New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

Lecture Notes for Exam 2

by: Madeline Abuelafiya

Lecture Notes for Exam 2 BIOL 5344

Marketplace > Southern Methodist University > Biology > BIOL 5344 > Lecture Notes for Exam 2
Madeline Abuelafiya
Molecular Biology
Dr. Vik

Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

This has lectures 11-17 which is all the notes for Exam#2
Molecular Biology
Dr. Vik
molecular biology, Exam 2, Vik, Lectures
75 ?




Popular in Molecular Biology

Popular in Biology

This page Bundle was uploaded by Madeline Abuelafiya on Saturday January 30, 2016. The Bundle belongs to BIOL 5344 at Southern Methodist University taught by Dr. Vik in Winter 2016. Since its upload, it has received 66 views. For similar materials see Molecular Biology in Biology at Southern Methodist University.


Reviews for Lecture Notes for Exam 2


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 01/30/16
Eukaryotic RNA Polymerase General Transcription Factors and 5 Capping Monday September 28 2015 BIOL 5304 lecture 14 Overall transcription in eukaryotes is rather similar to what we have learned about transcription in E coli There are two important distinctions in eukaryotes 1 There are multiple RNA polymerases rather than one usually 3 not counting mitoc ondna and chloroplasts 2 Initiation of transcription in eukaryotes requires numerous factors not just 1 sigma factor and these are called the General Transcription Factors In general eukaryotic RNA polymerases also require other factors in vivo because of the structure of chromatin Three types of RNA Polymerases in Eukaryotes A RNA Polymerase I Found in nucleoli where ribosomes are assembled Synthesizes only a transcript for the 2 large ribosomal RNAs B RNA Polymerase ll Found in the nucleoplasm Synthesizes mRNA precursors C RNA Polymerase Ill Found in the nucleoplasm Synthesizes several classes of small RNAS including tRNAs and the small rRNA We will focus first on RNA Polymerase ll The lO subunit yeast RNA polymerase II bound to an RNA DNA hybrid It is capable of RNA synthesis but cannot initiate transcription without the general transcription factors fun V I I f in y g 1quot Structural basis of transcription an RNA polymerase II elongation complex at 33 A resolution GnattAL Cramer P Fu J Bushnell DA Kornberg RD Science 2001 Jun 829255231876 82 Epub 2001 Apr 19 RNA Polymerase ll core promoter The minimal sequence necessary for initiation of transcription Elements found in core promoters are shown Not all are found in every core promoter many elements not just 10 and 30 like in the prokaryotes U pstream transcription begins around 2 FIg1315 Fig1214 TFIIB TBP TFIID TFIID TFIID TFIID 28 30 32 34 1 3L7 32 31 2l6 12 4 6 11 16 21 1 1 BRE 3mm Ijnr ioptgipcai GoG quot A cc ch c39rTc39 CTG39I A A quot Ag CCAccccc TATAQAT TTANATT GG TCGTG TFIIB TATA Initiator Downstream EOWnStI P am Recognition Binding Core E Om0tfr Element Protein Elements eme Another element not shown is the MTE found just upstream of the DPE Other regulatory sequences exist and are often found upstream of the core promoter They bind activators or repressors of transcription TATA is the most commonly found element in the core promoter but is not present in all Consensus sequence is TATAAA see below Its sequence is similar to the 10 region found in E coli but it is not considered homologous to it similar to the 10 in bacteria but not homologous alternating TA is a weak double strand that can be bent or melted it is a Chicken long way before the beginning of the transcription and its role is to be bent mmmmm CAGCCTATATATTCCCCAGCCCTCACCCACTGTCTGTICA thhls Adenovirus bent lme GGGGCTATAAAAGGGGGTGGGGGCGCGTTCGTCCTCICTC he not Rabbit melted swam TTGGGCATAQAACCCACAGCACGCCACCTGCTCCTAICACT Mouse B mmmmam GAGCATATAAGGTGAGGTAGGATCAGTTGClCClClCATTl A A m r53 I I quot831 gtI39 3r After F O39Hara K Perrm F Le Penna 2 JP Biz0315 C Ccchet M Breathnac R RO39QI A Garacm A Cami B and Crambon P Nsmre 278 433119751 Co 39yright 1999 John Wiley and Sena In All ngms lesewed n l O n 6 The exquisite control of transcription that is found in eukaryotes is the consequence of the actions of numerous proteins and protein complexes A key element of this is the action of the general transcription factors They are important for the initiation of transcription in eukaryotes Just as the E coli RNA polymerase core enzyme cannot initiate RNA synthesis without a 039 factor the general transcription factors are necessary for the initiation of RNA synthesis in eukaryotes They guide the RNA polymerase to the promoter while forming the PIC preinitiation complex Overview of Eukaryotic Transcription Initiation Fig 1316 TBPXJ TFIID y TATA box TFIIA39 O TFIIB TFIIF RNA polymerase II 2014 Pearson Education Inc TBP TFIID TFIIAB RNA polymerase II TFIIF TFIIEH PIC is formed Phosphorylation Polymerase leaves TA B L E 132 The General Transcrip tion Factors of RNA Polymerase ll GTFs Number of Subunits TBP l TFIIA 2 TFIIB l TFIIE 2 TFIIF 3 2 rather largeI39FllH 1 0 Human asgggliZfed 6 in two Copies with TBP TAFs TBP AssomatedFactors 1 1 l3 7 in one copy The numbers shown are for yeast but are similarfor other eukaryotes including humans There are some differences however for example human TFIIF has only two subunits and its TFIIA has three TFIID stands for Transcription Factor for RNA polymerase II class D TFIID contains a special protein TBP TATA Binding Protein along with about 11 others so called TAFs TB P Assoc i ated Factors inC39UdeS the TBF and TAFS To form the PIC TFIID must bind first to the promoter region It contains the protein that recognizes the most prevalent core promoter elellment TAJAQAA Ehe TBP n ta genes avet is utmost o TATA Binding Protein 0 10 This is TBP from Arabidopsis a plant The human version and that from archaea are virtually identical They all have pseudo symmetry meaning each half looks identical but the amino acids are not all the same Figure 25 13a The Xray structure of TATAbinding rotein TBP from the plant Arabrdopsls thah39ana Courtesy of Stephen Burley he Rockefeller University 11 When TBP was crystallized with DNA containing the TATA sequence the DNA was seen to be highly deformed and at an angle relative to the curved protein DNA is bent highly curved The TBP is binding along the minor groove and opening it up so the minor groove becomes very large and the phenylalanine gt planar aromatic can insert into the dna and bend it distorting the two strands Fig 13 17 2014 Pearson Education Inc In fact the TATA Binding protein sits along the minor groove A feature of an alternating T A sequence is that the minor groove can be readily deformed TBP has 4 phenylalanine groups near the quotstirrupsquot that poke into the stacked bases 3 39 39 O iquot I 39 39 I l c I 0 j I Iquot 1 v o u why does this sequence work To understand DNA all pieces of dna are about the same but there is something invisible also just looking at the crystale there is different sequences and properties that allow it to be bent and different ways cannot tell someone can bend there arms by a picture of them standing up straight Richard Dickerson has said that one needs to know both the structure of DNA sequences and also their deformabilities He likened this to understanding an arm which has a particular structure and certain ways of bending The TATAATAATN sequence is very special How proteins recognize the TATA box Juo ZS Chiu TK Leiberman PM Baikalov l Berk AJ Dickerson RE J Mol Biol 1996 Aug 16261223954 l 3 While the TBP can bind to the core promoter by itself it normally does so in conjunction with many other proteins Its distortion of the DNA provides the platform for addition of other factors First there are the other components ofTFllD the so called TAFs TBP Associated Factors TBP also interacts with two other general transcription factors TFIIA TFIIB 14 TBP DNADNA TFIIA The TFIIA makes contact with one end ofTBP they have B strands that are edge to edge TFIIA also makes some contact with DNA TFIIA binds to TBP and DNA The DNA contact can be seen when the ribbons are converted to space filling The distortion of the DNA allows this 2 point contact Crystal structure of a yeast TFIIATBPDNA Complex Crystal structure of the yeast TFIIATBPDNA complex Tan S Hunziker Y Sargent DF Richmond TJ Geiger JH Hahn S Lee S Siger P3 Nature 1996 May 9381657812751 Science 1996 May 1027252638306 15 TBP DNADNA TFIIB A 3 1 The 2 domains ofTFllB make significant contact with DNA as well as with TBP Again it is because the DNA is distorted from B form Fig 1318 Crystal structure of a TFIIBTBPTATA element ternary complex Nikolov DB Chen H Halay ED Usheva M Hisatake K Lee DK Roeder RG Burley SK Nature 1995 Sep 14377654511928 16 TFIIB binds to core promoter element BRE upstream of TATA TFIIB TBP TFIID TFIID TFIID TFIID 37 32 31 26 2 4I 6 11 16 21 28 30 32 34 F39g 123914 5 m m quotDPE ECE BRE TATA 1 W l GCG A Cc ch cmc CTGT39 A A quotAGC39 ccccc TATFQAT TTANATT GGTCGTG CCA V 4 Pearson Education me It also interacts with the RNA polymerase in part similar to the sigma factor of bacteria It initially inserts into the RNA exit channel and approaches the active site region This domain ofTFllB the B reader loop is most similar to the sigma 32 domain It is important for stabilizing the first nucleotides synthesized ie without a primer and for separating the strands after about 10 bp of RNA DNA hybrid Structure and function of the initially transcribing RNA polymerase TFB complex Sainsbury S Niesser J Cramer P Nature 2013 Jan 17493743243740 doi 101038nature11715 Epub 2012 Nov 14 17 TFIIB in Yellow and Magenta also contacts the RNA polymerase The magenta domain is in contact with TBP and DNA the upstream core promoter element BRE The yellow domain seems to enter the polymerase in the RNA exit channel similar to the E coi 039 factor lDownstreamDN L l Structural basis of l transcription an RNA upstream DNAquot polymerase TFB cocrystal y V at 45 Angstroms Slde TOP Bushnell DA Westover KD i Clamp Wall TFlllBN I Zn DaV39S RE Kornberg RD SCience 2004 Feb 133035660 l ack E Map l TFIlzBE TBP 9838 18 TFIID which includes TBP shown below from humans It forms a U shaped structure that can wrap around the promoter region of eukaryotic DNA The architecture of human general transcription factor TFIID core complex Bieniossek C Papai G Schaffitzel C Garzoni F Chaillet M Scheer E Papadopoulos P Tora L Schultz P Berger Nature 2013 Jan 31 4937434699702 l9 TBPX Q TFIID y TATA box TFIIAQQ TFIIB 030 A tail QKEED TFIF RNA polymerase II So far we have looked at the first step When the RNA polymerase binds to the promoter it brings a bound TFIIF TFIIF is a 2 subunit factor or 3 in yeast It stabilizes the DNA TBP TFIIB complex Fig 13 16 20 T BpxaTFIID TATA box rim Qul TFIIF RNA polymerase II a l awful 1 4 ll quot x quotIf V j quot 1137 39 Jquot TFIIE and TFIIH bind last to complete the preinitiation complex TFIIE has 2 subunits while TFIIH has 10 TFIIH has many roles 2 of its subunits are ATPases helicases involved in nucleotide excision repair 1 is a kinase and it is also involved in promoter melting and escape drives melting of dna 1636 Fig 13 16 21 A TFIIK kinase trimer Cc1 CyclinH Kin28 Cdk7be3 Matt 10 no39 139 i 39 39 u b I 39II quot quot 39 a 391 I quot y w F quoti 39 2 o 39 39 a J 39 o lquot 39 l39 Iquot 3939I at a i q v I 39 j x39 39 L 3939 39 quot 39 2 4 39 39 339 K u 39 a 9 39 139 e uquot quot 39 t J 0 39 39 I o Down stream DNA An overlay ofTFllH on the preinitiation complex It is larger than the polymerase itself It includes ATP clriven helicase activity and kinase activity It is necessary for the ATP clriven transition to the open complex Subunit architecture of general transcription factor TFIIH Gibbons BJ Brignole EJ Azubel M Murakami K Voss NR Bushnell DA Asturias FJ Kornberg RD Proc Natl Acad Sci U S A 2012 Feb 71096 194954 22 TBPlt1TF D The tail of the polymerase which TATAbox W3 contains repeatIng unIts of 7 amino acids containing serine residues wraps around the GTFs TFIF RNA polymerasell l Tyr Ser Pro Thr Ser Pro Ser tail 4 7 IZ39quotquot Lm X o v In humans there are 52 repeats last step is quotdrift39rie se AA can almost all be phosphorylated and is necessary especially Ser J Iquot I l TFI I E TFllm Transcription can begin when the tail is phosphorylated and when ATP hydrolysis by TFIIH drives helicase like activity to form the transcription bubble Fig 13 16 23 Transcription is even more complex The effect of activators can be mediated by the massive Mediator complex mediator interacts with RNA POL at the promotor and ha sea oplgary interactions to other active sites Various activators interact Wit i erent components of the details of the mediaigr is not well understood mediator They interact Wit distant sites in the DNA Chromatin remodeler and are reuird crtain o o ind the in 39 Hi suceo 39 tructur activator 1 ix x hromatin Mediator complex HAT Fig 1319 24 The mediator also contacts the tail of the RNA polymerase and influences its phosphorylation In addition other enzymes are necessary to activate transcription in chromatin as shown here chromatin remodelers and histone acetyltransferases activator g Fig 1319 25 Both human and yeast Mediator contain about 20 protein subunits Many are found in both The roles of individual subunits are not known in general The subunits form modules and there may be several distinct forms of the mediator complex Much remains to be learned about the role of this important complex in transcription human Mediator Fig 1320 26 Copyright 2008 Pearson Education Inc publishing as Pearson Benjamin Cummings Electron microscopy has provided images of the yeast Mediator complexed to RNAPII lower right image It can be seen that it has multiple contact sites and therefore the interactions are likely complex MERLE Medlg very large c Med4 Middle many domains 0 head tail middle domains 0 Med10 O Med8 Withrgggrent O Med31 c Med la know what is TAquot the mediator 0 4quot I v ti and what does it do 552i Menu Subunit architecture and functional modular rearrangements of the transcriptional mediator complex Tsai KL TomomoriSato C Sato S Conaway RC Conaway JW Asturias FJ Cell 2014 Jun 51576 143044 27 The Elongation Phase of RNA Polymerase II General transcription factors dissociate from the polymerase Mediator is also lost The next step is the binding of a new set of factors These include elongation factors TFIIS and SPTS Other factors such as those involved in RNA processing bind to the phosphorylated CTD of the RNA polymerase II C terminal domain Let s look at TFIIS It is not only an elongation factor but also works as a proofreader It helps prevent RNA polymerase stalling and it also catalyzes hydrolysis of the RNA 28 TFIIS in red was diffused into existing crystals of the yeast RNA polymerase II It is highly extended and reaches into the RNA polymerase towards the nucleotide binding site This might remind you of GreA from E coli Architecture of the RNA polymerase IITFIIS complex and implications for mRNA cleavage Kettenberger H Armache KJ Cramer P Cell 2003 Aug 8114334757 29 TFIIS and GreA seem to carry out the same job although they are not related GreA has a coiled coil of 2 0 helices while TFIIS is merely extended with a zinc ribbon domain at the end Both coordinate a lvlg ion to catalyze hydrolysis of ribonucleotides near the active site The released nucleotides are typically dinucleotides for paused polymerases or 7 9 nucleotides for fully arrested polymerases A binding site for 8 nucleotides opens up So it functions in proofreading also 3 upstream DNA incorrecgggaggnisgincorportated gt slow down pause stall 41quot fig15 00 speeds up transcription and corrects it flap l I l I39ll metal A w metal A 3913 lt34 39 t l pore secondary channel 2912 5 V it v quot 3 393 3 15 ff l 4 7 mg backtracked RNA backtracked RNA Fl g 1 3 2 2 yeast RNA polymerase II bacterial RNA polymerase TFIIS and GreB two likeminded transcription elongation factors with sticky fingers Conaway RC Kong SE Conaway JW 30 Cell 2003 Aug 81143272 4 Other elongation factors are members of the ELL family They also reduce pausing of the RNA polymerase and hereby increase the net rate of transcription A kinase PTEFb is also an elongation factor It phosphorylates the position 2 Serine in the RNAP tail It also phosphorylates and activates another elongation factor SPTS involved in 5 capping And it recruits another elongation factor TATSF1 Another issue for the eukaryotic RNAP during transcription is due to the structure of the nucleosomes 31 In humans the efficiency of transcription through nucleosomes is enhanced by a factor called FACT facilitates chromatin transcription FACT is composed of two parts SSRP1 and Spt16 Removing only part of the histones is sufficient to allow transcription as shown below nucelosomes structure is stable but must be partially taken out which is just enough for the RNA POL to be able to go around the circle become some of the dna will always be bound to the histones RNAPII H2AH2B dir step 1 histonesI H2A I H28 I H3 I H4 H2AH28 dimer I l step2 xJZC39A39oDears1nEL2Cd2I w During elongation the CTD C terminal domain of the large subunit of the RNA polymerase II acts as a docking site for numerous proteins Its extent of phosphorylation at several sites Changes during elongation due to the activity of kinases and phosphatases 1 J capping enzyme components of polyadenylation splicing machinery and Ceavage factors b phosphorylation stage of RNA processing 39 state of CTD tail transcription factors recruited 7 aa reSldue N l C reinitiation Re eats Y s P T s P s b p p 1 2 3 4 5 6 7 Human 52 N m C romoteresca e ca in rmmm quot quot Yeast26 N P C elongation splicing Y S P T S P S g 391 V2 3 4 5 6 7 Flg 133921 33 There are 3 types of processing events of the mRNA that occur during elongation and after termination 5 capping splicing 3 polyadenylation capping enzyme components of polyadenylation h splicing machinery and cleavage factors quot1 D arson Education Inc Splicing is the most complicated requiring the excision of many internal segments of mRNA in the transcripts of higher organisms We will look at capping and 3 polyadenylation next time Fi 1321a g 34 The first processing event is the 5 capping This occurs when the transcript is only 20 40 nucleotides long Capping is stimulated by the elongation factor SPTS There are 3 essential steps in capping but additional steps might also occur 5 capping a g 1 i Q N H RNA 7 happens right away whe 39 sUSPTS involved in stimulating the c capping enzyme components of polyadenylation splicing machinery and cleavage factors 6 2014 Pearson Education Inc Fi 1321a g 35 RNA Triphosphatase In the first step the 5 phosphate is removed from the mRNA by an enzyme called an RNA triphosphatase 7 methyl Fig 13 24 36 7 methyl Guanylyl Transferase It binds to the CTD tail of the RNAP In the second step a GTP reacts with the 5 phosphate of the mRNA It creates an unusual 5 5 linkage including 3 phospho groups PPi is released Fig 13 24 37 The guanylyl transferase shown in blue and cyan crystallized as a dimer but it functions as a monomer The RNA polymerase CTD binding sites are indicated by the yellow and green peptides Shown are 17 residues of the heptad repeat with Ser 5 phosphorylated The guanosine to be added is indicated in red The guanylyl group is only transferred to the RNA if the polymerase is phosphorylated at the Ser 5 position by a component of TFIIH the kinase CDK7 The lower domain binds the RNA phosphatase Structure of an mRNA capping enzyme bound to the phosphorylated carboxyterminal domain of RNA polymerase II Fabrega C Shen V Shuman S Lima CD Mol Cell 2003 Jun1161549 61 38 IN 7 methyl 2014 Pearson Education Inc Methyl Transferase In the third step the newly added nucleotide is modified with a methyl group at the N 7 position of the guanine Fig 13 24 39 Hg ii A closer look at the 5 cap of an d mRNA 3x 7lclhyl 3 7 quot Several other modifications are t P quot ii ii quot 0 i 0 m Ai possbe 3 ll ll 0 P i If the second base is Adenine it 0LO Maybe can be modified by N 6 l NOmeh quot18 ed 0 o Bag if A quot methylation fl L39 f 2quot Finally the 2 OH of the first two l I o o o 0 3 nucleotides of the original mRNA 7777 P171 0 can be methylated i Haw recognition and protection CI m These modifications serve to 2 Wily chemically stabilize the mRNA 1H 0 and tag it for recognition by the if Ccpwighl 1990 hhn Wiley and Sans Inc All rights reserved translation machinery 4o l I 41 Self Splicing Introns and Regulation of Splicing Friday October 2 2015 BIOL 5304 lecture 16 Another view of the splicing pathway snRNPs only 539 A 3 III III lJl E complex 4 A W U7 A U 5 U4UE B complex A complex C complex Catalytic ac va on BAU1 complex Stark H Liihrmann R 2006 Annu Rev Biophys Biomol Struct 35435 57 How was the mRNA splicing of eukaryotes discovered In adenovirus which pieces together its transcripts from a single primary transcript Box 14 1 Flg 1 primary transcript gt tripartite leader I I ber q DNA 3 I I I I I I I I I I I 0 1O 20 3O 40 50 60 70 80 90 100 map units 9 2014 Pearson Education Inc Each virion protein is coded by a message that has an identical 5 end each of the 3 small piecestripartite leader plus a downstream coding region hexon or fiber Phillip Sharp Spliced segments at the 539 terminus of adenovirus 2 late mRNA 1944 Berget SM Moore C Sharp PA I993 NObEl Prlze 3 Proc Natl Acad Sci U SA 1977 Aug74831715 Physiology or Medicine Visualization of mRNA DNA hybridizations revealed that the mRNA sequences did not match the DNA a b DNA cut with restriction enzyme 0 O 3AA mRNA with polyA tail 539 cap incubate with hea ng R loop 0 o displaced DNA strand C x l H 391 7r 39l jfr 7v39 gq v r 39I39 quot39 739 qquot 9quot 39 139lt39 39V 1 3939390 39 1 quot39 O quot i 39 I 39 quot aquot 39C l 1 39Iquot 39I 1quot39 n 1 I39 39 39 539 y r f quotquot 139139 rt u el39uv sv39 w a 3 v is 1733 o r n l 14 39nl 39ru3939 VZ JHJ 39O v 6 20394 Dearsm Educamn 39tc Box 14 1 Fig 2 4 Are the 5 excn and the 3 excn that become spliced always adjacent in the transcript No sometimes an excn is skipped can be an accident or part of a mechanism to get a desired product Excn skipping is one example of alternative splicing Must the 5 exon and the 3 exon originate from the same transcript No if they come from different genes it is called transsplicing This is rare in general but common in some species For example in C eegans all transcripts receive a 5 end by trans splicing Trans splicing generates a Y shaped product rather than a lariat since there are two distinct introns RNAI RNA II exon 1 exon 2 I I I I 539 E E 339 NO Iariet 2 exons b anchjoined together AAG 339 Fig 14 1 2 The Minor Spliceosome A minor spliceosome also exists which uses some of the same components U5 and several distinct ones U11 U12 The intron ends are defined by AT AC rather than the conventional ET AC It has been suggeesetglmgstmrgrereztarrp ef the spliceosome evolved from Group II introns and later gave rise to the standard splicing pathway Fewer than 1 of introns are excised by the minor spliceosome Tarn WY Steitz JA A novel spliceosome containing U1 1 U12 and U5 snRNPs excises a minor class AT AC intron in Vitro Cell 1996 Mar 8845801 ll The AT AC spliceosome The Chemistry is identical to the standard CIT AC spliceosome U11 and U12 are analogs of U1 and U2 U6 and U4 are different but analogous U5 is identical Fig14 13 9 1 U1 43353 U2AF65 35 3 A i339 U5 gt U2AF65 35 V V 3 5 a AI 3 F U1 9 U6 U4 U2 s i 1 fj 339 r U4 U5 U6 U2 5 A A3 ti 1 IA 3 539 339 The most commonly found pathway of RNA splicing requires a spliceosome Two other types of splicing have been discovered that are selfsplicing 10 TABLE 141 Three Classes of RNA Splicing Cata tic Class Abundance Mechanism Machinery 2 Major and Nuclear Very common most f remRN A eukaryotic genes transesterl Icatlons ominor p branch Site A Spliceosomes Rare eukaryotic 2 Selfsplicing Group II organelles amp transesterlflcatlons catalytic lntrons prokaryotes branch Site A Intron Rare nuclear rRNA 2 Selfsplicing Group I organelles amp some transesterlflcatlons catalytic lntrons prokaryotes branch Site G Intron G is a free nucleotide and is not part of the intron ll How do self splicing introns work The Chemistry of splicing Group II introns is like the spliceosome a premRNA spliceosome b group II selfsplicing c grouplseIfsplicing m0 1 1 539 OH339 339 5390H339A3 339 Cy 6 1 l G 539 339 539 339 D1986Esevm 14 8 Group I introns require a free guanine nucleotide or nucleoside The 3 OH of the free G attacks the 5 splice site It ends up covalently linked to the 5 end of the intron a premRNA spliceosome b group II selfsplicing c groupl selfsplicing I i 39 m0 39 39 339 539 W Important features of self splicing introns They are in the range of 400 1000 nucleotides and they have conserved sequence elements In particular the Group I introns have a special sequence that enables it to bind a C This works with an IGS internal guide sequence that is complementary to the exon at the 5 splice site so that the G will attack the correct bond Self splicing introns are also often bound to proteins that help to stabilize their structure Nucleic acids always carry negative charge that is repulsive Proteins can neutralize the charge Proteins are not necessary for the splicing reaction as demonstrated by experiments at high ionic strength where the proteins dissociate l4 premRNA 1 ecu ua A exon 2 39 OH 3 1 exon GU group II domain 5 A quotL 0 r T quot 339 60 intron 39 5 rsnn I rlu Fig 14 9 Group II introns Secondary structure is similar to that of the RNA VinsnRNPs This indicates a likely evolutionary relationship The snRNPs reducethe sequence requirements for splicing in most current mRNAs 15 Complexity of a Group II intron Domain IV can contain an open reading frame many stem and loop structures TCTf c i39 i o C j 3 1 IV II a 0 xx G 331 3 r I 3 B h39 5 Exon 3 Exon ranc Site adenosine 16 This group II intron encodes a reverse transcriptase A M38381 B C RT BOOaa39 539 339 3 E1 Intron 12 kb E2 539 39 ifquot 39Vquot Transcription l om 39 quot Translation E882 EEJ on C quot x 39 5 GUGYG A AY 3 is 5 E1 w 52 D quot391quot V M 7 RT 39 N A EBS1 t I851 ProteinAssisted 1T w quot sf a RNA Splicmg 39839 t 3 E883 039quot 9 Tiquot Intron RNA I j IBS3 E u u l DIV 539OH 339 quot2 8 390 E1 U 52 DH I g IBS2 L Branch quot point E1 E2 Intron RNA E1 E2 H RNPs Biotechnological applications of mobile group II introns and their reverse transcriptases gene targeting RNAseq and noncoding RNA analysis Enyeart PJ Mohr G Ellington AD Lambowitz AM Mob DNA 2014 Jan 13512 doi 1011861759875352 17 This is the catalytic fragment of a Group II intron It proceeds via a quotlariatquot intermediate and requires an adenine base for a catalytic 2 OH This A is shown protruding from the Structure in ttbsrltrargsrtrsarsms llgltlselmal to the reaction A second group involved in catalysis is visible in the lower region cyan Most of the rest of this intron is double helical Structural insights into group II intron catalysis and branchsite selection Zhang L Doudna JA Science 2002 Mar 152955562 20848 Epub 2002 Feb 21 18 Two complete Group II introns illustrating the compact structure 9 1K 3 3 a s A 39 got 5 23 quot 3 9 4 1 39 w I 39 1 I w 5 3 I s o quot Thuquot Domain VI O iheyensis P littorais Crystal structure of a eukaryotic group II intron Iariat A R Robart R T Chan J K Peters K R Rajashankar amp N Toor Nature 2014 Published online 24 September 2014 19 A Group intron caught after the first reaction The first bond is broken near the yellow base Notice the tightly wound compact structure of the RNA and the role of a protein to stabilize the structure blue 5 a c group I selfsprout 39 H quot L s I 2 l 5 K G 3 V 3 end of the 5 exon k 3 end of the intron3 exon U r Structural evidencefor a twometaIion mechanism of group I intron splicing Stahley MR Strobel SA Science 2005 Sep 23095740158790 2 O Self splicing introns are examples of catalytic RNA but they are not true enzymes since they only function once However a Group I intron can continue as an enzyme carrying out a different reaction if provided with the correct substrate and an ample supply of free guanine nucleotides The excised intron retains its C binding pocket and IGS internal guide sequence 21 RNA The green RNA molecule provided must have a sequence complementary to the intron s guide sequence The RNA will be cut into two pieces at the junction defined by the 5 end of the guide sequence A G will be added to the 5 end of one of the products ribozyme an enzyme Tom Cech 1989 Nobel Prize in Chemistry 1947 539 339 Hear Tom Cech describe how they BOX 142 Hg 1 563 discovered that G was necessary for 2014PearsonEducationInc I Errors in Splicing 1 Exons can be skipped a exon skipping exon 1 2 3 DNA 8 1 pre mRNA incorrect I l 5 3 exon 2 is overlooked treated as part of an intron Fig 14 10a 23 Errors in Splicing 2 Non splicing sites can be mistaken for splicing sites b pseudo splicesite selection Fig 14 10b exon 1 2 a 539 T 339 pseudo splice site 539 339 exon 2 is truncated an internal site is used as the splice site 24 First mechanism to minimize the chance of using incorrect splice sites capping enzyme components of polyadenylation splicing machinery and cleavage factors E 2014 PearSOn EdUCGlIOn inc splicing is going on as mRNA is being made so the machinery can gather on the mrNA and the nect exon that is synthesized it can begfr gci gdcgdsef eli I fgreo ra xcof ag fprmed pang triigreri p t beHrgpIi e and become components of the splicing machinery bound to the CTD of the RNA polymerase Splicing begins before transcription is completed Therefore the next 3 splice site can be selected before others have even been synthesized Flg 1321 25 Second mechanism The possibility that incorrect splice sites are used is further minimized by special exon binding proteins called SR proteins for being Serine Arginine rich They bind to special sequences called ESE exonic splicing enhancers They recruit the initial splicing factors U2AF65 35 proteins and snRNP U1 to the nearby splice sites e U2AF65 35 YYYY AG V 39 ESE ESE intron exon intron exon intron 920 4 Pearson Education inc Alternative premRNA splicing and proteome expansion in metazoans Maniatis T Tasic B Nature 2002 Jul 114186894236 43 Review F g 1 41 1 Alternative Splicing Exon skipping is not always a mistake Some splice sites can be turned off leading to alternative splicing pathways Up to 90 of human genes might be alternatively spliced 1 2 3 5 spliced mRNA 539339 spllcmg octroponin T primary exon 1 2 3 4 5 RNA 5 I l 339 transcript spliced mRNA 5 splicing Fig 1414 The choice of using exon 3 or 4 can be regulated Both spliced transcripts could be produced simultaneously in some proportion Or only a single product might occur in some circumstances Such exons are sometimes called cassette exons and often occur in pairs such as 3 and 4 above 27 The number of possibilities becomes large as the number of introns increases intron 1 2 s 1 1 exon 1 2 3 ltranscription primary RNA 5 339 transcript 1 3 lt gt N 1 l S39 is39 S39 Es39 539 339 act339 539 Z339 l l l l sp ced 539339 539 339 539339 539 339 539 3394 4 mRNA 1 2 3 1 3 1 2 3 1 2 3 1 2 normal exon skipped exon extended intron retained 539 339lt 1 3 alternative exons lt9 2014 Pearson Education Inc Fi g 1 4 1 5 28 An quotextended exon example from the SV4O virus It produces 2 versions of the T antigen designated T and t stop 5 SST codon 539sst 339SST l l i D 1 exon 1 2 primary 1 regulated by SR protiens if presest or absent they will go one way or the other 2 RNA 539 u 1 339 511 1 339 transcript l l 539 3b0th proteins are funCthHal 539 339 protein N u C longer mRNA makes N C tag Tag 5 2014 Pearson Education Inc there is a stop codon shorter mrna longer protein The larger message makes the smaller protein The ratio of the 2 forms depends upon the level Fig 1416 of splicing protein SFZASF an SR protein The two T antigen proteins have different roles 29 The most commonly found type of alternative splicing is one in which complete exons are included or excluded For example there might be 2 exons and one or the other is always included but never both ie cassette exons There are several mechanisms used to ensure mutual exclusivity in such splicing Steric Hindrance Combinations of Major and Minor Splice Sites NonsenseMediated Decay 3O Steric hindrance can operate if an intron is very short as in part a intron 2 The binding of U1 at the 5 splice site prevents the binding of U2 at the 3 splice site In part b the 5 splice site works with the next available 3 site This generates exons 1 2 4 In c it is 1 3 4 a used when one intron is very small s Fig 14 1 7 31 Another way to ensure mutually exclusive splicing is for an intron to have mixed splice sites As shown below the central intron has a 5 splice site for the major spliceosome and a 3 splice site for the minor spliceosome In this way either the second exon or the third exon is used but not both not possible for a single splicesome to remove the intron so the minor splicesome can come to the 3 minor and cut to the 5 minor eliminating exon 2 if the 5 major splicesome ensures number 2 and 3 exon cannot both be in the final product ENSURES a 539 minor 339 minor 339 minor exoni ACME 539 major 539 major 339 major iii 2014 Pearson Education inc Fig 14 18a 32 Nonsense mediated decay NMD can ensure that messages containing both exons are degraded For example the inclusion of both exons 2 and 3 might generate a second stop codon UGA which leads to destruction by the NMD system b 1 2 4 M dqes not ergure but qan be looks for stop codons which are not supposed to be in the middle of the tr sctipt so it will degrade it because it can recignize that it is incorectly spliced exon1 x 2 3 4 A v V i Fig 14 18b U G A U G A gt degraded 2 3 4 exon 4 exon 6 exon 9 exon 17 12 alternatives 48 alternatives 33 alternatives 2 alternatives genome I I I I t Fig 1419 DNA and Il premRNA a A I 1 Down RNA39 1391quot nr ti rm Syndrome m i l 17 Cell Adhesion Molecule transmembrane segment 1 protein m C I w l I l l l lg repeats fibronectin lg domains repeat In Drosophila Dscam is an example of mutually exclusive splicing Its message agggygygtgrgpggms exactly 24 exons genes do not correspond to protein number 20 of the exons are always the same but the other four have from 2 to 48 possibilities resulting in 38016 possible isoforms Part of the need for such diversity is that this protein functions in the innate immune system of Drosophia 34 Dscam splicing is accomplished not by one of the mechanisms previously mentioned but in a completely different way It involves interacting RNA sequences within the unspliced message as shown below selector sequence docks at the docking sequence removing the docking site only happen once because the docking site is eliminated amoung the first splicing quot d docking site J F 539 1 rm 9 l 39 d AU r0slAth A gt l exons to AAAUUGAAAlQMs LAM ueaw 9949996696699 j DUJiA UUU UGGGCOUACAUCCEUAVcAU A UUGUUA I A P iexon 61 n II selector seque A 68 C exon 620 exon 621 k F H K Fig 14 20 35 In this example exon 5 will be spliced to the exon 621 that is the 21 st of the 48 alternatives A sequence just upstream of exon 621 the selector sequence can base pair with a sequence just downstream of the 3 splicing site of exon 5 the docking site docking site quot s39 c 1 l l f m quotG K c l x lAW AllU A UL l j A A I l 555999555 W 9 QGW 95999 595599 ACAUCCUACAf iAUGAGUUGUUAC exon 5 O r 1um uuu UGGGCU I Ajj I selector sequence A X exon 620 J exon 621 Fig 14 20 36 In addition splicing of the other exons 6x is inhibited by a general repressor of splicing called Hrp36 This repressor functions by binding to the other splice sites By unknown means the docked exon 621 here is not subject to the same inhibition docking site 539 V f w j 6 G I 39 quot WU Z rm 1A let J exons v AMWGAM WMG G W Guecuceasaeus Iriumccuuu U ee u rACAu uAWrcAUGAGUUGUUACx mtg fA l39lexon 61 I selector sequence 2 exon 620 7 exon 621 i h W 39 Fig 14 20 37 c gtgtoc co gt0 gt w mmmgtgtco COOgtC OOCgtOCOOgtOgtgtCO m C IIICC gtOCC OOOCCOO gtgtOOOCO OCII O OCgtC C gtgt gt gt gt c Igtgtgtccm mcmomm gtmcmmm gtooocgtocoogtogtgtco ocoomgtooogtoccogtgtooocgtcccllz o CC gtgtgtOgtgtgtgtOCOOOCOgtgtCOCCOOOgtCgtOQOCgtOCOOgtOgtgtCO ZICCCCCCCCOC0gtOgtOCCgtOgtgtI gt gt 00 O C C gt C 2lgtgtgtmagt ocmmm0 000gtC9mOmCgtOCOOgtOgtgtCO C A gtgtOCCCCOgtOOQgtOC CCOCOCOCOIIZ OO gtgtgtCCOgtgtgtgtOCOOOCOgtgtCOCCOOOgtCgtOOOCgtOCOOgtOgtgtCOIE H gtgtoccogtogtooagtoccaogtgtooocgtI CO C gt ogt aaamcmagtgtaocmmmioaamimmo cgt000cgtocoogtogtgtco i m M H m cccgtooccccooooogtocgtogtgtoogtgtmcco0039 CC coomimafm mmma Ommcgtocoogtogtgtco o 4 gtc00gtccgt0 gtOOOC OOOIIE c 0 zlt mgtoccc ogt 6 mo UmwGOJ mucnmzo in a 692 00 608 a w 699 05 629 93 699 mow 699 m 602 mmn 0x0 3 m cs cm mmmn8 mmgcmsnm wmsgmsm 0 03m 8 9m molasm mzm mltltmltm 9013330 Esgmsm 0 m3 9 rm 015 dim 3 9m mvznmsm 3Emlt manmZm mm SE a The docking site and selector sequences were discovered through a bioinformatics analysis The sequences of 10 species of Drosophila and several other insects were compared The docking site emerged as the most highly conserved region of the 60 kb gene 10 20 30 40 Dmelanogaster 39 v x Dsimuans w 3 r39 39 t x KnitIsl quot Veilquot n39 uu39t fz Dyakuba v 39 39 39 39 f39 1 111if51quotquotcquot39s39 39 39 A quotP Derecta 39 w r39 39 u quot 39 39 w Dananassae D pseudoobscura D persimilis D mojavensis Dgrim5hawi f39 A quot 39 quot f if w m 39f t39Ygz afuw tv39Ll c it Agambiae t 39 39 Y w 39 GTG Aaegypti quot TGTGT Bmori 39 Aratc j fuW39t39s3 ng TTM Ameiffera quot 6 0 Tcastaneum CTTGI i quot39 iiiTsw 3J XM4th7quotEquotL39 TTGCTE39CTCRAAC Box 14 3 llllll C 2014 Obaer Edimush IN 3 9 chI 6 24 GTCATTGTCGAGAGCTC I39I TACATQQMTgc 64 GGC I TTTCCAGTACCCA39ITATCAGG I39I AGTQWQ fccgddi39mrc CAATTAGACAGAGG 6 22 CAGCTCAATCGTATCC Mchg Gm 39Ifr quot fTAAACAC39I TAAGAmA 6 17 CAGCTGTCAGGACT39I GTC QAG K rr mrcc 6 34 T39I CAG ccc TTAGAW mxaa c 6 1o GTGGGT39I TCCC meg rm a e e u 64 GGTMACCC AAC f 6 6 GTCAG I CCCT o Tc d 39rc q r I 6 38 ccmmcc Garcd icm rr deTAwArACAATmTTGGTT 6 33 G cc TTGAA ggg cncsmcmmccma 6 15 TGCCC 39I CCA Tijr w T 68 chr AGGC 12quot 6 14 GTCGmCAncrArcd c 39r TmGAm39r 635 chr quotAch Ar quot ATGTCCGCGATAGATT 6 9 TACT39I39I AAA I TAAAATCM 39 39 c AATAAGGGA 6 1 TCA AGTCamp TCG 63111 quot AC I TC I TA 6 41 CTCAGGCGTTCCCCGTI39CCCATCA 9rquot RAG Accmu CAGGCTTCTAGGTT 63 cc TATC quot GHA 39C P I TCGA 6 31 TTGGGAATCAGTGT TAT 794193 ATGGAGTTGTTAGAGC 6 37 GGTAA GCC A Trc i 4 AGTAA 6 29 GGTGA I TCTGC I CAGA u trim A AG39I TATGGCT 6 32 Tcmmcm rdccmT air cuij 6 39 TGTTGATAAAC grew iati p fay A 6 23 GAGTGCCCTGGTTGCCT I 43 c 433311571 CAT GGTCT 6 7 TATCCCTGAc39r39r39rm 9931133139 cur TGAG39I39I39AGG 6 42 GCC I TGATC CGTfIquot uV g fi wit ATAGAGATT 612 mcrcmcncc vr i i gfasc V124 6 26 CCCCATCCQTTTC quot ur e39 z Ij1i39 ACTAGAC IquotI CGGTT 6 2 ACCCAGAGGA 5 6 64612711 CAA I TGAGATTGCTCGC 616 cccrc39rncc oi 21mg jig AGCAT GGC 619 CTC39I G39I CTT I I 3335152141141 MAG39I39I CC I T39I AGCTGATAGGT 6 25 TGTCGAGTT 4 a 39 crev39a Vcrnma MT CTCAG CACGGGTT 6 20 CATTGCTGAGT c CAGG TCATGAGA39I39I GGG 621 CATTGTTG G d 39 f CCATTTACATAGAATGTTTAGAAGC 6 5 TTTATGd caACT 39xts39a quot e TAGA 636 ACCCCG quotravage 39r 39erGCGmAGC39r 6 13 AACA T 631113 214 ATTG 6 27 ATCC GTT 4 391 rr n 4 c TTCAAACTGA m 68 ATCQ E I r39w ifi a39i CGG39I39I TAC39I39I AG 644 ACC quot A39IquotI AAGCGAC 64o Acc rcu w 1 CTG I TAGGGTTCAAATAGA 6 43 TTT 6 30 cc J14 6 48 cc Iquot f t cfcits AAATAGCAT TTCAAATAGGGATCTTA 645 quot quot quot CTTAGAAGGCT 6 18 C39I39I AAAAAGA 39I C I39139CT391 AAGCA 611 w CGAA TTCAG one 6 46 r CAATA AGTAGA C39IquotI A ttg lglii ii G G 2014 Pearson Education Inc l The selector sequences are not as highly conserved shown here for the Drosophia melanogaster gene They have an overlapping core of conserved nucleotides In the lower pictogram the height of each letter represents its frequency of appearance among the sample From this one can write a consensus sequence Box 14 3 Fig 2 4O 41 Bacterial RNA Polymerase Chapter 13 Wednesday September 23 2015 BIOL 5304 Lecture 12 The 2 DNA strands can be called template and non template The RNA is complementary to the template strand and it is equivalent to the non template strand substituting U for T Nontemplate DNA strand DNA duplex 39 h l I l V o 39 b 1 i s 391 I 339 Ly lIA iulaquot ll II IL 39 II llquot I 539 RNA 5 a template strand Fig 134 I believe this terminology is less ambiguous than sense and antisense 5 ACUUGGCCGGCAGUACUGACG RNA transcript DNA 5 ACTTGGCCGGCAGTACTGACG non template sense 3 template antisense can go to the protein sequence automatically with the sense non template version although non template doesnt do anything it is the more important strand If a DNA sequence is written as a single strand it is customary to write the non template strand with the 5 end at the left Then the RNA transcript will be essentially equivalent to the DNA sequence and later we will be able to read the codons for protein synthesis left to right There are several important differences between DNA synthesis and RNA synthesis RNA polymerases do not require a primer to get started The RNA provides its own template DNA duplex I I If I I 9quotquot quotMNquot A template strand Fig 131 RNA synthesis does not require complete separation of the DNA strands but only a bubble The newly synthesized RNA strand does not remain base paired with the DNA template strand Does not require complete separation of the two strands RNA is its own helicase separates the strands enough for its own purposes DNA duplex i H I 39quot39i39 I l l i I i 5 i i g template strand H 134 Copyright 2008 P eeee on Education Inc publishing as P eeee on B eeee min Cummings g In fact many RNA polymerases can be copying a single gene at once one just after another An RNA DNA hybrid was determined at high resolution for a bacterial RNA polymerase The enzyme is not shown so that the nucleic acids can be seen RNA is in magenta Template DNA is in cyan and non template DNA is in yellow The red template nucleotide is unpaired and ready to base pair with the next ribonucleotide to enter the catalytic site Structural basis for transcription elongation by bacterial RNA polymerase Vassylyev DG Vassylyeva MN Perederina A Tahirov TH Artsimovitch Nature 2007 Jul 6 12448715015762 The accuracy of RNA synthesis is not nearly as high as in DNA replication 1 mistake in 10 thousand vs 1 in 10 million Proofreading does exist in RNA synthesis but overall the system to ensure accurate sequences is not as great as for DNA There is also some RNA repair such as from alkyl transferases but there are not as many systems as in DNA repair Why is it less important for transcription to be accurate than it is for replication DNA is passed to the next generation Whereas mRNA is used by a single cell for a limited time The most significant difference between transcription and repHcann The entire chromosome is replicated the emphasis is on accuracy Only selected regions of the chromosome are transcribed the emphasis is on Where and when to begin transcription not all genes will be transcribed and Where to end it Details of the regulation of transcription will be examined in the last segment of this course Almost all RNA Polymerases are related not the case with DNA polymerase doesnt equate between animals TA B L E 131 The Subunits of RNA Polymerases Prokaryotic Eukaryotic Bacterial Archaeal RNAP l RNAP II RNAP III Core Core Pol I Pol II Pol III B A A RPAl RPBl RPCl B RPAZ RPBZ RPCZ a39 D RPCS RPB3 RPCS oz L RPC9 RPBll RPC9 1 K RPBo RPB6 RPB six others nine others seven others 11 others The subunits in each column are listed in order of decreasing molecular weight Adapted with permission from Ebright RH 2000 Mol Biol 304 687 698 Fig l p 688 Elsevier 3955 2514 Pearson ca r Surprisingly mitochondrial RNA polymerases are related to phage RNA polymerases and consist of a single polypeptide RNA polymerases l and III are specialized enzymes for rRNA and tRNA genes TA B L E 131 The Subunits of RNA Polymerases Prokaryotic Eukaryotic Bacterial Archaeal RNAP I RNAP II RNAP III Core Core Pol I makglq oMRA Pol III B A A RPAl RPBl RPCl B RPAZ RPBZ RPCZ a39 o RPCS RPB3 RPCS aquot L RPC9 RPBll RPC9 x K RPB RPB6 RP86 six others nine others seven others 11 others The subunits in each column are listed in order of decreasing molecular weight Adapted with permission from Ebright RH 2000 Mol Biol 304 687 698 Fig l p 688 39 Elsevier Po1 and Po3 are related 423214 Pearson EducatIOr m make SpeClallzed rna Note the similarity of Archaeal to Eukaryotic 10 Overall structure is similar between bacterial and yeast RNA polymerases colored similarly upper T aquaticus B purple 5 blue 20 yellowgreen 00 red lower Yeast RPBl purple RPBZ blue RPBB yellow RPBH green Fig 13 2 RPBb red ll Another bacterial RNA polymerase from T thermophilus colored similarly Structural tutorial U 5 4 Crystal structure of a bacterial RNA polymerase holoenzyme at 26 A resolution Vassylyev DG Sekine S Laptenko 0 Lee J Vassylyeva MN Borukhov S Yokoyama 8 Nature 2002 Jun 134176890712 9 12 Roger Kornberg was s g k H awarded the Nobel quot I 39 Prize in Chemistry in 2 o 2006 for his work on quot 39 the yeast RNA Polymerase II This is the lO subunit enzyme l23568910l 112 PNAS August 7 2007 vol 104 no 32 I 1295512961 The molecular basis of eukaryotic transcription 39 Roger D Kornberg 39 Stanford University School of Medicine Stanford CA 94305 5400 lfy L 391 39 r J I am deeply grateful for the honor bestowed on me by the Nobel Committee for Chemistry and the Royal Swedish Academy of Sciences It is an honor I share with my collaborators It is also recognition of the many WhO have contributed over the past quarter century to the study of transcription 13 RNA j Transcription w if proceeds through 1 several steps that can be Classified i into 3 phases l 1 Initiation l 2 Elongation I gt l E 3 Termlna tlon alri iizsseV v and releases RNA 1 4 CD 2014 Pearson Education inc Fig 13 3 A promoter is a DNA sequence that binds the RNA polymerase directly or through other proteins The actual transcription start site will be nearby The first nucleotide copied is designated 1 The downstream DNA is transcribed The upstream region designated by negative numbering is not promoters numbered negatively as well as upstream DNA R39lIAquotquot polvgsei upstream downstream DNA l W DNA J promoter 1 binding N a 1 closed complex I I 15 The RNA polymerase must undergo conformational Changes from a Closed state where it binds duplex DNA to an open state where about 13 bp of the bound duplex DNA is melted to form a bubble This renders the template strand able to serve as a template binding closed 39 complex promoter melting t open is Fig 13 3 mp39ex i The transcripts are synthesized from their 5 ends to their 3 ends Or the next nucleotide is attached to a 3 OH just as in DNA replication No primer is necessary the first 2 nucleotides enter the active site and are eventually joined The complex of enzyme DNA and RNA is rather unstable at this point and often falls apart until the transcript reaches gt 10 nucleotides promoter j melting t open 33 complex l initial transcribing 39 Fig 13 3 complex RNA39 l7 Now Elongation has begun The polymerase has escaped the promoter and the ternary complex is relatively stable This requires stronger interactions between the enzyme and the DNA The polymerase must funnel the RNA away from the DNA Proofreading can occur at this time also Fig 13 3 initial 39 transcribing complex RNA elongation 18 Elongation continues normally until termination is signaled Termination results in the release of the RNA transcript which can go on to be translated into protein The RNA polymerase can go on to transcribe another gene elongation 39 r 9 l Rgf Jkl polymerase Fig 133 terminates 39 and releases RNA w 19 In bacteria the core RNA polymerase needs an additional subunit for tight binding to promoters This is called the sigma 039 factor and it is shown in purple below The core enzyme plus a 039 constitutes the holoenzyme E coli has a 039 factor known as 03970 which recognizes most promoters Alternative 039 factors can direct the RNA polymerase to special genes if 2014 PearsOn Education Inc 20 Features of bacterial promoters b upstream promotor element 1 UPelement D l l 17 19 bp D D 35 1 O extended 10 l 10 i 1 1 Fig 135 modulator making the promoter stronger or weaker discriminator ED 35 1 0 1 21 a Most promoters are recognizable by their 1 O and 35 elements Each element is 6 bp but the spacing between them is somewhat variable Also the distance to the start site 1 is somewhat variable a Fig 135a 22 b Some promoters have an additional upstream promoter UP element which makes for a stronger promoter This element is bound by the C terminal domain of the 0 subunit of the RNA polymerase ie not by 03970 Sometimes there are 2 separate UP elements 1 39 UPelement 35 1 0 1 Fig 13 5b 23 C Some promoters lack the 35 region but have an additional region called the extended 1 0 region This provides additional interactions with the RNA polymerase through domain 3 of the 03970 The gal genes of E coli have this kind of promoter C extended 10 gt W I 10 1 Fig 135C 24 d The discriminator is a short region near 10 It appears to interact with 03970 at the 12 region This interaction fine tunes the promoter polymerase binding discrinQinator gt I L4 35 1 0 1 Fig 135d 25 2 g 30 m m 0 c E H CD CD E gt8 goo05 S5 c 02 ltE CDNOH EOOH EON391 Z In C quc CD CD EMEH COWGL mm L gt 15E HE SCGJ EH CCU CCU 253 150993 339 m gtIcu Um C39l E 0 bgm gt a 00 TSPC cuquot NCDO quotLCDU EW39UGJ OQISSTQ UUCE CDC CD SCl 13an 56 3 H093 0mm EltEF I EZQR D DUF 26 The binding of a bacterial RNA polymerase T aquaticus holoenzyme to a segment of DNA can be seen here 10 is where separation of strands occur 35 just holds Structural basis of transcription initiation RNA polymerase holoenzyme at 4 A resolution Murakami KS Masuda S Darst SA 27 Science 2002 May 17296557112804 Consensus sequences for the 03970 promoter in E coi have have determined At each of the 12 positions one base is much more likely than any of the others The closer to the consensus sequence the stronger the promoter 100 V 01 U1 O nucleotide frequency N 01 0 l m l l ll Box 13 1 Fig 1 113 l 35 1 meLcsma l I I I 15 1 9 nucleotides 28 What do actual promoters look like None of these have the entire consensus sequence Operon 35 region 10 region Initiation Pribnow box site 1 lac ACCCCAGGCTTTACACTTTATGCTTCCGGCTCG TGTGATTGTGAGCGG AGCGCCCIGAAGACAGTC TGGTTITTTCATACCAT TTCTCCAT CCCGTTTTT CCTTTC TCCCGCTTTG lac CCATCCAATCGCGCAAAACCTTTCGCGCTATGG gaIPZ ATTTATTCCATGTCACACTTTTCGCATCTTTGT amBAD GGA39I CC39l39ACCTGACGC39I39T39IquotI39TA39I CGCAAC39I C39I39C araC CCCCTCATTATAGACACTTTTCTTACGCGTTTT trp AAATGAGCTGTTGACAATTAATCATCGAACTAG GTACGCAIGTTCACGTA bioA TTCCAAAACGTGTTTTTTCTTGTTAATTCCCTG TGTAAICCTAAATCTTTT bioB CATAATCGACTTGTAAACCAAATTGAAAAGATT TACAAGTC39ACACCGAAT CGCCCCICTTCCCGATA CGCCTCC TTCACACCA CGCCTCC TCGACACGG CCGCCGCTG doubt CAACGTAACACTTTACAGCGGCGCGTCATTTGA rle CAAAAAAATACTTGTGCAAAAAATTGGCATCCC rmEl CAATTTTTCTATTGCGGCCTGCGGAGAACTCCC rrnAl AAAATAAATGCTTGACTCTGTAGCCGGAACCCG purine makes it easier to hold in the first nucleotide Initiation 35 region 10 region site 33533 T T G A c A mesmp s sbp 39 69 79 61 56 54 54 77 76 60 61 56 82 Figure 255 The sense coding strand sequences of selected E coli promoters i 9 nontemplate Alter Rosenberg M and Court 0 Annu Rev Genet 13 321323 1979 Consensus sequence from Lisser D and Margalit H Nucleic Acids Res 21 1512 1993 Copyright 1999 John Wiley and Sons Inc All rights reserved There is also a consensus sequence at the initiation site 29 How does the 039 factor bind to the promoter It is an extended protein with several domains numbered 1 4 Domain 4 binds to the 35 region and domain 2 binds to the 1 0 region discriminator Fig 136 extendeldI 1O LL 35 10 T4 3 I I 2 1 quot XI 7 quotT p C E 42 I 41 32 31 30 24123i22r21 12 11 N Ll melting Domain 30 binds to the extended 1 0 region and domain 12 binds to the discriminator region 30 Here is a view of the 35 region of a promoter with a domain 4 from a 039 factor This protein sits in the major groove using the helix turn helix motif tightbinding Structure of the bacterial RNA polymerase promoter specificity sigma subunit Campbell EA Muzzin O Chlenov M Sun JL Olson CA Weinman O TresterZedlitz ML Darst SA Mol Cell 2002 Mar9352739 31 On the left domain 4 of the 039 factor interacts with the 35 promoter element by a helix turn helix At the right domain 2 has a more complex interaction with the 1 0 region which helps to melt the duplex DNA The 1 0 in region must 39 be melted before RNA synthesis can be initiated 39 13 2 x 3quot Structural basis of transcription initiation RNA polymerase holoenzyme at 4 A resolution Murakami KS Masuda S Darst SA 32 Science 2002 May 17296557112804 How can the spacing between the two promoter elements be somewhat variable Flexibility in the 039 factor Structural basis of transcription initiation RNA polymerase holoenzyme at 4 A resolution Murakami KS Masuda S Darst SA 33 Science 2002 May 17296557112804 This is a major portion of the E coli 03970 Crystal structure of a sigma 70 subunit fragment from E coli RNA polymerase Malhotra A Severinova E Darst SA Cell 1996 Oct 487112736 sigma factor cannot bind on its own needs the ma polymerase too and then they both bind to the dna promoter 3537 It is not as elongated as it would be in a holoenzyme This altered structure prevents it from binding to promoter sequences without the polymerase 34 The UP element when present is bound by the Carboxyl terminal domain CTD of the 0 subunit of the RNA polymerase This domain is connected by a very flexible linker so it can contact a wide range of sites in the promoter region dNTD ocCTD alpha is very flexible iowing the UB element to be mreIariable D V m UPelement 35 1 O V I Fig l 3397 alpha binds to minor groove UP element 35 The 0 CTD shown in violet contacts the UP element at the minor groove Many UP elements are found at 43 and this allows the O CTD to interact with domain 4 of the 039 factor which is at the 35 element A second UP element is usuaHyfound about one turn of the helix upstream from 43 and this binds a second 0 CTD although weakly Structural basis of transcription activation the CAPalpha CTDDNA complex Benoff B Yang H Lawson CL Parkinson G Liu J Blatter E EbrightYW Berman HM Ebright RH Science 2002 Aug 3029755861562 6 36 37 Conservative Site Speci c Recombination Transposition of DNA and Introduction to RNA Synthesis Friday September 18 2015 BIOL 5304 Lecture 11 Chapter 12 Conservative Site Speci c Recombination CSSR is an example of DNA rearrangement that occurs between two speci c DNA sequences Another example is Transposition 1cssRh These two classes are illustrated below sitespecific recombination sites recombination gt Fig 12 1 transposable element Hquot quot or Conservative Site Speci c Recombination such as occurs between 2 de ned sequence elements 2 Transpositional Recombination as occurs between speci c sequences and nonspeci c DNA sites Examples of these processes include 1 Insertion of viral genomes into host DNA 2 Inversion of DNA segments to alter gene structure 3 Movement of transposable elements from one site to another within a chromosome 4 Development of the human immune system Today we will look at general features and some speci c examples of the rst 3 types listed above Integration of the phage A DNA into the host E coli chromosome not to scale A is about 40 kb while E coli is over 100 times larger The same recombination sites are always used phage recombination site bacterial recombination site O l g12e2 Cooyr gm ti 2008 Pearson Education ire oablls nng as P integrative recombination gt ma 5 a c o 2 a CSSR conservative site speci c recombination can generate 3 different types of rearrangements depending on the recognition sequences Insertion Deletion Inversion recombmase step delebonl reoombmase step 39 m a inversion J F insertion l v an ix nv mo Fig 12 3 399 2014 Pearson Educatee Inc 6 Recombinase recognition sequences I I I I E E T T Crossover region Direct repeats Inverted repeats Insertion or deletion Inversion s 4 3 lt f lt T reoombmase step inversion J 3 Insertion I Fig 12 3 2014 Pearson Educaten Inc recombination sites recombinase recognition sequences crossover region 51 gt Ijrlo lt 3quot gt liloch 4 5 O gt IJCIOD 4 3 O gt fillet 4 lrecombinase binds recognition sequences 539I 31 3 5390 gt lumen lt 339 gt LIIOIC lt G lrecombination 39 l0 lt 11 02quot 0201 cc Uy vu gt ljtlol 4 Lilac 4 Copyright 2008 Pearson Education Inc publishing as Pearson Benjamin Cummings Example of direct repeat recombination sites allowing the insertion of one segment of DNA into another Directionality exists because the site is not symmetrical unlike most restriction sites Fig 12 4 There are two types of conservative site speci c recombinases using Serine or Tyrosine amino acid side chains Serine is illustrated below Phosphate bonds are conserved in each class The tyrosine class also uses the OH group of its side chain Fig 12 5 cleaved DNA end 539 O O m 5390 5390 HO cleavage relomlng o gt 1 o I Ser OH p o O m Ser o p o O m O IID O O m 0 0 O 0 0 Ser 0H 9 9 339 339 9 3 protein DNA covalent intermediate Copyright 65 2008 Pearson Eczucatrorx Inc publishing as Pearson Benjamin Cummings This mechanism resembles the type topoisomerase and the Spoll endonuclease that generates double strand breaks for meiotic homologous recombination 9 Table 121 TA 8 t E 121 Recombinases by Family and by Function Recombinase Function Serine tamin Salmonella Hin invertase Transposon Tn3 and ya resolvases Tyrosine family Bacteriophage A integrase Phage Pl Cre Escherichia coli XerC and XerD Yeast FLP Inverts a chromosomal region to flip a gene promoter by recognizing hix sites Allows expression of two distinct surface antigens Promotes a DNA deletion reaction to resolve the DNA fusion event that results from replicative transposition Recombination sites are called res sites Promotes DNA integration and excision of the A genome into and out of a specific sequence on the E coli chromosome Recombination sites are called att sites Promotes circularization of the phage DNA during infection by recognizing sites called on sites on the phage DNA Promotes several DNA deletion reactions that convert dimeric circular DNA molecules into monomers Recognizes both plasmidborne sites cer and chromosomal sites dif Inverts a region of the yeast 2 p plasmid to allow for a DNA amplification reaction called rolling circle replication Recombination sites are called frt sites 39339 2014 Pearson Education Inc 10 Serine R OH Fig 12 6 crossover region 2 or ii recombinase recognition sites 2 serine cleava e recombinase g gt serine relommg 39 recombinase 5390 339O 539 3 Copyright 2008 Pearson Education Inc publishing as Pearson Benjamin Cummings Mechanism of a serine recombinase All four strands are broken at once Four enzyme units are required R1 R2 R3 R4 4 strands are covalently linked to enzymes via 5 phosphates 11 An actual Serine recombinase in which all four strands of DNA are cleaved It is thought that the strands are exchanged by 180 rotation of the top relative to the bottom Structure of a synaptic gammadelta resolvase tetramer covalently linked to two cleaved DNAs Li W Kamtekar S Xiong Y Sarkis GJ Grindley ND Steitz TA 12 Science 2005 Aug 19309573812105 Epub 2005 Jun 30 Serine recombinase step by step all 4 strands must be cleaved so that rotation by 180 can occur before resealing 4 h Sin 35 75 resolvase 90 Hin 55 Sin gt gt gt Parental 1ZR4 Ehelix aligned Recombinant The smooth rotating surface of a Serine recombinase Crystal structure of an intermediate of rotating dimers within the synaptic tetramer of the Gsegment invertase Ritacco CJ Kamtekar S Wang J Steitz TA Nucleic Acids Res 2013 Feb 1414267382 14 Another class of recombinase for Conservative Site Speci c Recombination does not break all four strands at once but instead breaks two at a time This recombinase happens to use tyrosine as its catalytic amino acid residue That makes an easy way to distinguish between the the two classes 15 Fig 12 8 3 Ptyrosine a m 539 0H 539 O 4 339 o39 39 i 539 l I 339 I top strand exchange b 539 o c 339 O Holliday junction ail Ho39 cleavage of bottom strands c 539 lt5quot 3 O 539 I I 3 339 I bottom strand exchange to finish d recombination 539 o 339 O 539 I 39 quot 339 I Copyright 2008 Pearson Education Inc publishing as Pearson Beniamin Cummings Mechanism of a tyrosine recombinase Two strands are broken initially and recombined Then the next two strands are broken and recombined Again four enzyme units are required Initial links are through 3 phosphates leaving 5 OH ends in the DNA 16 Cre recombinase is a tyrosine recombinase that integrates a circular phage genome into the E coli chromosome as a linear segment at a lox site Fig 12 9a synapsed substrate DNA 3 5 firststrand l lcleavage CreDNA intermediate I firststrand cleavage Holliday junction intermediate 339 4 11 39 ATAACTTCGTATAG CATATGpCTATACGAAGTTAT TATTGAAGCATATCpGTATACVGATATGCTTCAATAT539 l Tyr324 phage 39l E coli Structural tutorial 17 firststrand 539 cleavage Holliday junction intermediate secondstrand cleavage CreDNA intermediate ll secondstrand exchange 5 i recombined 39le DNA I Each pair of recombinases binds to one of the two lox sites upper and lower in this gure Only one enzyme in each pair is active at a time colored green In the rst step Tyrosines become linked through 3 phosphates and S OH groups are generated The strands are rejoined when the S OH groups attack the Tyrosine phosphodiesters of the other stand This process is then repeated for the other two strands Fig 12 9a 18 Cre recombinase binds two duplexes of DNA forming something like a Hollidayjunction The movie highlights the catalytic tyrosines The magenta tyrosines have formed covalent bond intermediates with the DNA The red ones will act later The structure shown in the movie is the second image in the previous slide b Fig 12 9 b O o 9 39 39 r k I quot o 3 C P o F l 39 if v 3939 f I 1quot 39 I quot l 1 f c v V r 1 v 139 k 39Iy 39o 9 39 v 39 Il fit a 39 m I A quot 39 J 39 39 g O t l 4 4quot 39 C A4 v Copyright 2004 Pearson Education Inc publishing as Benjamin Cummings Structure of the Holliday junction intermediate in CreonP sitespecific recombination Gopaul DN Guo F Van Duyne GD EMBO J 1998 Jul 151714417587 l9 Cre recombinase can be used to knockout genes in mice in a tissue speci c manner Lox sites are introduced into the germline by homologous recombination so that they ank every copy of a particular gene in the organism The recombinase is engineered to be expressed only in particular tissues eg liver by the use of tissue speci c promoters Expression can be turned on after birth The result is that most cells will express the original gene but in liver cells the recombinase is activated and the gene is excised from the host chromosome See Box 12 1 20 Transposons A B Transposons sitespecific recombination sntes recombination aISO called gt transposable elements can move into new targets without transposable element I I th e n eed fo r s pee i f i C recombination sites transposntlon gt Ccwngw 9 2009 Pemscn Education Int wean as Pearson Bamnmm 3 me F i g o 1 2 1 21 Transposition transposon l I genomic DNA oanig old site new site movement without duplication l O 2 av usi Gian I 1wa excised from old site copies of element and inserted in new site at old and new sites Copyright Q 2008 Pearson Education Inc publishing as Pearson Benjamin Cummings movement with duplication Transposons or transposable elements are segments of DNA that can move from one location to another within a host Some types of transposons move physically to another site ie cut and paste while other types are copied to the new site Fig 12 1 6 22 Many organisms carry substantial amounts of transposons or their remnants colored green in their Chromosomes Barbara MCClintock quot quotquot quot ll39l39il quotMilitary 1 902 1 992 Nobel Prize 1983 httpprofilesnlmnihgovLL INC1 it P quot333 l b Human V28 V29I TRY4 TRYS c Drosophila melanogaster PpI Edg78E Polycomb ll39lll CI l39IquotOI MWquota I I IIl39 A H M y 1 U v 1 d Saccharomyces cerevisiae GLK1 V 5309 HIS4 FUSI AGPI BUD3 JDDDD l l Ty2 e Escherichia coli thrB dnaK carB fixA mIDIIIIlII ll 1 ill Dl nn in UN D m 3 MA thrC Sl86 ISI 6 l l l l 110 l l l l 210 l l l 410 l l l l lkb kb Fig 12 1 7 Copy gm 0 2003 Pearson Educahon Inc ownsmng as Pearson Ber amar Emma n95 a DNA transposons 3 families Of anking transposable hOSt DNA element elements I I lti IgtD l l transposase A functional targetsite terminal inverted duplication repeats transposon should have b viruslike retrotransposonsretroviruses recombination element I p I Sites at the m em39s39 a I n n I should code LTR mtegrase and RT LTR for an enzyme c polyA retrotransposons that facilitates 39 gt 539 UTR ORF1 0an 339 UTR tranSpOS39t390n 0 gt445 gt transposase wwwc39mizoze earscw tagsancw Inc cmcrssrwgasweaw Eeom rn QJmn ngs I n Fig12 18 24 a DNA transposons 112E flanking host DNA element I I 0 M l transposase targetsite terminal inverted duplication repeats mange Fig 12 18a This transposon is autonomous it contains both terminal repeats and a transposase Transposons lacking the transposase are called nonautonomous They cannot move unless the transposase is supplied by another source DNA transposons often carry other genes such as those for antibiotic resistance which can benefit the host 25 element in old DNA location flanking host terminal inverted repeats DNA Ii j all I f binding to multimer of transposase synap c complex DNA cleavage of both strands excised transposon Cut and Paste mechanism of transposition First the repeats in the host DNA are brought together in a synaptic complex The transposon is excised from the host DNA and attacks the target DNA at staggered sites Fig 12 1 9 26 excised transposon l I Cut and Paste 539 3 OH 56 3 a mechanism of 339al 0 quot o 0 show 5 transpOSItIon target D Insertion Of the transposon at DNA strand transfer staggered sntes o 9539 v results in a x 395 duplication ofa O 56 short segment 5 DNArepair synthesis of the target to fill gaps DNA V element in new DNA location ligation of nicks nevlt DNA 539 339 1 1 taquotgetsite targetsite Flg 1 2391 9 duplication duplication 2 7 An example of a transposon Tnl O This transposon is found in E coli It provides resistance to the antibiotic tetracycline It is a composite transposon meaning it has 3 modules transposase defective tetracycline gene transposase resistance r I gene genes Fig 1227 S10 right Copyright 2008 Pearson Education Inc Dublishing as Pearson Benjamin nnnnnnnn s 51 CL left and 51 OR right are mini transposons They both contain insertion sequences although the transposase gene in 51 CL is not functional 28 339end of transposon target DNA site 5 339 339 DNA strand OH transfer vr a P r Close up View of DNA strand transfer Fig 12 20 12014 Pearson Educm cn in 2 9 a smHW Transposons will typically l antisenseRNAwy control their frequency of Pour v i transposition since too a transposasggene E3 i many transposons would transposon PIN mRNA W threaten the Viability of the 1 I o 3533quot host cell Tnl 0 does this by b higth10copy number USE Of antisense RNA RNAzRNA pairing 0 o S requem RNA is synthesized in both 339 directions from the start of x the transposase gene This translation of transposase generates a Short mRNA is blocked is complementary to the messenger RNA coding for 3 the transposase This 1 inhibits protein synthesis c low Tn 10 copy number RNAzRNA pairing 539 is rare translation of transposase mRNA is efficient 1 2 2 8 Copyright 2008 Pearson Education no publishing as Pearson Beniamin Cummings 3O OH Tni 0 also takes advantage of the 99 6 thcrlzgggggase GATC methylation system in E O l 1 b Tn10Tn5 coI OH There are two GATC sequences in 0H the transposon which when transesteri ca m hemi methylated cause an increase in transcription of the 31E 39 Q transposase gene That means that transposase is 235339 expressed preferentially just after v 9H its DNA has been replicated 3390 OrgT 0 gt That ensures that when 3 transposition occurs the double DNAstrand Fl g 12 21 b strand break that it generates can 5 be repaired by homologous 5quot 35H 0 O O I I I b I n I O n Copyright 2008 Pearson Education no publishing as Pearson Bengamm Cummings 0 tra n S poso n MEChanism for 5 donoroNA The 3OH ends of Replicatiy as primers for DNA Transposntlon synthesis The strands from the transposon become separated and each is copied Now the final product has 2 copies of the transposon First the transposon is nicked at 2 sites generating 3 OH which then attack the target DNA through a DNA strand transfer mechanism replication fork assembly at left gap Unnke a cutand aggmgptrand lit39ll 3 9 Such transposons EFFE paste transposon thIs are generally more intermediate reOIUires 39eadmgmnd l giiigiedrep39icam d39SrUPt39Ve t0 hOStS DNA synthesis Fig 12 22 cointegrate with 2 copies of transposon 3 2 2014 Pearson Education Inc Chapter 13 General Features of RNA Synthesis Previously we have looked at nucleic acid structure in particular DNA the replication of DNA and its maintenance Now we will consider the expression of genetic material This will be the focus of the remainder of the course The first step in expression that we will look at is the synthesis of RNA using the DNA as a template 33 RNA Synthesis or Transcription is very similar to DNA synthesis both in terms of the chemistry of the reaction and the main enzyme involved RNA like DNA is synthesized according to the specifications of a DNA template RNA is constructed from nucleoside triphosphates and pyrophosphate is a product The PPi is subsequently converted to 2Pi as in DNA synthesis 34 The multi subunit RNA polymerases appear to have a mechanism similar to that found in DNA polymerases to ensure that the correct nucleotide is added This involves the protein fitting around the incoming nucleotide at the active site A proper fit leads to rapid catalysis In addition the active site discriminates against deoxy ribonucleotides similar to the way that DNA polymerases discriminate against ribonucleotides 35 Why are Wild mushrooms so dangerous Amatoxins such as 0 amanitin are produced by poisonous mushrooms They bind tightly to RNA polymerase II 10398 M and to RNA polymerase III 1 Oquot6 M blocking elongation RNA polymerase I mitochondrial chloroplast and bacterial RNA polymerases are not affected oH H JU GQOH cHt o l H PI H ll H A IW C N C N UQ czo CO HZC NH CHg I m I H CH crs N OHinCH ltnnghtt qa HO I I H l ILH2 c olt3 sz 24 hours for H 4 t1 C C N C C Ahff Q NH fm hwa H f H C CHZ CONH2 uAmanitin Copyright 1 o u o Jnhn u39llny and Son lrr All n5 mm n39m l 3 6 Ot amanitin bound to yeast RNA polymerase II It does not prevent substrate binding but it binds near the catalytic site and prevents RNA synthesis Structural basis of transcription alpha amanitinRNA polymerase II cocrystal at 28 A it j resolution 4 H Bushnell DA Cramer vr quot P Kornberg RD Proc Natl Acad Sci U S A 2002 Feb 5993 121822 Epub 2002 Jan 22 37 38 Transcription in Bacteria Friday September 25 2015 BIOL 5304 Lecture 13 The next step Initiation After binding of the RNA polymerase to the promoter the initiation process begins The interaction between the polymerase and the DNA must change so that the DNA can be unwound to form a bubble to allow RNA synthesis large conformation change in polymerase bind and then dissociate it is looking for the right sequence if it doesnt bind the right sequence it will quickly dissociate This happens in 2 steps The first nucleotide binds at the catalytic site where the DNA has been bent and slightly opened The second nucleotide binds and is joined to the first releasing PPi To continue a large conformational change must occur Transition to the Open Complex DNA must be brought into the RNA polymerase and melted between positions 11 to 2 This positions the 1 site inside the RNA polymerase at its catalytic site with a single strand DNA template This transition is called isomerization is irreversible and does not require input of energy eg ATP hydrolysis In contrast binding of DNA to the closed conformation of RNA polymerase is readily reversible The DNA can dissociate from the polymerase In addition an exit channel is formed for the newly synthesized RNA in the open conformation The 0392 region binds to a Fig 138a the 10 element of the 39 promoter It eventually pulls the non template strand away from the e39eme39 10 template strand by grabbing an A at position 11 and a T at position 7 l l 1O consensus sequence second A is 11 and the last T is i 201 1 Elsevier The 0392 region I rotates the bases 539 3 1 quotl0 9 8 i 339 fromthe 7and 62 11 positions It H i H i i H provides well 339 1Oeemem 539 2 a tailored pockets to dsDNA ssDNA hold these bases which facilitates gigging of the ml J U j 539 og u m s Ll 539 12 11 1o 9 8 7 339 T l l T l T 39 l The formation of 339 m the transcription t 5 339 n T bubble completes My I I no promotermelting the tranSItIon to otranscr39pt39on 5 promotermelting transcription Fig 13 8b 5 Let s analyze this schematic view of the RNA polymerase showing the catalytic subunits BB the 039 factor and the DNA The active site is in the center near the 0392 red is nontemplate is being pulled away from template grey strand RNAe t channel B39pmcer upstream DNA downstream NT channel T channel There are 5 channels and several cavities The entry channel for nucleotides is not shown The template strand of DNA is gray The non template strand is red As in the phage RNA polymerase the non template strand comes out from the active site to form the bubble then re enters to form ds DNA RNA exit channel 339 pincer linker downstream 34 0 DNA upstream 7lg 4 I DNA a 4 lt i I 35 B pinc NT channel 3 flap T channel Nucleotide secondary channel 139 is not shown 7 The major changes that occur when the open complex forms 1The B and B pincers close around the downstream DNA 2 The N terminal region ofO39 11 moves out of the active site some 5013 It is negatively charged and acts as a DNA mimic or placeholder RNAe t channel 339 pincer downstrea e I 1 4 upstream amp DNA 4 A 1017 NT channel B ap T channel Since RNA synthesis starts without a primer that means that 2 nucleotides must simultaneously come into the proper positions at the active site There must be extra interactions between the first nucleotide and the protein to stabilize it This includes a role for the 039 factor esp 34 A or G is usually the first nucleotide The first nucleotide is usuaIIonr G b 39 IS arger o 39 o o a RNA GXlt very sho eices made jossled out Channel restarti 39 O nucelotides in 339 pincer downstream Even at this point initiation does not always proceed In fact until the transcript becomes more than about 10 nucleotides it is frequently released and transcription must re start The open complex will usually be maintained After a transcript of more than 10 nucleotides is formed elongation usually proceeds RNA exit channel 3 pincer downstream 6 DNA upstream y 39 39 n 4 DNA 10t1 a j 4quot I I gt NT channel fla B p Tchannel O F l g 1 3 9 4 Pearson Ezucamn nc 1 O If the RNA polymerase does not escape the promoter until about 9 nucleotides of RNA have been synthesized how can that be consistent with the fact that it must also move along the DNA template in order to synthesize the complementary strand of RNA Three models were proposed to explain this and recently evidence has accumulated that one of the models is correct RNA Polymerase will sit on the promoter while it makes the first 10 nuceotides thennn starts moving ll Transient excursions the RNAP moves1eyatt forward and backward each time synthesizing a short piece of RNA transient excursions abortive RNA inchworming rna pol can change Its shape and stretch out iwr l Nmn Pm it 0 35 10 if 1 abortive RNA scrunching xa NTPn PPin t AL 435 410 1 quot7 abortive RNA 39 r a xxx i H 435 410 1 f I I H 7quot V 35 1 0 1 Fig 13 10 a SCRUNCHING IS CORRECT ached florescent molecules on different positions so they could tell what part of the RNA was fixed and what was moving lnchworming the RNAP has a flexible element It continues to bind to the 35 element while moving forward from the l 0 element Scrunching the initially transcribed DNA loops out of the active site 12 The scrunching mechanism is now favored The polymerase remains on the promoter but downstream DNA is pulled into the active site and the excess DNA is looped inside transient excursions abortive RNA inchworming j i i NTPn PPn I ll 39 435 10 0 1 ll abortive RNA scrunching xx NTPn PPon 7 V j t 35 10 1 abortive RNA quot121 139 2 F 35 1 0 1 f T x l 339 l v Fig 131 0 rH m 435 10 1 35 10 1 Initial transcription by RNA polymerase proceeds through a DNA scrunching mechanism Kapanidis AN Margeat E Ho SO Kortkhonjia E Weiss S Ebright RH Science 2006 Nov 17314580211447 Abortive initiation and productive initiation by RNA polymerase involve DNA scrunching Revyakin A Liu C Ebright RH Strick TR Science 2006 Nov 173145802113943 l3 The scrunching mechanism provides a basis for understanding why promoter escape occurs after the synthesis of 10 or more nucleotides At that point there is no more room to accommodate the single strand DNA within the polymerase The RNA transcript is also growing too long and it must be threaded out the back side of the polymerase through the RNA exit channel It must displace part of the sigma factor which is acting as an RNA mimic l4 Things to see Stacking of the first nucleotide with the template G Scrunching of DNA The Tth RNAP promoter DNA complex gr quot 39 o domain2 Esubunn 1O element n domain3 n domaind LN 39 10 element nontemplate DNA r r39 39 quot u 39 W 3939rArAA r 53 2 quot 9 5 A 5 N downstream DNA 3 19 393 i 3395ci oaca oaaroccracorcnc539 u subunits beam I template DNA transcription start site TSS Structural basis of transcription initiation by bacterial RNA polymerase holoenzyme Basu RS Warner BA Molodtsov V Pupov D Esyunina D Fern ndezTornero C Kulbachinskiy A Murakami KS J Biol Chem 2014 Aug 29289352454959 1 5 Region 32 of the 039 factor seems to play a role in the progression to elongation It occupies the RNA exit channel which must be used when the transcript becomes more than 10 nucleotides The successful displacement of the 32 region of 039 allows elongation to continue RNA exit channel 339 pincer er downstream G2 DNA upstream DNA 1039quot1quot2 r 39eww I V gt 039 139 O 3 pinc 0 Fr g 13 9 16 1132251 F earscn Etucamn w Schematic view of the role of sigma 32 shown as the dark red loop below A WT Left sigma 32 helps to stabilize the first two nucleotides Center It moves out of the way as the first 5 1 0 nucleotides are incorporated Right Sigma leaves as the polymerase escapes the promoter Distinct functions of the RNA polymerase 0 subunit region 32 in RNA priming and promoter escape Pupov D Kuzin I Bass I Kulbachinskiy A Nucleic Acids Res 2014 Apr4274494504 doi 101093nargkt1384 Epub 2014 Jan 21 1 7 As elongation begins the 039 factor has now been displaced from two areas of interaction with the RNA polymerase and so its binding is greatly weakened It can be lost from the complex now The reverse of scrunching is thought to help power promoter escape RNA exit channel l3 pmcer I k downstream f 34 m er 0 DNA upstream g f 39 7 18 Before continuing let s look at the phage T7 RNA polymerase where the conformational change to the open complex can be readily seen This is a one subunit enzyme of about 100 kDa that is related to DNA polymerases and is about 14th the size of a bacterial RNA polymerase It is also a close relative of the RNA polymerases of mitochondria and chloroplasts 19 T7 RNA Polymerase 2 conformations The magenta structure has the full transcription bubble It has a larger cavity and an exit path for the nascent RNA The cyan structure has a tiny RNA DNA hybrid and transcription is stalled until the enzyme opens up Structural basis for the transition from initiation to elongation transcription in T7 RNA polymerase Yin YW Steitz TA Science 2002 Nov 152985597 138795 Epub 2002 Sep 19 20 T7 Polymerase RNA template DNA non template DNA sharp bend so there is 1 nucleotide upaked nontemplate is really pulled away to keep it from reanneaHng In the initial view the DNA lies across the top of the RNA polymerase with the template strand dipping into the enzyme s cavity The 5 end of the nascent RNA is coming out of the enzyme toward the viewer The non template strand of DNA seems to be gripped tightly by the enzyme 21 Schematic view of the transition from initiation to elongation in the T7 RNA polymerase Notice how the DNA duplex moves as the RNA transcript begins to be synthesized The promoter is in blue It maintains contact with the RNA polymerase initially Template DNA dark blue Nontemplate DNA light blue RNA red The structure of a transcribing T7 RNA polymerase in transition from initiation to elongation Durniak KJ Bailey 8 Steitz TA Science 2008 Oct 2432259015537 2AA 1CEZ R 22 Rfree 27 22 Back to Bacterial RNA polymerase Two kinds of proof reading activities occur in the RNA polymerase Pyrophosphorolytic editing This is simply the back reaction by pyrophosphate to re generate a nucleoside triphosphate By an unknown mechanism this happens preferentially when an incorrect nucleotide has been incorporated It is likely to involve an inactiveactive transition of the polymerase which is determined by the fit between the nucleotide and the enzyme Hydrolytic editing This is a proof reading endonucleolytic activity that is stimulated by elongation factors GreA and GreB These factors prevent or reverse arrested RNA polymerases and therefore are crucial to synthesizing long transcripts 23 Fig 13 DNA 1 1 RNA polymerase b 1 forward translocated W WWWg nun a ii th t At any one time only about 8 9 base pairs exist between the RNA and DNA 4 As each base pair of the duplex DNA is pulled into the polymerase one nucleotide of the RNA is threaded out the exit channel This allows the next nucleotide to be incorporated into the growing chain 24 RNA ol merase DNA p y c 1 forward translocated NTP bound Forward translocation allows the next nucleotide to come in Reverse translocation allows the last nucleotide to be cleaved by hydrolytic editing F 1 1 1 lg 3 514 f39 15 l3939 39u39quot39quot quotL A39I3939ll39 39J l39 H E4 2 quot L ur39 r The GreAB proteins stimulate hydrolytic editing by extending into the RNA polymerase active site GreA C terminus 3 1 Crystal structure of the GreA transcript cleavage factor from Escherichia coli Stebbins CE Borukhov S Orlova M Polyakov A Goldfarb A Darst SA N quotterm I n U 5 Nature 1995 Feb 163736515636 40 26 GreA shown at the right C fits into the secondary Channel colored yellow in the middle panel B of the RNA polymerase in order to get started again these have to get cleaved out B upstream downstream C DNA DNA Btudder B39lid secondary channel B ap secondary channel Regulation of RNA polymerase through the secondary channel Nickels BE Hochschild A Cell 2004 Aug 611832814 Review 27 The quotSecondary Channel is normally used for entry of nucleotides The GreA coordinates a Mg ion that enables hydrolysis using the active site residues of the polymerase downstream DNA upstream upstream DNA B39rudder s39rudder backtracked RNA Hid I lynd I are GreA red helix promotes cleavage of 2 3 nucleotides GreB promotes cleavage of up to 18 nucleotides Structure and function of the transcription elongation factor GreB bound to bacterial RNA polymerase Opalka N Chlenov M Chacon P Rice WJ Wriggers W Darst SA Cell 2003 Aug 8114333545 2 8 An arrested RNA polymerase backtracks when it stalls This causes the 3 end of the RNA to move away from the active site To resume transcription several nucleotides at the 3 end must be clipped off A Elongation B Arrest Promoting elongation with transcript cleavage stimulatory factors Fish RN Kane CM Biochim Biophys Acta 2002 Sep 1315772287307 Review 29 The action of GreA B not only speeds up transcription by rescuing stalled RNA polymerases but since incorporation of incorrect nucleotides is more likely to cause stalling they also function as proofreaders But an RNA polymerase can also become arrested due to DNA damage In this case it must recruit the Uvr endonucleases as we have seen in the section on DNA repau Another protein called TRCF Transcription repair coupling factor is involved in this process It translocates along the DNA using the energy of ATP hydrolysis When it runs into a stalled RNA polymerase it can both cause the RNAP to dissociate and recruit the Uvr repair proteins survellience proteein when encounters a stalled RNA polymerase it will attract proteins to help it dissociate or get rid of it 30 Now that transcription is going smoothly how can it be stopped at the proper place There are terminator sequences In E coi there are two mechanisms 1 Rho dependent overlayed 2 Rhoindependent or intrinsic terminators 31 The intrinsictermination pathway requires no additional factors It relies upon a sequence motif shown below in the DNA A symmetry element followed by 8A T bps dyad 4 symmetry gt DNA 5 CCCAGCCCGCCTAATGAGCGGGCTTTTTTTTGAACAAAA 3 GGGTCGGGCGGATTACTCGCCCGAAAAAAAACTTGTTTT RNA 539 CCCAGCCCGCCUAAUGAGCGGGCUUUUUUUU 339 strong stem and loop interaction and weak interaction gt pulling it off 3300 Details of this mechanism are not completely known transcript folded to form termination hairpin A G C Formation of the RNA A C G A duplex leads to U lt CG gtAUC cHG gt AU destabilization of the 5 wage M 3 RNADNA hybrid and t I I the RNA dissociates Fig 134 3 G from the polymerase 32 The rU dA quot h ete ro d u p I ex is th e A I least stable of all combinations The size and location of the RNA stem loop affects the efficiency of termination It is possible that this RNA a UUUUUUU H H stru ctu re interacts D directly with the RNA l polymerase perhaps in the RNA exit channeL Fig 13 14 33 Other transcripts which lack such sequence motifs must be terminated in a different way via the p factor Rho p is a hexameric protein that binds single stranded RNA or DNA It is powered by ATP hydrolysis It is enzymethatmakeSATP structurally related to recA and F1 ATPase ssBinding protein It recognizes a particular RNA sequence rut rho utilization that occurs in the nascent RNA upstream of the termination site occurs upstream of where it needs to terminate en d rji spl i n the Ir12 template Sir 5 l 1 After rho binds to the rut sequence it uses the energy from ATP hydrolysis to pull itself towards the polymerase When it arrives there it continues to pull the RNA out of the transcription bubble thereby ending transcription It is not known if the rho hexamer continues to bind to the rut sequence as it pulls the RNA strand 339 an J di spl 3quot i n g ll l l l l lplme 31nd This crystal structure of hexameric rho shows how it might open to allow the single strand to enter the central channel The rut sequence will presumably bind along the top surface where the RNA analogs are bound ATP analogs are bound at the interfaces of 2 subunhs Structure of the Rho transcription terminator mechanism of mRNA recognition and helicase loading Skordalakes E Berger JM Cell 2003 Jul 11114113546 36 Model for rho action Likely pathway is 1 gt 3 gt 4 gt 5 rho binds RNA on both its top and bottom Binding on the top opens the ring allowing the RNA strand to bind at the bottom This Closes the ring the RNA through the ring quot 1 39l v 0 U 39 quot a 1quot x 139 quot1 quot 39 2 n c 5 l39 l 39 v V 39 3 Q 39 l h NJ 39 Iquot J 39 A 39 1 v x l O r 39 0 D st 9 3 f a lu 15 4 xquot I 7 0 V uv I Fig 1312 8 i Now ATP hydrolysis can pull 1 3 lt3 Q5 gt 2H A Q E 3 a y 7 3 539 3 Structural insights into RNAdependent ring closure and ATPase activation by the Rho termination factor Skordalakes E Berger JM Cell 2006 Nov 3127355364 ll ll 37 38 Eu karyotic Transcription Termination and The Chemistry of RNA Splicing Wednesday September 30 2015 BIOL 5304 lecture 15 The next stage is splicing of the RNA transcript This will be described in subsequent lectures Finally termination of transcription and 3 processing of eukaryotic mRNA includes 1 Cleavage of the transcript near a signal sequence of AAUAAA 2 Addition of many adenine residues to the 3 end of the transcript 3 Final termination of transcription Note Cleavage of the transcript in step I does not stop transcription A second synthetic RNA is produced but eventually is terminated and released polyA signal sequence in DNA ii 395 V V l 39 f t I 22 fE1 xn igJJ CstF polyA signal sequence in RNA RNA cleavage 1 CstF CPSF 539 CAP V 3 polyA polymerase PAP 3 polyAbinding protein 5 CAP V additional polyA I binding protein aquot Polyadenylation of the 3 end of an mRNA is outlined here The CTD is again highly involved first binding important factors and then releasing them to act This includes the CPSF Cleavage and polyadenylation specificity factor a multi subunit complex and CstF cleavage stimulation factor Fig 13 25 3 polyA signal sequence in DNA quot l til quot2W quot ir If CstF polyA signal K sequence in RNA CPSF RNA cleavage 1 l CPSF 539 CAP w 339 polyA polymerase PAP a PAP 5 CAP v hlg 3 polyAbinding protein 5 CAP V additional polyA binding protein J 539 CAP 2014 Pearson Education inc CPSF Cleavage and polyadenylation specificity factor is initially bound to the Polymerase When the poly A signal sequence appears AAU AAA it moves to the mRNA followed by the CstF cleavage stimulation factor which binds to a downstream GU rich region of RNA CPSF after binding to the poly A sequence causes the polymerase to pause hence it can be considered an elongation factor This always precedes cleaving the mRNA Fig 13 25 4 CPSF blue subunits bind to the AAUAAA element CstF orange subunits bind to the CU element The resulting complex allows the Cleavage Factors CFIm and CFllm to bind and cleave the RNA PAP poly a polymerase CFIMA Hydrolysis of the mRNA occurs between CPSF the 2 sites The 73 kDa subunit of CPSF is the likely a endonuclease Domains of CstF64 Recognition of GUrich polyadenylation regulatory elements by human CstF64 protein P rez Ca adillas JM Varani G EMBO J 2003 Jun 22211282130 polyA signal sequence inDNA quot39 QCQCQ 24A J CstF g polyA signal sequence in RNA 539 CAP CPSF RNA RNA cleavage CstF CPSF 539CAP We polyA polymerase PAP a PAP 539CAP Vt Ihly 3 polyAbinding a protein 539 CAP additional polyA binding protein J V 539 CAP Q 2014 Pearson Education inc While CPSF remains bound to the poly A signal sequence AAUAAA PolyA polymerase is recruited to the 3 end of the transcript shown on the previous slide as PAP PolyA polymerase is a non template polymerase It adds adenosine to the 3 OH end of the transcript using ATP as a substrate See next slide Fig 13 25 6 PolyA polymerase is shown on the left with an analog of ATP and on the right with an A5 substrate Notice that the polymerase closes around the poly A It is different from other polymerases that use a template The specificity for A is a consequence of this tight fit high specificity because binds very tightly to its A product CWStal StrUCture Of mammal39an lochA Mechanism of polyA polymerase structure of the RAOJSrItme aSEe39 le Knp izmggm analog Of ATP39 enzymeMgATPRNA ternary complex and kinetic 39 analysis EMBO J 2000 Aug 15191641932033 Balbo PB Bohm A Structure 2007 Sep159111731 polyA signal quot sequence in DNA a V l Q e i 939 CstF polyA signal sequence in RNA 539 CAP CPSF RNA RNA cleavage k CstF V CPSF 50 We polyA polymerase PAP a PAP SOAP 339 polyAbinding a protein 539 CAP additional polyA binding protein J 539 CAP As the action of polyA polymerase begins to add A s to the 3 end of the transcript a poyA binding protein will bind to the single stranded polyA tail This binding serves to measure the length of the polyA tail When it reaches about 200 250 the wrapped PABP causes the release of CPSF and PAP Fig 13 25 The polyA binding protein PABP appears to function by binding single strand polyA RNA as a monomer below left Then the monomers RNA come together below right binding about 200 nucleotides of the polyA This complex functions as a signal to the polyA polymerase to stop in a sense counting to 200 then triggers the polymerase to stop the protein wraps up at about 200 Recognition of polyadenylate RNA by the polyAbinding protein Deo RC Bonanno JB Sonenberg N Burley SK Cell 1999 Sep 1798683545 Now the transcript has its 5 cap and its 3 poly A tail Once it is properly spliced it must travel through nuclear pores shown schematically below to get to the cytoplasm for translation cytoplasmic laments cytoplasmic ring outer membrane 39 central scaffold inner membrane nuclear ring nuclear basket Tdistal ring intranuclear laments Functionalization of a nanopore The nuclear pore complex paradigm Peters R Biochim Biophys Acta 2009 Oct17931015339 Note that the poly A tail is a very handy marker for molecular biologists eg for making a cDNA library Since only mRNAs have the poly A they can be isolated by various procedures using its affinity to polyT 10 polyA signal sequence in DNA But what stops polyA Signal S sequence in RNA 2 5 cm TilW transcription RNA RNA cleavageLOCstF After the AAUAAA mediated cleavage of the transcript RNA synthesis of a second molecule continues for awhile before it is finally terminated This is shown nicely on the animation This signal for termination is not entirely known but it is thought to involve either the lack of a 5 cap or that the dissociation of the 3 processing enzymes from the CTD causes a conformational change in the RNA polymerse ll 11 The two models for transcription termination in eukaryotes are illustrated below a polyA signal Rat1thn2 sequence a e 02014 Pearson Educalon Inc Fig 13 26 12 Torpedo model An enzyme has been discovered that binds to the RNAP in yeast called Rat1 in humans thn2 Another protein loads it onto the 5 end of the uncapped RNA It is a very processive enzyme and it rapidly degrades the RNA chain It might help to pull the RNA away from the RNAP similar to the rho factor in bacteria rho factor does not hydrolyze rna like this polyA signal RatlthnZ sequence uncapped 539 CAP end This is now the favored model Fig 13 26 13 Allosteric model In this model a conformational change in the RNAP causes the termination of transcription This could be induced allosterically due to the loss or binding of factors on the tail RNA degradation would still occur 539 CAP V l 539 CAP h 539 CAP f L m 39 E 2014 Pearson Education inc Fig 1326 14 Now a quick look at RNA polymerases l and Ill RNA Polymerase I has its own promoter There is a core promoter near the start of transcription and an upstream element called UCE composed of parts A and B It also uses TBP along with 3 TAFs in a complex called SL1 A second factor UBF binds to the other half of UCE B Fig 13 27 B A I II I UCE 15 What genes are transcribed by RNA polymerase I It transcribes a single gene that is a precursor for the 2 large ribosomal RNA molecules Why a pOlymeraSe f0 gaggrldggprotein products ribosomal RNA oner 1 product circumvent to have many copiees by there being many copies of the gene In fact there are many copies of this gene and it is expressed at a high level Why is this gene different from the genes transcribed by RNAP ll Its product is not translated into protein 16 The structure of RNA Polymerase I left is very similar to that of RNA polymerase II center and archaeal RNA polymerase right Archaea A190pr1Rpo lC A135 pr2 IRpoZ I AC40pr3 IRpoS AC19pr11Rpo11 I A8C27tpr5 proS A8C23pr6 IRpo6 A14pr4RpoF ABC145praRpo8 I A43pr7Rpo7 ABC1OB pr10Rpo10 A122pr9 4 A8C10a pr12Rpo12 A49 A34 5 Rpo13 7 Room Crystal structure of the 14subunit RNA polymerase I FernandezTornero C MorenoMorcillo M Rashid UJ Taylor NM Ruiz FM Gruene T Legrand P Steuerwald U MUIIer CW Nature 2013 Oct 3150274736449 doi 101038nature12636 l7 RNA Polymerase Ill like RNA Polymerase l shares some subunits with RNAP ll Like RNAP I it also transcribes genes for RNA products but there are many such genes for all the various tRNAs splicing RNAs and the small ribosomal RNAs Therefore there are a variety of promoters for these genes Each type of promoter might require different general transcription factors One common theme is the presence of downstream elements 18 This is the promoter for a yeast tRNA gene TFIIIC binds first in the downstream region This complex recruits TFIIIB which includes TBP to the transcription start site Now RNAP Ill can bind and initiate transcription 3 3 MTFIIIB 3quot Fig 1328 T m i Box A Box B TBP 19 Chapter 14 One of the biggest surprises in the SO some years of Molecular Biology was the discovery that mRNA is spliced In some organisms mRNA is synthesized as a long transcript but before the sequence is translated into a polypeptide many segments are cut out This is particularly common in mammals less so in yeast and very infrequently occurs in bacteria Coding sequences are called exons expressed and noncoding sequences are called introns intervening sequences The frequency of introns varies according to organism 20 L major G lamblia 7 vaginais C merolae E cuniculi G theta NM C parvum S cerevisiae C albicans P aurelia S pombe P falciparum P yoelii D discoideum I pseudonana N crassa A nidulans A gambiae D melanogaster B natans NM C briggsae C elegans P chrysosporium C reinhardtii C intestineis C neoformans I rubripes O sativa A thaliana M musculus H sapiens 0201 Poavwn Ewenon Inc Fig 14 2 ullllllllllllllllllll 21 Average number of introns per gene A A l L 0 N h 01 O 8 39V 1 1 T T T W I Average number of introns per gene for various eukaryotes A typical spliced gene with 4 exons and 3 introns Yeast genes might have a single intron whereas human genes might have more than 10 In human genes the introns are usually much longer than the exons promoter region intron1 2 3 31 1 D D exon 1 2 i 3 4 transcription noncoding 539 leader region I l 1 2 3 4 l l premRNA 539 l 339 spliced mRNA 539 339 1 2 3 4 lt0 20quot Pearson Echation in The human dihydrofolate reductase gene is 31 klo of which the 6 exons are only Zkb less than 10 Fig 144 22 This would seem to be a waste of resources to synthesize very long mRNAs only to discard most of the length We will discuss this later A question that can be answered how is splicing carried out promoter region l intron 1 2 3 genomic DNA 1 I D exon 1 2 3 4 transcription noncoding 539 leader region 1 2 3 4 I I premRNA 539 l 339 spliced mRNA 539 339 1 3223949981S0rEchailon t C 1 2 3 4 Some genes can be spliced in alternative ways resulting in many different proteins being produced from a single gene This is significant in many higher organisms 23 Splicing is very much dependent upon particular sequences of nucleotides at the junction sites These are called the 5 splice site and the 3 splice site In addition an important sequence including an A is found within the intron called the branch site 5 splice site 3 splice site 539 exon intron 3 exon 39 II II 39 39 539GU AG u YNYU RAYHY11NCAGMB39 I 39 I I I 539 splice site branch site 339 splice site GU A AG These are the most highly conserved bases Fi 14 3 g 24 The Chemistry of splicing 2 steps of transesterification 539 exon intron 339 exon 39 ll ll 39 39 5 AgGaGQU a l 5339 spliced exons Fig 144 25 539 exon intron 339 exon quot H IFquotquot 539 M Q Q A M 339 OH239 539 OH339 O A mg The Z OH of the conserved A at the branch point site attacks the phosphate at the 5 splice site This generates a new phosphodiester bond between the 2 O of the branch site A and the 5 O of the C at the 5 end of the intron This breaks a phosphoester bond at the 5 splice site Fig 144 So there is conservation of phosphoester bonds 26 Step 2 The 3 OH of the conserved G at the 5 exon attacks the phosphoester bond at the 3 splice site This bond is broken releasing the intron and making a new phosphoester bond that links the two exons 5mm A 0A OE ems Fig 144 Intron larlat spliced exons quot13 Warmquot Emma w Both steps of the splicing reaction are reversible That can lead to reinsertion of the intron into another site hopping introns It is uncertain to what extent this led to the proliferation of introns during evolution Both catalytic steps of nuclear premRNA splicing are reversible Tseng CK Cheng SC Science 2008 Jun 2732058841782 4 doi 101126science1158993 28 What exactly does the branch site look like in the lariat of intron The A nucleotide is linked by phospho ester bondsat3 different sites 2 3 5 Fig 14 5 29 Although the chemistry of splicing is rather simple we cannot expect these reactions to proceed without additional factors Matters of specificity and accuracy are of the utmost importance The correct exons must always be joined in order to produce correct proteins Likewise the junctions must be determined precisely Not surprisingly a large cellular apparatus is required to accomplish splicing of mRNA 30 The spliceosome is believed to be one of the largest structures in a eukaryotic cell The number of proteins associated with it is now thought to be more than 100 There are also 5 important RNAs Threedimensional structure of the native spliceosome by cryoelectron microscopy Azubel M Wolf SG Sperling J Sperling R Mol Cell 2004 Sep 101558339 31 The 5 RNAs are called small nuclear RNAs snRNAs They are directly involved in the catalytic steps of splicing Called U1 U2 U4 U5 U6 They are each 100 300 nucleotides long and come complexed with Joan A Steitz several proteins in a small nuclear 1941 r39b n l r t in nRNPs or quotsn r s Discoverec39 SNURPS Iouceopoe ss up 11980 video The spliceosome is composed of the 5 snRNPs and many more proteins It is not yet clear if the spliceosome has a more or less fixed composition as suggested by EM or if it adds and drops components as it goes through the splicing process as biochemical studies have suggested It certainly has a dynamic structure 32 The spliceosome in 5 orientations 240m 7 r o 0 29am Native U4 U6 U5 red U2 SF3b green U1 blue A unique spatial arrangement of the snRNPs within the native spliceosome emerges from in silico studies Frankenstein Z Sperling J Sperling R Eisenstein M 33 Structure 2012 Jun 62061097106 doi 101016jstr201203022 Epub 2012 May 10 In a recent study published September 2015 the best image yet of the spliceosome was revealed It is a cryogenic Electron Microscopy study of the S pombe spliceosome Resolution A I45 5 55 65 75 85 It is highly extended and its arms are probably very flexible Structure of a yeast spliceosome at 36 gstrom resolution Yan C Hang J Wan R Huang M Wong CC Shi Y Science 2015 Sep 11 349625311 8291 34 Detail of the spliceosome containing U2 U5 and U6 C complex 3 CW Head wa4Syf3 39 0 Arm I A CdC5 1 7 I 1 i I v K U2 snRNA v 2 p o u quot Arm II g wa8Prp19 Catalytic center w U5 snRNA Cwmsm 1 5 939 CM 2 Arm I Head 5 I Lariat RNA 7 I U6 snRNA o cch I wa1Prp5 I wa19 El Unknown 5 I U2 snRNA I wa8Prp19 I wa2Prp3 I wa5Ecm2 L US snRNP 1 amt nit n I Sm ring I wa7 I wa15 I wa14 g g gnRNP Downing Lea1 I wa3Syf1 I Prp45 I Prp17 C NTC 236 figm fyz I Ms1 wa4Syf3 El wa11 I Cyp1 3 Others Structure of a yeast spliceosome at 36angstrom resolution Yan C Hang J Wan R Huang M Wong CC Shi Y Science 2015 Sep 11 34962531182 91 35 How do RNA binding proteins such as snRNPs bind RNA One way is to bind the loop of a stem and loop structure as illustrated by the UlA protein also on slide 39 proteins bind in the loop because of theit lack of Hbonding stability 1 Fig 618 31 Crystal structure at 192 A resolution of the RNA binding domain of the UlA spliceosomal protein complexed With an RNA hairpin Oubridge C Ito N Evans PR Teo CH Nagai K Nature 1994 Dec 13726505432 8 36 snRNPs recognize the 5 splice sites and the branch site bring them together and catalyze the reactions b A exon2 539 339 doe305 U2 Fig 14 6 0 d exon2 I Gc 539 339 AmU U39 U2 1 C G A exon 2 AU 539 1 Ag 1 339 c 2 5 3 2 5 Game U2 W2C Who39sw Cc zwa V 3 7 In a U1 and U6 are shown making base pairing interactions with the intron sequence at the 5 splice site U1 makes the initial contact and then U6 takes over 2014 Pearson Education inc 38 Structure Of the U1 snRN P U1 consists of one RNA and 10 proteins The RNA is colored a pale blue 3 U1 proteins are labeled 70K A and C The 7 Sm proteins form a disk colored cyan U1 in the black circle and detail below binds at the 5 splice site lJ170K I Ui snl iNA 039 2 Z quot U1 0K 39 Crystal structure of human spliceosomal U1 snRNP at 55 A resolution Pomeranz Krummel DA Oubridge C Leung AK Li J Nagai K Nature 2009 Mar 26458723747580 In b U2 is shown making base pairing interactions with the intron sequence at the branch site The red A is the Z OH donor that becomes branched in the lariat b m exon 2 5 uecuas Illlls39 i 0 3 ix 0 U2 Fig 14 6 40 In c U2 is shown making base pairing interactions with U6 This interaction brings together the 5 splice site and the branch site C 29gt c o gt mnco c gt C oogtocgtQC Spliceosome factors U2 and U6 are able to catalyze a step of splicing without any other factors present That would indicate that the spliceosome is composed of catalytic RNA Structure of the yeast U2U6 snRNA complex Burke JE Sashital DG Zuo X Wang YX Butcher SE RNA 2012 Apr18467383 doi 101261rna031138111 A C U GA75 70U A C G CG U6 ISL C A 5 splice site C 38 reco nition se uence 65U A g q U U6 Helix Ill 50 A cgsuu Helix H G G U 90 41 45 A A 95 100 vCAAUAC 0U CAAAGAGAUUU UU I UGUUAUG UCCGUUUCUCUAAG 45 C40 A 35 15 10 5 U G GU Hellx la U2 Branch pornt recognition sequence Fg1 6 m In d a non snRNP BBP branch point binding protein is shown before it is displaced by snRNP U2 d exon 2 539 339 A l exon 2 539 M A 9 u 9 339 7 quot U G A U V i U2 E J c A u G A75 70U A C G CG U6 ISL C A 5 splice site C 380 39 39 65U A recognition sequence U A U6 H I39 III H r lb 2 935 e 39X 506A 9 39X C CGUUU 90 Helix 41 A 55 AGG G UA 95 100 i ii i c Grimmirri U 39 1 ACUAGAU UUCCGUUUCUCUAAGI g 45 A30 25 15 10 5 Helix la U2 Branch point recognition sequence 42 U1 V V w U2AF65 g 5 A 339 gt gag U1 7 V U2 5 I I I 3 2U52g U4 W U6 I gt U2AF65 35 v a 5 3 U1 953quot U6 U4 U2 5 39f 339 I I I l H I U4 1 U5 us u2 s A 339 gig 1 Initial binding of U1 at 5 splice site BBP at the branch site U2AF65 at the pyrimidine tract and 35 at the 3 splice site The Splicing Pathway Fig 14 7 43 Mss 2 Binding of U2 at the v A branch site displaces BBP This is called the A complex 3 Binding of U4 U 5 U6 pug brings the 5 splice site J and the branch site close 3 together and displaces U2AF65 and 35 This is k U called the B complex 5 A C e l K Splicing Fig 147 Pathway 44 U39 3 quot A s339 gt x 39BE U2 r r sr RNP 39 U1 V M U2 539 1553 snRNPs U4 U5 gt U2AF65 35 v quot3 5 I AI 3 i ll U6 U4 U2 539 39 jf 3v I l l l N I U4 I U5 U6 U2 5 A 339 2014 Dearson Education inc The Splicing Pathway 4 Release of U1 and replacement at 5 splice site by U6 bringing the splice sites together 5 U4 is released This is now the catalytic C complex Shown in slides 34 and 35 Fig 14 7 45 j U1 Fir 333w U2AF65 g 5 A n s a39 gt quot869 U k d I 4 C M U6 gt U2AF65 35 V 3 5 A 3 l The Splicing Pathway 6 First transesterification releases the 5 exon 75econd transesterification releases the lariat with U2U5U6 bound The snRNPs are recycled Fig 14 7 46 47 Alternative Splicing Exon Shuf ing mRNA Editing and Nuclear Transport Monday October 5 2015 BIOL 5304 lecture 17 Regulation of Alternative Splicing The splicing at a particular site can be enhanced by RNA sequence elements called enhancers exonic or intronic splicing enhancers ESE or ISE as we have sssnghsigorsmtnhaggarallyamsnpte splicing I W I splicingwould occur unless repressers bow w w q w 77 SlSRTlS I VSRJ SRWSQ UZAFGS 135i0 1 AU2 U2AF65 V RYYYY AG 391 A 39YYYY AG 39 Fig 14 11 ESE ESE intron exon intron exon intron quot Dearson Education Inc Similarly splicing can be repressed by RNA sequence elements called silencers exonic or intronic splicing silencers ESS or ISS SR proteins can lead to alternative splicing by acting in a particular type of cell or at a particular stage of development due to regulation of SR expression Illustration of repression of splicing A repressor site silencer exists near a splicing site In cell type I splicing occurs at the site because no repressor is expressed in that cell In cell type 2 the repressor is present and so splicing does not occur at that site a cell type 1 splicing site repressor site primary RNA transcript 5 3 splicing i machinery primary RNA t J l 3 transcript 5 spliced mRNA 539 3 cell type 2 539 3 O repressor 5 g339 339 unspliced Fig I4 22a 3 Illustration of enhancement of splicing A splicing enhancer sequence exists in this gene On the left this cell type lacks the activator protein and so splicing does not occur On the right this cell type expresses the activator and so splicing occurs Example Half pint protein in Drosophia is such an activator splicing splicing b site enhancer 539 339 5 339 activator V 539 339 539 3 l l unspliced 539 339 539 339 spliced RNA Fig l4 22b Most silencers are bound by members of the heterogeneous nuclear ribonucleoprotein family hnRNP These proteins bind RNA but do not contain RS domains and so do not recruit splicing machinery They block splicing by preventing the use of the splice sites Two examples 1 Human immunodeficiency virus HIV tat gene 2 Mammalian hnRNPI or PTB protein HIV tat exon 3 SC35 is an SR protein that activates splicing by binding to an incompetition ESE exonic splicing enhancer A1 is an hnRNP that suppresses splicin be bindin to a ocoope atlve mo pr ent more bin 3 and WlnS nearby ESS exonlc spllcmg silencer Cooperative binding of A1 allows it to compete with SC35 and suppress splicing a SC35 ESE ESS Fig 14 23a PTB Py tract binding protein is an hnRNP that binds to splice sites and interacts with U1 This interaction prevents U1 from working with factors at the 3 splice site Therefore splicing will not occur at a splice site that has PTB bound and an exon will be skipped Fig 14 23b 39 pliced out as if it were an intron U1 U1 PTB U2 exon exclusion 7 An example of regulated alternative splicing Sex determination in Drosophila depends upon the splicing of sz the double sex gene Because females have twice the ratio of X chromosomes to autosomes that males have females have twice the level of transcriptional activators SisA and SisB This leads to transcription from the Pe promoter in females only but not in males 2X as many genes 2X as many proteins FEMALES MALES 2X2A 1X2A sisa I Isisa I sisb dpn sisb dpn 2x 1x 1x 1x l l repressors win no transcription Pm Pe stop Pm Pe Stop DNA D DQDDDDD DNADDDWDDDDD transcription notranscription activators Win and transcriptl n begins at promoter Pe Pm malntenance promoter extra premRNA 539 339 exon39 effgds Whether Or Gt a productive protein IS made lsplicing if starts at the Pm will not make a productive protein spliced mRNA 539 339 t Fig 14 24 early le protein N C it 2074 Pearson Educator no In males the repressor Dpn Deadpan prevents transcription of the early SXI gene Sex lethal In females the doubled amount of the transcriptional activators SisA and SisB allows expression of early le Transcription from the Pm promoter is constitutive which allows transcription of SXI in both females and males but this transcript has an additional exon that makes the protein nonfunctional In females the extra exon is spliced out due to the presence of pre existing le protein FEMALES MALES 2X2A 1X2A I sisa I I sisa sisb dpn sisb dpn 2X 1X 1 X 1X Pm Pe sto Pm Pe Stop 3 13731313131313 DNADDDZDDDDD ltranscription no transcription premRNA 539 15m 339 lsplicing spliced mRNA 539 339 Fig l 424 1 early le protein N C 393 2074 Eearson Educatorr Incl d regulated 339 splice site 539 ll 339 legene 5 339 1 no functional protein regulated 339 splice site L 539 339 tra gene 539339 1 no functional protein introns retained not functional regulated 3 splice site 539 339 dsx gene 539 339 l l represses female genes 1 male development lt3 2314 Pearson Education r c N DC proteins le protein 539 539339 l 8 Tra protein Tra2 gctl ator 539 1amp 339 5 339 l JC l represses male genes and activates female genes l female development The le protein is necessary to repress splicing so that a functional le protein can be made when transcription occurs from the Pm promoter In males lacking le a functional le protein is not made using the Pm promoter In females the le protein also represses splicing in the Tra mRNA As with le males cannot make a functional Tra since they lack le Fig 14 25 10 How le ties up mRNA to prevent splicing aitkmx 3 nBEHnRNA UanSD1 ties up mrna very tightly so it cant get lose and interact with the splicing machine Structural basis for the assembly of the leUnr translation regulatory complex Hennig J Militti C Popowicz GM Wang I Sonntag M GeerlofA Gabel F Gebauer F Sattler M Nature 2014 Sep 7 doi 101038nature13693 Epub ahead of print 11 d regulated 339 splice site 539 l 339 legene 5 339 1 no functional protein regulated 339 splice site 539 l339 tra gene 539 339 1 no functional protein regulated 339 splice site 539 339 dsx gene 5 339 l c DSX l represses female genes 1 male development lt3 2314 Pearson Education r c N proteins 39 le protein 539 1 339 539339 l 8 Tra protein magi 539 1amp 339 5 339 l l represses male genes and activates female genes l female development Finally Tra is an activator of splicing in sz the double sex gene In females this generates a sz protein that represses male genes and activates female genes In males without the splicing activator Tra a longer sz protein is made This represses female genes leading to male development Fig 14 25 12 A similar splicing choice lies at the heart of differentiation by embryonic stem cells Daughter cells must determine whether to remain stem cells with pluripotency or to differentiate Particular transcription factors such as Nanog and OCT4 are required to maintain pluripotency The FOXPl transcription factor is required for the expression of OCT4 Nanog and other such factors see next slide 13 Exons 18a and 18b are paired such that either one or the other is spliced into the transcript 18a leads to differentiation 18b leads to pluripotency Fig 14 26 stem differentiated cells cells FOXP1ES FOXP1 39 l pluripotency differentiation pluripotency differentiation genes genes genes genes 14 In humans many defective proteins leading to serious disorders are a consequence of splicing errors For example muta ions that effect splicing factors or part of the actual machinery rather than just a protein g thalassemia familial isolated growth hormone type II Frasier syndrome some forms of cystic fibrosis Box 144 Fig 1 retinitis pigmentosa Now let us turn to the questions of what is the utility of introns and where did they come from 15 Nat Rev Genet 2006 Mar7321121 Review 16 Roy SW Gilbert W The evolution of spliceosomal introns patterns puzzles and progress Hgl42 C 2014 organ haunt0 Inc Average number of introns per gene 0 N 03 b 01 O l l 1 L major G lamblia 7T vaginais C merolae E cuniculi G theta NM C parvum S cerevisiae C albicans P aurelia S pombe P falciparum P yoelii D discoideum I pseudonana N crassa A nidulans A gambiae D melanogaster B natans NM C briggsae C elegans P chrysosporium C reinhardtii C intestineis C neoformans 7T rubripes O sativa A thaliana M musculus H sapiens higher organisms more introns per gen 8 Spliceosomal introns are very prevalent in many eukaryotes less common in others and are not found in bacteria or archaea Two explanations have been offered for this observation lntrons were once plentiful in Bacteria but they have been lost over the ages This is called the intronsearly due to alot of pressure on them to divide rapidy hypothesIs Or introns were not initially present in bacteria but have been acquired by eukaryotes in more recent times This is called the intronslate hypothesis they are not mutually exclusive events 17 If the introns early model is correct why are introns absent in bacteria currently In general bacteria are very gene rich They carry very little extra DNA and so the pressure to eliminate non essential DNA might have eliminated introns genome streamlining Many unicellular eukaryotes such as S cerevisiae also have compact genomes and few introns 18 Alternatively in the introns late model introns did not originally exist in bacteria but instead arose later after eukaryotes had come into being For example they might have come from transposons that invaded bacterial genomes It seems likely that there may not be a single simple explanation for the observation that introns are more common in eukaryotes Analysis of introns in model organisms has indicated that some introns are ancient pre dating the animal fungi split whereas others appear to be much more recent So it is unlikely that all introns came early from bacteria 19 One possible scenario has been outlined recently lntrons have evolved in some bacteria from Group II self splicing introns When such bacteria invaded other cells eg archaea to form eukaryotes the introduced introns proliferated This led to the generation of a spliceosome to process RNA splicing more rapidly and a nuclear membrane to separate RNA processing from translation The origin of introns and their role in eukaryogenesis a compromise solution to the intronsearly versus intronslate debate Koonin EV Biol Direct 2006 Aug 14122 Origin and evolution of spliceosomal introns Rogozin IB Carmel L Csuros M Koonin EV Biol Direct 2012 Apr 16711 doi 10118617456150711 Review 20 Since introns are plentiful in many organisms and they clearly require a large investment by the cells we can consider what advantages they might bring to an organism First introns allow the possibility of alternative splicing as we learned about last lecture But on a larger scale the existence of introns facilitates the shuffling of exons eg via recombinational mechanisms thereby allowing new genes to be generated from the exons of different genes 21 Several observations support this idea 5 exon1 exon2 3 39 39 1 The boundaries between introns and exons do not appear to be random Many E1 E2 exons encode structural or 5 339 functional domains in translation proteins exons ofte corespond to protein domains protein domains and dimerization domains Here exon 1 codes for a 65m am 391 domain 2 DNA binding domain and exon 2 codes for a dimer 1 ization domain Many 02 D2 J dimerization proteins are modular in this I f way39 modularity is preserved DNA binding Fig 14 27 22 2 Many genes appear to have arisen through duplication of other genes leading to proteins that have pseudo symmetry Antibodies are composed of multiple similar domains This mechanism is more likely if large introns separate the domain encoding exons 4 very similar domains and red is the binding domain The antigen is in red The 2 blue domains are from one poly pepUdeandthe yellow and green domains are from another All four domains are related 23 3 Some exons appear to be found in a variety of otherwise unrelated proteins This also supports a modular view of protein domains The LDL receptor involved in cholesterol recycling has 5 adjacent exons related to an immunological protein C9 complement and 9 exons related to the epidermal growth factor precursor exon LDL receptor gene 1 2 3 4 5 6 78 9 101112131415161718 r I l l r y r I 39 I l l r y y v y w 1 39 l I 39 f 39 v gt V V V 09 complement EGF precursor gene gene Fig 14 28 24 The success of recombination like mechanisms to shuffle exons is facilitated by conservation of splice site junctions and by the relatively long length of introns relative to exons So recombination junctions are more likely to occur within introns than within exons Therefore exons are more likely to shuffled intact cannot put 2 together because they are out of frame fusing 2 proteins of advantageous bc most dna is introns better to use dna to retain 3100 of integreity of dna 25 Examples of how functional domains are assembled in several eukaryotes It appears that these domains can be added subtracted or exchanged a Y W F C D 9 am 117 l l l b Y w FH W F H 39 00b gt 00b 0 gt 3003 o gt Jr s gt 0015 YF O Y V x A HA I Common ancestor A WFH Br 7 quot Ch an rA SW12 HMT D 1 ll 1 l 3 D quot Jgt 78001 Nacmmar Yyeast W worms C eegans Fflies Drosophia Hhumans Fig 14 29 26 mRNA Editing mRNA can be edited before translation There are two known types of editing the mrna is made spliced seems to be ready to be ready but it is not The first is sitespecific deamination In one example cytidine C is converted to uridine U This is typically a highly regulated event and might occur at one position in a transcript only under certain conditions or in particular cell types a NH2 0 CAN 0 C C b Fig 14 31 0 N y ADAR N commonly used as RNA I l bc it can be base paired I N N and translated 27 In this case deamination of a C to a U results in a stop codon in apolipoprotein B in the intestine In the liver the editing does not occur The two forms of the protein have somewhat different functions codon 2153 within exon 26 premRNA I l 339 mRNA 3 transport to Mr i itlii cl rl 22 liamn no editing CAA pgt UAA in intestine short 3 339 stop codon translation translation glutamine N C N C 4563aa protein 2153aa protein 102314 Dearscn Eoucatrcn 39v Fig 1 430 2 diferent version of something in the liver linger protein in the interstines shorter protien 28 A second example of a deamination reaction is Adenosine to lnosine lnosine can base pair with C U or A but it seems to prefer C after this editing process ifla person is o The enzyme that carries this dzigct39coi39gyigrfg39s H3 53923 there will be H out is called ADAR adenosine isswsinbpram O llllllll HN H deaminase editing on RNA deva m occurs in many eukaryotic organisms including hman gltN H quotquotquotquot quot o o o 0 f 056 N 39 This type of editing is H t o o inosme cy osme particularly important in O H brain development V o HNWH N N H quotquotquotquot quot0 Nribose Flg 46 ribose Nlt H H CH3 inosine uracil NHIIIIHIIO 4 H N O quotquotquotquot H N N H N NHN3 T Y Y N N N H quotquotquotquot quotN N39 lt ribose Nlt N ribose H O H H inosine adenine 2 9 The second type of mRNA editing uridine insertion or deletion is completely different It is known to occur in the mitochondria of trypanosomes and in some other unicellular eukaryotes African sleeping sickness Typically Us are inserted into the transcript after RNA synthesis This tends to completely change the message by changing the reading frame and increases the total number of amino acids in the protein This editing is accomplished through the assistance of guide special RNAs that sassist in inserting uridines 3O Guide RNAs are 40 80 nucleotides in length and are coded for by genes that are distinct from those whose transcripts will be edited They have 3 important regions poly U editing region and anchor anchor sequence that can march up with unedited RNA b unedited RNA 539 W 339 guide RNA 339 I POWU C UAAC39A UA U G G A 539 i ll J editing anchor region ii 2014 Pearson Education inc 1 The anchor region base pairs with the RNA to be edited The editing region contains A s that mark the sites where U s will be inserted 31 Fig 13 26 RNA editing by guide RNA mediated U insertion a c site of U insertion DNA 5396 GAGAAC c 1 339 mRNA 539 339 sequence 1 Primary 539 339 9W 339 mm c quotAACAUAJP 6 quot 539 RNA 39 39 5 3 5 editing anchor ed39ung 2U U U region region of l homology mRNA 539 UIDIUI 339 l i ll 11 1 i l 5 3 339 IndyUICUCAUAUGGA 539 quotquot X quot AA protein quot D C I I P I endonuclease I quot 39 cuts at mismatch 339 539 539 339 b 339 polyUICUAAC39AUA39UGGA 539 unedited RNA 5 339 UTP 38dgaeigihgu33 dglgNA guide RNA 339 ladyU c ulAACAUAlllJ GGAJ 539 U U editing region editing anchor 9 region 339 z E 539 5 3 339 IndyUlcuii AUAUGGA 539 ligase joins 539 to 339 ends of message F I g 1 4 3 2 339 PdYUICUAACA UAU39GG A 539 c 21314 9035mm ECocatzr Inc 32 a DNA 50 sequence primary 5 In part a the positions RNA of U Insertions are editing 2UUU 1 shown along With the resulting amino acids RNA 539 o m in the polypeptide 1 Chain 2014PearsonEducggrullrdcobe import or ctr an rt or in making atp b In part b the unedited RNA 539 339 alignment of the guide gmdeRNA 339 po39y39UICUIAA39CAUAl GGAI 539 RNA with the unedited editing anchor o region l5 Shown Fig 14 32ab 33 site of U insertion In part C the steps of RNA mRNA 5 eAcummcu 339 editing are shown gRNA 3397ponU CUAACAUAUGGA 539 I II I editing anchor region region of Alignment of the guide RNA homology 1 mRNA is cleaved at 539 icgeg tgsgggaqqq 339 339 tipdryjU I 39 A O K f sir 539 mismatches by an M d I CUtS at mismatch 5quot 3963 39496999 339 JED411341 A AC AoAu39 e39c A39 539 At gaps Us are added by 3 term i n al u ri dy I yl tran sferase Pi ESSZdSSi E39mSUV39ii idngiNt editing region TUTase 3 ES 5quot GAE EQPAUAQQU 339 339 quot661 4 01396390 AUA39U G pi 539 y A A1 Iigase joins 539 to 3 ends of message Nicks are sealed by an RNA Iigase l 539 Q U E 39 UIU AC C U 339 quot39BBIFU roui K 7amp1 A U G39 e39 p 0 3 2014 Pearson Education inc F l g 1 4 3 2 C 34 Transport of mRNA from the Nucleus mRNAs are synthesized in the nucleus of eukaryotic cells There they are capped spliced and polyadenylated Some are edited as just shown nuclear envelope where allt he splicing and processes occur gt ready gt mrnas and rrnas must have a pathway out of the nucleus a nuclear pore To be translated into polypeptides they must be transported through the nuclear pore into the cytoplasm Ribosomal RNA must undergo a similar journey to the cytoplasm for assembly of ribosomes 35 This is a major step of quality control The nucleus contains many RNA molecules that are not meant to be translated or that are not yet ready to be translated only fully processes spliced and cap they should leave the nucleus if hey are not they s39nouid be atttacked by some enzyme in tr39r11ueC eugi us mUSt be AAA AAA AAA o mRNA for tranSport In the nucleus Some will be destroyed some will be further processed and 97 others remain V Cr in the n uc l eus to 1 function AAAI AAA AAA r 45 there Cymsm Fig 14 33 36 Exit from the nucleus occurs through the nuclear pores Successful exit depends upon the proteins that are bound to the mRNA Exit requires GTPase proteins called Ran which use the energy of GTP hydrolysis Fig 14 33 nucleus protein tag escorts a a It l lquot i 391 Iquot K gt 1quot AAAAAKAAA39 mRNA for transport cytosol 37 Structure of the nuclear pore Nuclear Pore Complex and FG nucleoporins Nup116 AA 348458 coHapsed 36 CO 1 764 960 Nsp1 n AA 3177471 canopy stalk N l charged Ms 2 36 re39axed i 1 186 617 CO SingleMolecule Analysis of the Recognition Forces Underlying NucleoCytoplasmic Transport Rangl M Ebner A Yamada J Rankl C Tampe R Gruber HJ Rexach M Hinterdorfer P Angew Chem Int Ed Engl 2013 Sep 5 doi 101002anie201305359 Epub ahead of print 38 39


Buy Material

Are you sure you want to buy this material for

75 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Bentley McCaw University of Florida

"I was shooting for a perfect 4.0 GPA this semester. Having StudySoup as a study aid was critical to helping me achieve my goal...and I nailed it!"

Janice Dongeun University of Washington

"I used the money I made selling my notes & study guides to pay for spring break in Olympia, Washington...which was Sweet!"

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."


"Their 'Elite Notetakers' are making over $1,200/month in sales by creating high quality content that helps their classmates in a time of need."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.