New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

Test 3 Notes and Review

by: Abigail Towe

Test 3 Notes and Review 85033 - GEN 3000 - 002

Abigail Towe
GPA 3.6
Fundamental Genetics
Kate Leanne Willingha Tsai

Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

This is compilation of chapter 8-11 and study guide for test 3.
Fundamental Genetics
Kate Leanne Willingha Tsai
75 ?




Popular in Fundamental Genetics

Popular in Biomedical Sciences

This 208 page Bundle was uploaded by Abigail Towe on Monday August 31, 2015. The Bundle belongs to 85033 - GEN 3000 - 002 at Clemson University taught by Kate Leanne Willingha Tsai in Spring 2015. Since its upload, it has received 160 views. For similar materials see Fundamental Genetics in Biomedical Sciences at Clemson University.

Similar to 85033 - GEN 3000 - 002 at Clemson

Popular in Biomedical Sciences


Reviews for Test 3 Notes and Review


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 08/31/15
Bacterial and Viral Genetic Systems Table 81 Advantages of using bacteria and viruses for genetic studies I Reproduction is rapid 2 Many progeny are produced 3 Haploid genome allows all mutations to be expressed directly 4 Asexual reproduction simplifies the isolation of genetically pure strains 5 Growth in the laboratory is easy and requires lit tle space 6 Genomes are small Techniques are available for isolating and manip ulating their genes 8 They have medical importance 9 They can be genetically engineered to produce substances of commercial value Escherichia coli the workhorse Single circular chromosome 46 Mb 4000 genes a Culturing bacteria in liquid medium 39 noculating loop I Sterile liquid medium b Culturing bacteria on petri plates Pipet Lid Class rod Dilute soluion Petri plate of bacterial cells 2012 Pearson Education Inc Handle 814 r Selective medium Only leu I lacking leucme bacteria grow all I it w m I 4 s vi I Velvet surface t x e Mlssmg 39 sterilized 1 39 colony iii image e T f 2 53 39 if w to 39 j 39V 4 t 39 quotquotf 39 243 quot quottip3 9 Bacterial 53 Culture gt L drv gt culture Complete leu and leu medium bacteria grow Prototroph Wildtype bacteria that can synthesize all compounds needed for growth from simple ingredients Auxotroph mutant strain that lacks one or more enzymes required for metabolizing nutrients Will grow on supplemented media e L o39 e quotr fgi39 39 h rquot I I ampI H quot32ko Most bacteria possess a single circular chromosome But some have multiple chromosomes Also a few have linear genomes Funny thing can happen when you mix bacteria Some progeny Partial genome 39 transfer by DNA uptake Transformation Coniungation Coniugation Partial genome transfer during conjugation Plasmid transe during conjungation Transduction Transfer as part of viral genome a Conjugation Gene Transfer in Bacteria f Donor Recipient cell cell Degraded Direct transfer of DNA from one bacterium to 39 another donor to recipient only Bacterial k chromosome 1 b Transformation 1DNA ragments v DNA taken up from medium K c Transduction Bacterlal Vlruses phages carry DNA from one bacterium to 0 another Differs from Eukaryotic 1 DNA exchange and reproduction are not coupled in bacteria 2 Cell remains haploid Plasmids are Extrachromosomal DNAs Small circular DNAs 1000s of bp usually 1100scell Replicates independently of chromosome Origin of replication oriV site d Strand separation Doublestranded DNA Newly synthesized DNA Separation Replication of daughter 4 plasmids Strands separate New strand at ori V Old strand Lederberg and Tatum 1946 A B met bio thr Ieu thi M39xture met bio thr 39 Ieu thi 39 gt 2 39 lt 39 l l l Wash cells Wash cells Wash cells Plate 103 cells Plate 108 cells Plate 103 cells met bio thr Ieu thi colonies Prototrophic colonies colonies Question How did the genetic exchange seen in Lederberg and Tatum s experiment take place Auxotrophic Auxotrophic strain A strain B a 39 Strain Minimal Minimal Minimal Minimal medium medium medium medium No growth No growth No growth No growth Conclusion Genetic exchange requires direct contact between bacterial cells Filter does not allow bacteria to pass through Rolling circle a b replication Bacterial chromosome Pilus Plasmid Recipient F F fertility factor a circular episome Sequences that regulate insertion into the bacterial chromosome I52 Episome plasmid that are capable of integration into the chromosome Cenesthat regulate plasmid transfer to other Genes that cells control plasmid replication oriV origin Origin of of replication transfer inc rep F factor F and F39 Bacteria Fertility factor F cells that have it W those Without F39 Contains origin of replication genes involved in conjugation including genes that encode for sex pili F can contact F39 and transfer DNA only works this way FJr to F39 Sequencesthatregukne insertion into the bacterial chromosome 52 Cenesthat regulate plasmid transfer to other Genes that cells a control v plasmid replication oriV origin Origin of of replication transfer inc rep F factor Conjugation can transfer F factor a b F cell F cell donor recipient bacterium bacterium F a Q 0 F factor Bacterial chromosome b C One strand of DNA on F factor is nicked replication then occurs replacing the nicked strand d c Single strand is replicated d E F F a 0 0 Hfr Cells Highfrequency Bacterial F cell Chromosome Hfr cell F factor F factor is integrated into the bacterial chromosome Hfr cells behave like F forming pili and conjugating With F39 a b c Hfr cell F cell Bacterial Hfr chromosome chromosome F factor plus bacterial genes Because F factor is in chromosome some of chromosome gets pulled into recipient cell Amount depends on length of time of conjugation c d e Hfr cell F cell Hfr chromosome F factor plus bacterial genes NOTE Because the F factor is nicked in the middle during strand transfer the recipient F does not get the Whole F factor remains F to get the Whole F factor the Whole chromosome must be transferred F39Cells Cells With F plasmid that contains some bacterial genes Hfr cell F39 cell F factor I Bacterial chromosome Bacterial with integrated F factor chromosome i a A Hfr cell CO F factor E Di i B A Hfrcell C E D 1 Excision of the F factor from the chromosome begins During excision the F factor sometimes carries with it part of the chromosome A F39 cell C OD 0 the A and E regions 2 Excision is complete During excision the A and E regions of the chromosome are retained in the F factor A F39 39 CO Q 7 7 The cell is converted to F39 v l aE erozygoe e 377 39 F39 Ill cecODEo Exconjugants 5 Replication and transfer of the F factor is complete The F recipient has become partially diploid for the A and E regions and is called a merozygote x It is also F39 C b F cell i do a 3 The F39 cell is a modified l39 cell and may I B A 39 undergo conjugation with an F cell co 0 I D C 4 The F factor replicates as one strand is transferred 9 2012 Pearson Education Inc Merozygote bacteria that is now a partial diploid F factor excised from Hfr some genomic genes on the episome w Table 82 Characteristics of E coli cells with different types of F factor F Factor Role in Type Characteristics Conjugation F Present as separate Donor circular DNA F Absent Recipient Hfr Present integrated Highfrequency into bacterial donor chromosome F Present as separate Donor circular DNA carrying some bacterial genes Table 83 Results of conjugation between cells with different F factors Conjugating Cell Types Present After Cells Conjugation F X F Two F cells F cell becomes F Hfr X F One Hfr cell and one F no change F x F Two F cells F cell becomes F Rarely the F cell becomes F in an Hfr x F conjugation if the entire chromosome is transferred during conjugation Table 51 Some Genotypic Symbols Used in Bacterial Genetics Character or phenotype associated Symbol with symbol bia Requires biotin added as a supplement to minimal medium mg Requires arginine added as a supplement to minimal medium met Requires methionine added as a supplement to minimal medium lac Cannot utilize lactose as a carbon source gal Cannot utilize galactose as a carbon source strr Resistant to the antibiotic streptomycin strs Sensitive to the antibiotic streptomycin Note Minimal medium is the basic synthetic medium for bacterial growth without nutrient supplements Francois Jacob and Elie Wollman a Hfr F tons 02139 Genes transferred thr leu and tr gxmr first selected genes aiir gal quot4 9 Ieu defined as zero time B ri S aCte ta thr Ieu Str epara e I l h I l I I I azir Gene mapping by interrupted conjugation 100 min to transfer Whole E coli chromosome 8 min Bacteria tonr thr Ieu str separate mmI gt 02 r Bacteria separate torir thr IeW str i y Lit gt i i Iac azir Bacteria separate b g 100 r m y ao o o o AZI L r 8 L fT O 0 Ton 5 g 60 a O g 2 40 o 5 Ea 0 a g gt5 20 39 0 g a 0 o L I 0 39 0 10 20 30 40 50 60 Time minutes after start of k conjugation between Hfr and F cells j Conclusion The transfer times indicate the order and relative distances between genes and can be used to Kconstruct a genetic map Time map Different Hfr strains have the F factor integrated at different site and in different orientation a Hfrl thr pg E II t E 39 F factorq his I azi quotChromosome I gal quotpro lac leu thr thi his gal lac pro azi I I I I 111 I Genetic map b Her thr rm 4 lea a o 39 F factor A h a IS IIChromosome 02 s I gal quot PFO lac thi thr leu azi pro lac gal his va I I I I I I I Cenetic map a Hfrl thr thi 39 lea 9 I F factor his I azi Ch romy gal 39 pro lac 1 ea thr thi his gal lac pro azi Genetic map b Her thr thi 9 F factor his azi Chromosome lac thi thr Ieu azi pro lac gal his Genetic map Using different Hfr strains to map a bacterial chromosome a Order of gene transfer unaligned thr lea azi pro lac gal his thi I I I I I I I I H lea thr thi his gal lac pro azi 1 i i pro azi lea thr thi his gal lac 2 I lac pro azi lea thr thi his gal D I I I I I I I all I thi his gal lac pro azi lea thr I I f r 4 I I I I I I I thi thr lea azi pro lac gal his I W I I I I I I I I b Order of gene transfer with genes aligned Hfr strain thi thr leu azi pro lac gal his 5 Wk thr leu azi pro lac gal his thi H thr leu azi pro lac gal his thi 4 azi pro lac gal his thi thr leu I n lac gal his thi thr Ieu azi pro 2 2 i ii gal his thi thr leu azi pro lac 3 aming c thr til g leu his 5 azi gal pm lac thr homework Consider that if you take a sample at each time point and colonies have grown then it means that it s wild type at the point for wherever the start is If you give it lactose it could be wild type or mutant If thymine is in the media then it could be positive or mutant But if I don t and it dies then I know it s mutant If I don t and it lives then it s wild type for thymine Wild type Mutant Bacterial transformation is different from conjugation DNA is external then taken into cell DNAbinding complex a Nucleotide Cell wall Cytoplasmic membrane DNAdegrading enzyme Free DNA from dead bacterium W Chromosome Transformed Transferred bacterium DNA Bacterial Transformation DNA taken up from surrounding and incorporated in genome can occur naturally DNA from dead cells in environment Scary Competent cells that can take up DNA Recipient DNA HeterodupleX Doublestranded V2 transformed fragment of DNA One strand is hydrolyzed We do this everyday introduce DNA by ELECTROPORATION Introduction of arti cial plasmids is a key to modern molecular biology Gene mapping using transformation Donor cell Uptake of Transformants I 61 I nc r gt a UC b b 61 17 c 39 3 g 39 Recipient cell a if r 13 a 7 j C M D cw o 7 I 5 quot0 lch Rate of cotransformation is inversely proportional to distances between genes Viruses 0 all organisms are infected by Viruses Nucleic acid coated in protein dsDNA ssDNA ssRNA ds RNA 0 linear or circular genome n5 V l aquot a w 039 r rm 39 3 7 5quot 5 quot I 33 a w W5 A gimmeng w Mu gifm l x V 39 7 I Nquot 924 A R39 a i lj ix NS W I l x t s 3 e v m Ig VA aw Y ixqil h I L 5 quotp M quot wmvm W o 0 7 A it x t e 4 quot 45 quotV 39 r 5 a ot h 39 39 39 l l J V1 w 5 hop Q Free phage Injected DNA Cell wall T4 phage components Head Neck and collar Core Sheath End plate ML Fibers Bacertiophages phage have two alternative life cycles Phage DNA is packa 1 using hostderived proteins 3 Replicated 4 RR phage Phage DNA replicates using host components Virulent phage reproduce only through lytic cycle Temperate phage use either lytic or lysogenic cycles Lederberg and Zinder Generalized transduction Mix two different auxotrophic strains Plate on minimal medium see if transduction has occurred Phetrp tyrmet v v Prototrophic Prototrophic colonies N0 COIOHIES colonies h hi Phage could pass through lter Transducing Phage Fragments Pha e g of bacterial Phage chromosome DNA r A ll T if atquot quotquot m 9 a i we 0 5 3 i 2 U Recipient Transductant cell COM Donor Transducing Normal bacterium phage phage 1 Requires that phage degrade bacterial chromosome 2 Packaging DNA into phage cannot be specific for phage DNA 3 Recombination must occur With the recipient chromosome ONLY A SMALL PORTION OF THE BACTERIAL DNA CAN BE TRANSDUCED phage it too small to pack the Whole thing Mapping Genes using Generalized Transduction Phage Phage I DNA Bacterial chromosom is broken down and packaged Recombination r A quoti39vs39 I b 5 C a C gt Single transductants J l gt if 5 DC Cotransductant b i V 15 c Nontransductant Rate of cotransduction is inversely proportional to distances bt genes Clear areas or plaques 399 Alfred Hershey amp Raquel Rotman studied phage recombination 39 fection 0f 5 CO 3 used T2 bacteriophage 1 one strain could infect type B E coli but not type B2 h also l l produced abnormal plaques r a 43 t J Recombination one stra1n could 1nfect both B 11 l r and B2 h produced normal 21 r plaques ltrgt W l Wquot 1quot h r h r hr x hr then infect type B m1 baCteria W r if r h rquot hquot 1quotquot Mixed Infection Experiment 9 Non Recombinant Recombinant Non recombinant phage phage recombinant phage produces produces produces phage produces cloudy large cloudy small clear large clear small plaques plaques plaques plaques g Then plate progeny on 39 t O C mixture of B and B2 O bacteria hjr 7 Phages With h could o only infect B yielded cloudy plaque 39 0 a k hr r yielded small o g o G plaques 390 0 O o 39 hiIr o 39 r y1elded large quotquot 39 O O 39 plaques 394 o 39 SO the genotypes could C be calculated Table 84 Progeny phage produced from Phenotype Genotype Clear and small h r Cloudy and large hr Cloudy and small hr Clear and large h r Results of a cross for the h and r genes in phage T2 h r gtlt hr Genotype Plaques Designation h r 42 Parental progeny W T 34 76 W r 2 Recombinant hr 12 24 k recombinant plaques h 1 h 1quot total plaques total plaques Mapping Bacterial Genes 1 Interrupted Conjugation 2 Transformation 3 Transduction Partial genome transfer by DNA uptake Transformation Coniungation Cc Plasmid transfer during conjungation Conjugation quotquot D Partial genome transfer during conjugation Transduction Transfer as part of viral genome phf o thrAD PY A deA Jam eu 02f quot 0 A B I C a cysC cysH eno reIA argA recC mutH 60 ptr thyA 61 b I tH gaIR POSPC quot cysC i cysH eno rem barA sdedacxo 9 VA m tAargA ptr recC thyA ptstquot aas 0 05 9 III rvnlllr I I II I V III III I cc cczmuztm cmEol 3cm 2 Early on Genetic Material had some known properties 1 2 Must encode complex information Must be capable of being replicated faithfully Must contain enough information to yield phenotype Must have variation as a result of mutation 1833 1869 1884 1900 Brown Miescher discovers Histones Mendel s describes nuclein DNA in isolated work nucleus of the nuclei of from rediscovered the cell white blood cells nucleus I 1830 1840 1850 1860 1870 1880 ll890 139900 1839 1866 1887 Late 1800 s Shleiden and Mendel s work Recognition that nucleus Kossel determines Schwann propose is first published is the physical that DNA contains cell theory basis of heredity nitrogenous bases Miescher studied pus isolated nuclei contained slightly acid material named in nuclein Kossel determined bases Adenine cytosine guanine and thymine 1910 1928 1947 1952 1953 Levene Griffith Ashbury Hershey and Chase Watson and Crick proposes demonstrates begins Xray demonstrate that DNA devise the secondary tetranucleotide transforming diffraction is genetic material structure for DNA theory principle studies of DNA in bacteriophage 1880 1890 1900 1910 1920 1930 1940 P950 l 1960 1944 1948 1956 Avery MacLeod and Chargaff and FraenkelConrat and McCarty demonstrate colleagues discover Singer show that some that the transforming regularity in base viruses use RNA as principle is DNA ratios of DNA genetic material Levene nucleotide most basic component of DNA sugar phosphate and base Also proposed tetranucleotide theory DNA is made up of units of four bases in a fixed sequence DNA too regular to encode info protein is genetic material Fred Grif th 1928 Transforming Principle early efforts to ID Used Streptococcus pneumonia Virulent strain has polysaccharide coat have smooth coat S R rough avirulent lack coat Some S could become R spontaneouslyWhy because one could infect and kill the other could not First he tried to heat kill because it causes them to lyse and die So When he did that and then put it in mice the mice survived But When he took some R type and some S type that s heated the mouse died a b C Type IIIS Type IIR Heat killed virulent nonvirulent type IIIS bacteria bacteria bacteria 5 4 s 333 0533 l 1445 l J K r d Type IIR bacteria Heatkilled typeIHS bacteria 52 39m t 3909 59 V c youquot quot 39 339 3 14 1 t Q FQ K i k Mouse dies Mouse lives Mouse livesf Mouse dies iv Autopsy Type IIIS No bacteria No bacteria Type IIIS virulent recovered recovered virulent bacteria bacteria recovered recovered Avery MacLeod and McCarty isolated transforming principle 1944 2 N u if 2 M r a w 19quot S strain exquotad No components Polysaccharides Lipids RNA Protein DNA destroyed destroyed destroyed destroyed destroyed destroyed 0 0 0 0 0 0 o 0 0 0 o 0 0 0 0 0 0 0 R strain m quot3 39 1 a Q 5 oz an es W g 47 Mouse dies Mouse dies Mouse dies Mouse dies Mouse dies Mouse lives Live S strainm No live S strain recovered W recovered T2 Bacteriophage used by Hershey and Chase to Build the case for Nucleic acid 1952 b Phage E coli l Bacterial QR chromosome Phage chromosome 1 5 a Iquot K BO Q Ca a V Label Proteins and see if they are transmitted to progeny Protein ECFDCOH H Q a3355 s m r Radioactivity DNA U in protein I coats Infect unlabeled 7 S reproduction g E coli Shear off coats separate from infected bacteria Radioactive proteins did not enter cell and was not transmitted to progeny Label Nucleic Acids and see if they are transmitted to progeny quot gt Q 1 4 33239 32p 3 t quot V Phage 9 W Infect unlabeled 5 reproduction 5 E C0 Radioactivity in cell Radioactive nucleic acids entered cells and was transmitted to progeny pe NA feceep LQMQ 6 I I 1 Type B protein geek Leap 5 g VP R 39 lt A g i m NA protein RNA can also be used as genetic material 1956 B Type A RNA B Protein B I Type B Type A RNA protein i Tobacco protein Hybiij TMV Type A Type B RNA I lBase Phosphate Sugar Nucleotide Bases A adenine T thymine G guanine C cytosine DNA is made of up nucleotides that consist of a sugar a a phosphate and a nitrogencontaining base 5 539 HOCH2 O OH HOCH2 0 OH H 2324 H H 232 H EH AH AH IL Ribose Deoxyribose Sugar base nucleoside Pu ne basic structure NH O 2 C C Nf icyk HNI 6SEC7N I2 4 sex 1 4n yen HC 3C I HzN C 3CKI N H N H Adenine A Guanine G Pyrimidine basic structure 11 1 u C CH C Wm Fr Hts4 2 6 2 6 2 6 l C C 0 N 0 N 0 N H H H Cytosine C Thymine T Uracil U present in DNA present in RNA P Phosphate Purine nucleotides Phosphate Nitrogenous base Adenine A 1 lt Deoxyribose sugar OH H lt Deoxyadenosine 5 monophosphate dAMP O H seuamm NH2 H OH H Deoxyguanosine 5 monophosphate dGMP Pyrimidine nucleotides OH H Deoxycytidine 5 monophosphate dCMP 0 CH3 H 5 4 3N I6 A Thymlne T 1 N O CH2 H H OH H Deoxythymidine 539monophosphate dTMP Chargaff and colleagues isolated DNA and found varied in composition Chargaff s rule AT and GC Table 71 Molar Properties of Bases in DNAs from Various Sources A T Organism Tissue Adenine Thymine Guanine Cytosine G C Escherichia coli K12 260 239 249 252 100 Diplococcus pneumoniae 298 31 6 205 180 1 59 Mycobacterium tuberculosis 151 146 349 354 042 Yeast 313 329 187 171 179 Paracentrotus lividus Sperm 328 321 177 184 185 sea urchin Herring Sperm 278 275 222 226 123 Rat Bone marrow 286 284 214 215 133 Human Thymus 309 294 199 198 152 Human Liver 303 303 195 199 153 Human Sperm 307 312 193 188 162 Defined as moles of nitrogenous constituents per 100 gatoms phosphate in hydrolysate Source E Chargaff and J Davidson eds The Nucleic Acids Academic Press 1995 X ray crystallography was key to unlocking DNA structure Beam of Xrays k Xray source Lead screen Detector photographic Diffraction plate pattern HuIiE5E 25 t39mlilutltrut mail as Dr Fl 1 If Ihn39in m mul lLrb Hal31min aran anirem 39 HJILIHI 1HJMET T Fem I39 39quot 39quot Whig 11 ubznmiiunz uidEb n39 in Uh l39ul39d E M Jthw Phi quotwI an quot5 quotiIu IIIIlI39 391i39l139 ll l39hlln 5 muw EL I I F f 535 Ij l Eju 39 39 I a39 Eur L1quot 1 H F 1Iia III9 1391rrllli39h H 1 hwq u 3 REEl 39 39393939quotF I 39 39 39quot39quot quotquot39 4 1391quot I 39w ma39139Eh39uu u1 I3951II MD LECULAH STRUCTURE OF NUCLEJC ACIDS A Structure lair Duhnarribui Nucleic Acid I IFII I39 HughN I39I i39nlquotlL39I lLII IJJH full 139 mxFJiltrrcr I39IIIIIEIr39lJZI E ll39l jTquotIu Thu Pi II IrIJ III I 39I3939I linenHquot whitELI Fm 3939I39in39i lnl39IIc hull35ml imam5n 3 il ntlllh d39Iaf rIIIIIIi HI39 Ikec JI39iIquotIr Egllr PELI39P39J I 13 I39amli ig iii 3939r1 Tl39nj39 kindly r39nnrli39 Iluil 39I139Il1a1111alE39ETII39ill mamlnl g IIquot IIc LI H i gHlmgl I39 FLl39lli39439illri 3939IIiI 1I39 El IquotI39 39 39i39It5 tl39 tinre int5 1139quotu11r MIL1153 Tr39llI39I In Thl39ai3939u39 n mum Ila ISMt axil ILd fJLJ I39Juurm L3939I tLLE main1n T1 i39Il39 npitin39m Ellii IrIIIII39irquot ilcl HIquotIIiu5II39IqIIjIP fur t39u39Fu rueam ill W hcl39inm 39iquot39i r39139 mm39nri which git1 lhr Hrl39lay II eag39l39mnI 39d Ilaa L IIII tI IE rug5 np39J rj mt t39l39i39 miin hgdzlgrLL LII1111 1r 39in mm lmquot 1quot39IIt FltTm IcIIIII I39IIl II FlarlJKIIIII39Igl lalm39lur lmjail 35 1quotquot ILGEMi39FD wg ah pi Intnp 1rII39r r3939n39 5315 Til ful l ball Iquot39IIIrquot Hi Erjl lli II L39LI 393939I39 Jr 39r39lx39 JlE dismnux Hymn239 to 39 atquot 39II1III39l kWIlla 39Ii39IE39I 3939i ll animal lznI39H lw 3939 J law Ei ra d b3 I39Lme in the PM T11 his mini 39i39i1r 1a39II uIII I39r HII hquot wquot 39lIItlIl39 Hull Halta I39mam Im ll lt39 39inm39lrh Ell39llifvfl mam11M l1 3939igquotrflr3939hg39rI1 I3939h1139l39 Thur n iru ILIlt we dt 39lll39ill r39l i39 IH H39EII39 jlIlIIai HIquot39 39cI39 39i39hIE mnnnwr I39I3939 no nowmm Irl 39 I 3in quot r Fin 1 391391 forward Ll 1 II39Hlil l39 iiITI quot1II Il llquot llll39I I39II 39 thr 551 3939 dnrm39ribum nalail 39 m39ij I Tilquotl qcII39II39i IIrIl MPH l3939I J39J Jigu 11de ml mil1 mamquot 1qu quotmml Huis Hut Ilidrc u 39r39r39t39 fur71 mm39lr 39rlhr umml chemical 1aI39JIrliiaIrH rLHLuzuly illsu 39rquot393939l 3939l1quotu Inlw39cm i39 pl39nnphutr di cELE39 wuuw ju39guu 395llL l39 l39lf rh11iu39una IM iium mt39h 39lquot3939 IILl39h lltl39h 39I39Ib I39I I39I39Ia39IujlaiI III r39 Their ham urn r39I l 1r II iII i lth1qIliml lil39tli39n i39I quot39 IiIII Il cam Jinn1 chuim Ilnw night l39HI3939 l hailinge I39III I39i39jrll39 II Thn Il39fm 15hr ml39nrnlw n39F 39iir ul39 i39I Illal I39I 39IirI III in jp a39im inr 39l ns Earer 39 I39L39I ham1 WLIIJIH JquotIII Int15139 mnil Ho 1 that i39 I II huhp rm 391 quotIj in393939u 139 thr Juli LEI1 Th le3939Ipquot1lltri 39In I39m mmquot Equot 1quot 339 III IIJIIil 39I39I39IIl jIillillll ll III IliLIInIIII39 man quot iM 39393939 an nF r39l1n39 IHEILHLT II111 th LITEII39I39lF mailamui wfquot i39 if we I quot ung Win 39 rc39r nm39lLu39n Iain gumtnm r1n Fll l39h39 IIIIilllI I39Iluir39lll llnlll39jlli PEIELM mgbrlgzl 39ml39m39 1 I If quotI d mint1 T am ehnih m Thar1239 jinnIr an L3939IILl39 Iu Jul ATE RE 1393 i5 39 f39I39HII39lliln39 39I39I I39I39I239I 39Iiin39l era11 i J L 39in 139I1r 239 r39rr39 fun 39quot3939 39IHIrc marl aI39 hula 39 HI muur c jEi n lf Il luiI39LIu39 I ill Maul 1LJII39 93 rJLub fIFII39EILII39E 393939HE aftw jl39l ImEIdTII39FI n11 cruel1 alumLI Ll 14 l39 1 33quot H it Thln I39 HannaIi II Ha plh 39uaphunm diam IiiT111 Il II39 limit 5 hi 139 lCII A 11 Thr phmpl39nnrn39s Jar39 m Eel uutuid mtinm 39I39m39n nM I39IIIl1 u um 39quoti Hln39luaul39t39 1393 au upon can 11quot wi39scl i39In i39 mi39lrnl 39l 11l139quotT high quot 1IE39quotIII39 wag uwltmtg 111 guid exrlular i39II Inn1H 1II Iil1 rn il39um llu alf39llvlulng III hunt1111 39mnvr unn39nI39IMIh 39l39luu laIJI tll Jthch of 111 mmriuha 39 lLInu umurnar in which 111139 lII39 filming nl39i I39IIIiI wge w l39139a lu ir39uc arIIi quoterIJi39LrII hasm T39hr plume If 1l39m mug1 39l39I1 mmdjm w tn quotIa InHI Flaxiu TL39Ingr Mal39 l jujunqi l Euia l l lui39 1quotquot I ri39iil fl EiJLglr 153m i39n39n nru39 chum inning Wugmnhundnd m r Hir39l IIJ haw mm 13 gully tinI39m I awn JLa 1139I lin sari21 qirll ndh illL39l lIIIiIU39IE i W l 1 LI39I39I I39 Lulu rmLI39nLJIIt Lb JIi39m39irm I39Ii tI JL39 LI H J39JI39 39 39I39quotE39jl39139lill1quot fitl l39HII39Ia39iirlrll III I13 Ilr 3939 I hydmpr Incundo m maid n gutu gum 3mitim 1 w mngLEMnu J Innum familial F In I3939Tu11Irl I39LIquot 39pnnihiru II Tr II it E39san villaJ ir 1331 mlgr I39me1 m 11m sungtum in flu1 39I39 l39u l I II1 mI393939d hwwumrjy IquotrIquotIC llth39J in quotLiLJI LI39JI39 Ltl39lLI mtl39m th39m 39391r nun5 m1 E39IJTIITII39II39I39EJ il I39 lingual Ill15 IIl39 grunt1L Pair uL39 EliI25 IRLTL de DEMJ1 2 39I39Il39u FII39IiHl m1 IaiIIiI l39I39I1139iI39IIc39 nilII h39II39IJ39II II3939iJuiJi1139l nil391 JquotI1H1I39iIIa I39p39uIiILza39l with mwm I393939n139mr39 4 F11 I Ill39rW Wk i flu391 I39IIII3939I39JlJLIquot formc 39E IIrr39I39 Lui39 1min Iri cithnr Lilakin J39m ran llmau l l lr39llfllh39ll39l III IIII39II39I39 Illlllllhlll39 IrIIII l39III fljrrntua mildhr fur 39III39II39 HI LINEHim Thn rrqu 1113 3939 urn3quot Lnr n FiI39LHKIIl I39t3939I39I39I rim quotI39 nuru m I39 h rmwil m in 1qu 1113 I I W39i EL39 milk npnn i n 3min r rl Im rinm i n JIJI39IHISIL Ll Ill139er Jm j ngLI muunLo IF 1319 on lltquot ahain 39ll l 533m IIEIIH39T39I 39li 39I39IuIII39 II lEIII aIII39II39I39 39JIi39I ix WLLIIIIIIIIEA39uu39g luE tuJLx Tt he hut1 I39I139rquot n1391 1naal39n3939I3939 llml llux ruin II39 Jquot inn NJ I39 I mlulljlw I LELH39l DILEEI art1 tI39JI IJI nF 5111mm 5 ITtmiwa1 alum5 1r callnan m II3939 III39 illx39 39l39iHI IIIJII39i39 IIr EllI T1 Er Iruhshlg itnprnrE blr m 393939IIrJ llquot 39 H39rlrrl1r39 II39i39n l39I FiIIHIfIl lil39r iII lulu Ix I39 Jug LMTIliIIle39i c l h rm oxfgm IIiurn 39mnh39i mule ln 3 an n 1am quotin 39r39Tr39mlt39 L39LILlI39u39l 39T39Irnr 39lI3939 ii39l ll 3939 39n1i39a3939n39r Elirm ulrlnl39r39 m aau Ji39II3I39 JLLLuluiju Mir m1 Jl l lui llt 39r U rigor11m 15 Jul n13939r HIHLDTIJ39E IL E n I39m rI39 mu rn lel39 i39 in nu urg39lu39y 39IUIHIill e 39I39j 39I E Equot L39EDEU39LIHJ data I3939I391 it IDLE1 Ian Trgm39lmi ik39 391111r39T39d 1I39l39 I has luau marlcurl nglrwl IIu39u lawnquot ltkt39Lllit39 fluml of c1159 ll39lI 511quotch in 39rl39ur i39vliuwing LZi39l39J1l111L139l InIIF l T 39r39r a war39ennnrquot II39I3939IIquot39 39II39 I 7 dI39iIII Iquot I 39II39 medulla Illr 39ntud fhmu ijL39L 1I3939a d 39r imr ml ml ruznq wl39m39l39i HEW63 rminly Mirnm39l39n i39m39l I39quotIJEII39 all Luil sgugd JJEEiEIL UElll duhLl and stem ralun39ln139 Mglunemn II ELLEE ELLL WAIJ39L J 39J39 InnJul ur 39i39i HEPElli leaning we ken71 1raI1Imqr1 ununlinlnly gumHula n I39Iquot1i39l39 mpgin inr39 mui n Eu 1 gimmic Eco3113 Pall I39l rl39a rh39F Tl39n39 lmnmm bungling quot1 Hur Mum HwIIII l i39I building it together with Isl 34239 n139 nnnrrllmrKnrI r39n3939r 1hr n n39nlml will he l39nihlinr ri LluLwhmt39 39r39la39II39h I39iuTi II IIJIquot139 I39H39E 139lil39r III Il39r IIL39I39rJ Ihlln h IquotI39 Im1uu Mimilu Irrd mitt rm cupmall un 39inrcz39 J lrll39lll hquot IjlllilE39IIIJ 43 39i39lquotI lamH le ll llII39fJI maerIJHIEIJlIl II39 a L39LJTI JLIl lgg39l Mil I3939I39 Edmund mtnnt I39f r1n 39Jn39EmbliuhrLl narrvimuMJJ 39rrm39l Imrl iElnnu nl39 Hrquot 1 H H Wilkins quotDr 11 quotE Irtw ilim uni thrtir EE mark3 cl 1953 Watson and Crick used chemistry and Xray diffraction to solve DNA structure Franklin s data was key We have also been stimulated by a knowledge of the general nature of the unpublished experimental results and ideas of D Nobel prize 1962 for DNA structure explains Chargaffy s rule AT because adenine base binds to thymine base Pyrimidine pyrimidine DNA too thin Purine purine DNA too thick Purine pyrimidine thickness compatible with Xray data DNA polynucleotide strand RNA polynucleotide strand PhOSPhOdieSter bonds DNA strands run in opposite directions antiparallel A nucleoside monophosphate unit Phosphodiester nkage DNA strands run in opposite directions antiparallel BDNA is the DNA that Watson and Crick solved a f r 9 N 5 end Pg 4 33 9595 A exists in the presence of water quot C Cv A Tia 6195 most stable of DNAs under A I J c Cquot physiological conditions TcA c nm 34 nm alpha hellx rlght GT b handedclockwise spiral G L 10 b T 2 C Oxygen p per rotatlon C G p T A Phosphorus T Hydrogen c c Carbon in CH n g53115 S hair h ate 339 end Backbpone W a Major groove Minor groove Base pairs Sugarphosphate backbone b C in phosphate ester chain P C and N in bases a A form b B form c 2 form alpha helix shorterWider probably does not exist in nature lefthanded helix zigzag backbone sites of active genes can make ZDNA Table 102 Characteristics of DNA secondary structures Characteristic ADNA BDNA ZDNA Conditions required to produce 75 H20 92 H20 Alternating purine structure and pyrimidine bases Helix direction Righthanded Righthanded Lefthanded Average base pairs per turn 1 1 10 12 Rotation per base pair 327 36 30 Distance between adjacent bases 026 nm 034 nm 037 nm Diameter 23 nm 19 nm 18 nm Overall shape Short and wide Long and narrow Elongated and narrow Note Within each structure the parameters may vary somewhat owing to local variation and method of analysis Genomes are Different Table 113 Genome sizes of various organisms Approximate Organism Genome Size bp bacteriophage 50000 E coli bacterium 4640000 Saccharomyces cerevisiae 1 2000000 yeast Arabidopsis thaliana 167000000 plant Drosophila melanogaster 180000000 insect Homo sapiens human 3400000000 Zea mays corn 4500000000 Amphiuma salamander 765000000000 c o c o Double Single Double stranded stranded stranded DNA DNA DNA Fraction of DNA 0 Denatured gtRenatured 5ch 1 C 3 34 Startof 2 reaCthn Cot 12 E 12 ct End of 14 reaction 39Q a 5 E o i d O 0000 00 01 i 10 100 Concentration gtlt time Cot Measure this using UV light dsDNA absorbs less than ssDNA Fraction of DNA Denatured Renatu red 390 8 Highly E repetitive S 34 Moderately 3 repetitive E 12 39 quot Un39 e g Iqu Q E I k g 4 1 0 00001 001 i 100 10000 Cot Initial concentration of ssDNA X time or renaturation a Pipette x a v a 7 15 AW Well Gel I r x K 1 Completion of migration Well 3 Lar e fra mentS g g b Small fragments Central Dogma of molecular biology A 1 I 1 I I 1 DNA replication Transcription l 39 Translation W DNA Replication and Recombination A singlecelled zygote contains 64 billion base pairs of DNA IF 1 error in 1 million bp 6400 errors every time cell divides Bacteria replicates 1000 nucleotidessec1 in 1 billion error Three Models for DNA replication a b c Conservative Dispersive Semiconservative replication replication replication ganglnal quots K5 1quot l L 1 r 1 r 1 r 1 F l l l l l l Irst e 39 replication s g e g S d Ii 39i i it rc3 lilc1ation 39 l E g g a 5 3 g S 4 f r E coli grown in 1 t Nlabeled medium E coli DNA becomes uniformly labeled with 15N in nitrogenous bases l Generation 0 gt 15Nlabeled Cells 1 1312 E coli added replicate 5333 to 14N medium once in i 3933 l 3 l 14 j N quot1 5 A Gravitational force 7 ll lSNl 5N 2012 Pearson Education Inc WP lSN14N Messelson and Stahl came up with a method to track old vs new DNA Generation Generation II Generation l l gt j gt i k 3 Cells Cells quot39quot replicate a replicate second time a third time in 14N in 14N DNA extracted and centrifuged in gradient my it l4N14N lSN14N 14N14N 15N14N Generation l Generation II 15NDNA MNDNA ducati nnnnn c Predictions of conservative model Parental 1st generation 2nd generation sz mix 14N14N Q Q light DNI W m SiVj lgl lLDmm W 39W L U Predictions of dispersive model Parental 1st generation 2nd generation MW W KW I 14N E N 14N15N ltbxbridP39LAmM hybrid DNA 15N15N heavy DNAA IW I J L w Chromosome after one round of replication O w 03 Autoradiograph Interpretation Chromosome cluring second round of replication Replication forks w 4 I 439 3932 v o H k k s k 5 39ampO 39039 O 3o z 0 I 39 o 3 Autoradiograph Interpretation a Replication I Both sister 3Hthymidine chromatids labeled gt Unlabeled chromosome Metaphase I 39 Anaphase Chromatlds migrate Into separate cells No sister Replication ll Sister chromatid chromatld exchange Unlabeled thymidine Change b c Unlabeled chromatid A Reclpfocal Only one regions of both chromatld labeled chromatlds a labeled B 13539 39 Metaphase ll Metaphase 2012 Pearson Education Inc 39 a 15 a b Fork Replication qua n3 00 mm 82 H O u Origin of replication Origin of replication Theta Replicat DNA A Newly synthesized Replication bubble Replication 1011 can OCClll W1 th circular DNAS RollingCircle Replication Used by some Viruses and F factor Like theta has origin of replication 339OH 5 O gt gt 539 Cleavage 539 5 339 339 31 The cycle may be repeated Li 1 i l quot 1 Wm l i i i 000 i i i Table 121 Number and length of replicons Organism Escherichia coli bacterium Saccharomyces cerevisiae yeast DrOSOphila melanogaster fruit fly Xenopus Iaevis toad Mus musculus mouse Number of Replication Origins 500 3500 15000 25000 Average Length of Rep con hp 4200000 40000 40000 200000 150000 Source Data from B L Lewin Genes VOxford Oxford University Press 1994 p 536 Linear DNA Replication with Multiple Origins Origin 1 Origin 2 Origin 3 M W m m l w W D m J H Newly synthesized DNA f Table 122 Characteristics of theta rollingcircle and linear eukaryotic replication Breakage of Replication DNA Nucleotide Number of Unidirectional Model Template Strand Replicons or Bidirectional Products Theta Circular No l Unidirectional Two circular or bidirectional molecules Rolling circle Circular Yes i Unidirectional One circular molecule and one linear molecule that may circularize Linear eukaryotic Linear No Many Bidirectional Two linear molecules Replication has many Requirements 1 ssDNA template 2 dNTPs 3 Enzymes a b Phosphates New strand Deoxyribose sugar Template strand 5 3 539 e W 39 Deoxyribonucleoside 539 triphosphate dNTP DNA DNA template strand template strand 339 339 539 539 396 P S PS I psi23p G C C T A T 3 II II II O I r L quot 39PquotP p 539 A 45 a 3 3 5 r a Q Q r A G c T T v a 5 Addition II I 9 T c G A A 539 5 P 3 P AP 5 a 6 Pigr 7 339 3 a Equot 5 W n I 20 46 C T A C G WpAPAPAP PAP PAP c 1 pAddition pp 3 39 539 5quot 339 539 G A T A P 3 P 5 P 5 339 3 Template exposed 5 gt 3 V V E I t l a u u gt Direction of synthesis p Unwmdmg Template Direction of synthesis Replication fork exposed 3 gt5 I g 7Template strands 539 339 S39IJ Unwinding gt 33939 and replication Newly synthesized DNA 539 339 539 339 Usquot Lagging strand Okazakl fragments Discontinuous 3 39 DNA synthesis 539 339 539 339 3 339 f s WA gt 339 Leading strand Conunuous DNA synthesis a Theta model Leading strand Unwinding and replication 39 Lagging Laggmgx strand 1 strand I 539 Unwinding Leading strand and replncatlon b Rollingcircle model Leading Orlgm strand 339 Unwinding and replication 539 c Linear eukaryotic replication Leading Lagging 5 strand strand 5 3 I I I 5 3 Laggmg Leading 3 trand d Unwmdlng 5 Strain Unwmdlng and and replication replication The Mechanisms of Replication o o 0 Iquot 01 l 0 I 39 3 J 1 Bacterlal DNA rephcatlon par n mitiator proteins a Initiation Circular chromosome has one few origin of replication Initiator proteins bind to oriC opening dsDNA Helicase and SSB protiens bind to strand 9 I 9 Helicase 39 tri e Singlestrand binding proteins w 9m 9mer DnaA 0 O ATP hydrolysis Initial binding ATP hydrolysis Replication bubble forms ATP hydrolysis c DnaBDnac OO Helical unwinding is initiated 2012 Pearson Education Inc The Mechanisms of Replication Origin 4 I 11 1 11 VII 0111 Unwinding 0 q UnW DNA gyrase DNA helicase Singlestrand binding proteins 5 quotquot4quotr 31 1 too 4 Unwinding 5 0014 Unwinding b Unwinding DNA helicase enzyme that breaks hydrogen bonds bt base of strands cannot initiate unwinding Binds to the lagging strand template moves 5 3 moves fork ssDNA binding proteins prevent ss regions from snapping back DNA gyrase topoisomerase reduces torsional strain that builds as fork moves Priming is Required for DNA synthesis Cyrase Helicase Origin Primase 321 I 01 gyztquot39 1 011 1 Unwinding Unwinding DNA synthesisl Leading 1 Primer for strand agging strand fl I 3 V 9 9 9 V 339 o o a o m Unwinding 7L UnWinding Primer for I Leading lagging strand DNA synthesis strand Leading Continues Lagging strand l strand 539 lt339 539i lt339 7 9 0 ot0391irwpnmers Primers 0 0 I Unwinding Lagging Leading Unwinding strand strand c Priming DNA polymerases cannot initiate DNA synthesis require a 3 OH group to extend Primase synthesizes a short oligonucleotide to get DNA replication going Molecules are RNA 1012 nucleotides long SO Primase is an RNA polymerase Why use RNA D Elongation Cyrase Helicase Origin Primase 1 31 I 01 A yzk 1 011 1 Unwinding Unwinding DNA synthesisl 1 Primer for lagging strand strand i 311 II 391 1 Leading r gt Unwinding Unwinding Primer for I Leading lagging strand DNA synthesis Strand Leading Continues Lagging strand l strand I lt 39 539i 339 7quot v 339 lA 0 o ov kwprlmer5 Primers 0 0 quot539 Unwinding Lagging Leadmg Unwmding strand strand DNA polymerases then synthesize DNA E coli has 5 DNA polymerases DNA polymerase I has 5 3 polymerase activity has 37 SF exonuclease activity allows correction of errors has 5 3 exonuclease activity used to remove primers Main function may be removal of primers D Elongation Cyrase Helicase Origin Primase 211 I 39i f39fHJ39 39 Unwinding Unwinding DNA synthesisl Leading 1 Primer for strand i i Jlagging strand OH 51 It s 7quot 1 gm OH a m 1 gt Unwinding Unwinding Primer for I Leading lagging strand DNA synthesis Strand Leading Continues Lagging strand l strand I quotI I 1 84 7 5 3397 39 39 339 30 ll oto39I ii aners Primers to o quot5 5 39 539 ls39 39 d Unwmdmg Lagging Leading Unwm ing strand strand DNA polymerases then synthesize DNA E coli has 5 DNA polymerases DNA polymerase 111 large complex has 5 3 polymerase activity has 37 SF exonuclease activity allows correction of errors Characteristics of DNA Polymerases in E coli DNA 5 gt3 3 gt539 5 gt3 Polymerase Polymerization Exonuclease Exonuclease Function I Yes Yes Yes Removes and replaces primers ll Yes Yes No DNA repair restarts replication after damaged DNA halts synthesis III Yes Yes No Elongates DNA IV Yes No No DNA repair V Yes No No DNA repair translation DNA synthesis DNA pol I Arthur Kornberg TABLE 113 Subunits of the DNA Polymerase Ill Holoenzyme Subunit Function Groupings a 539 3 polymerization Core enzyme Elon e 339 5 exonuclease gates polynucleotide 6 Core assembly chain and proofreads y w 5 Loads enzyme on 5 template serves as 7 complex X clamp loader 1P J B Sliding clamp structure processivity Factor 739 Dimerizes core complex 2012 P eeee on Ed lllll on Inc a Template strand E ED f A 3 RNA primer added by primase DNA polymerase I b RNA DNA nucleotide dNTP c E9 B 8 it Ci 1 Nick 1 Eli5 DNA ligase a Template strand ED 6 6 RNA primer added by primase DNA polymerase I RKIA DKIA nucleotide dNTP RKIA DKIA nucleotide dNTP M ED E9 6 GI G 1 Nick 0 3 DNA ligase TABLE 114 Some of the Various E coli Genes and Their Products or Role in Replication 201 Gene polA polB dnaE N Q X Z dnaG dnaA P dnaB C gyrA B 1g rep 55b 17903 2 Pearson Educat on Inc Product or Role DNA polymerase I DNA polymerase II DNA polymerase III subunits Primase Initiation Helicase at oriC Gyrase subunits DNA ligase DNA helicase Singlestranded binding proteins RNA polymerase subunit Components required for replication in bacterial cells Component Function Initiator protein DNA helicase Singlestrandbinding proteins DNA gyrase DNA primase DNA polymerase III DNA polymerase I them with DNA DNA ligase Binds to origin and separates strands of DNA to initiate replication Unwinds DNA at replication fork Attach to singlestranded DNA and prevent secondary structures from forming Moves ahead of the replication fork making and resealing breaks in the doublehelical DNA to release the torque that builds up as a result of unwinding at the replication fork Synthesizes a short RNA primer to provide a 3 OH group for the attachment of DNA nucleotides Elongates a new nucleotide strand from the 339OH group provided by the primer Removes RNA primers and replaces Joins Okazaki fragments by sealing nicks in the sugar phosphate backbone of newly synthesized DNA The Replication Fork IF synthesis occurs on both strands Two DNA Pol III complexes are required Each fork requires 1 Helicase ssDNA BP DNA Gyrase DNA primase DNA polymerase 2 01ka K Second primer 040004 k Two units of DNA Helicase primasa polymerase HI complex Leading strand 0 0 0 0 0 39 0 0 0 539 gt0 0 0 In DNA gyrase Third Primer Singlestrand binding proteins Lagging strand First Primer J K II II II ll 1 II II Second ll 1 II ll 1 1 II x 539 VI 1 II 1 ll39 0 4 1 3 First primer 1 52 l 339 x primer primer 39Ql l I I j J r S39 gt Third I Iquot If primer e I V II If I II II First primer 0 0 0 0 0 0 0 07 390 J Fourth 11 primer A 39 I Second primer a Primase RNA Primer Lagging Helicase YWX Z strand Topoisomerase AQZZ fli 339 W 39 Two attached I Leading my 3 DNA polymerases strand Two units of DNA Helicase primase polymerase III complex Leading strand 539 39 K Second primer Third Primer Singlestrand binding proteins to Lagging Strand First Primer J d 1 1 r 39H E A v r x 35 g Q I 41 1 First primer Second 1 l primer Third primer SIS K VI VquotVXOXII39XVW 1 First primer Second primer Termination 1 Occurs when two forks meet 1 Sequences in some systems bind termination protein Tus in E coli blocks helicase O i T 7 a 4 3 1 M i 1 x aquot I I mm m s Tus Tus ter fer er unwound from left ter unwound from right Tus dissociates Tus locks on to er replisome passes replisome arrests Topoisomerase Replication is FAST almost Helicase 1 OOObp second J Next Okazaki fragment will start here In C011 RNA primer Replication fork movement v U v RNA primer Okazaki fragment Singlestrand binding proteins DNA Replisome polymerase I Clamp Leading strand polymerase V III dimer Lagging strand Ligase Bsubunit sliding clamp Singlestranded binding proteins Leading strand template Polymerase dimer Okazaki fragments A quot2 I quot l Helicase DnaBDnaC DNA gyrase Lagging strand template 2012 Pearson Education Inc Unwound parental duplex Over xd WOUHd C CO q region 43 Topoisomerase can relieve or introduce supereoiling I DNA gyrase cuts DNAt d srans I O s I I The DNA rotates to remove the coils I DNA gyrase rejoins the DNA strands Replication fork DNA Replication and Recombination A singlecelled zygote contains 6 billion base pairs of DNA IF 1 error in 1 million bp 6000 errors every time cell divides Bacteria replicates 1000 nucleotidessec1 in 1 billion error DNA Replication and Recombination MILIT TIHIEHHI In FarrowEnigma or turnor Euppl E f gene 5 J1 LP J H 1 39 yr J mo REPAIR EAHEEH If nvglil i l l iMEE DNA repair enzymes are key imam M 39 ha in 4 l H mmquot Xeroderma pigmentosum XP genes Gene Yeast gene Prorein function XPARPA Radl4IRpa binds damaged DNA IOOOfold preference XPB Rad25 SSLZ DNA helicase 3 to 5 component of TFIIH XPCIhIIRZBB Rad4Rad23 binds damaged DNA XPD Rad3 DNA helicase 5 to 3 component of 39I FIIH XPEp48 binds damaged DNA with 500000 fold preference XPFIERCCI RadlRale DNA endonuclease for 5 side of damage XPG RadZ DNA endonuclease for 3 side of damage lt1 mistake in 1 billion bp how Three mechanisms 1 DNA polymerases are choosy they usually pick the correct nucleotide 2 Insertion of the wrong nucleotide leads to incorrect positioning of 3 OH stalls polymerase PROOFREADING 3 5 exonuclease removes 3 Mismatch repair fixes errors after replication Nucleotide selection DNA proofreading polymerase K Mlsmatch repair GGGATTCGTATTAGGCATAGCACT GGGATTCGTA 39AGG ELIREG New DNA GGGATTCGTAT A TAGCACT CCCTAAGCAT39 G Ll K Nucleotide selection l b DNA 7 r000 polymerase C rquot 395 A r GGGATTGGGATTGG DNA proofreading gm Eukaryotic DNA Replication A Eukaryotic Origins ARS autonomously replicating sequences enable DNA to replicate B Licensing of DNA replication A With thousands of origins how does the cell make sure replication is only initiated oncecell cycle from each BIG PROBLEM a Replication licensing factor attaches to origin then AND ONLY then initiator proteins can function Eukaryotic DNA Replication Unwinding ssDNA BP topoisomerases does the same thing as gyrase in prokaryotes but eukaryotes have to have topoisomerases DNA polymerases Function in replication recombination repair DNA polymerases in eukaryotic cells DNA 539 gt3 Polymerase 3 gt5 Exonuclease Polymerase Activity Activity Cellular Function 1 alpha Yes No Initiation of nuclear DNA synthesis and DNA repair has primase activity B beta Yes No DNA repair and recombination of nuclear DNA y gamma Yes Yes Replication and repair of mitochondrial DNA 8 delta Yes Yes Laggingstrand synthesis of nuclear DNA DNA repair and translesion DNA synthesis 6 epsilon Yes Yes Leadingstrand synthesis C zeta Yes No Translesion DNA synthesis 1 eta Yes No Translesion DNA synthesis 6 theta Yes No DNA repair I iota Yes No Translesion DNA synthesis K kappa Yes No Translesion DNA synthesis x lambda Yes No DNA repair p mu Yes No DNA repair a sigma Yes No Nuclear DNA replication possibly DNA repair and sisterchromatid cohesion d phi Yes No Translesion DNA synthesis Rev1 Yes No DNA repair 5 in E coli 2012 Pearson Education Inc RE I c D Gyrase Helicase Origin Primase 321 1 011 35 0H 411 01 1 Unwinding Unwinding DNA synthesisl Leading 1 Primer for lagging strand strand 5 gt 3 339 I 1 0 s 1 0111 5quot Unwinding Unwinding Primer for Leading lagging Strand DNA synthesis Strand Leading Cont39nues Lagging strand l strand 34 Lagging Leading strand strand Unwinding Unwinding Circles Do Not have Ends a Circular DNA Primer OH 539H339 Template Replication around circle DNA gt Linear Chromosomes Create Replication Problems b Linear DNA Telomeres Primer Replication and unwinding Lagging strand 5 339 339 I 1 3 i I 339 I i 3 339 339 3 3 339 3 3 339 3 539 Leading strand Primer at end Unwmding of chromosome 539 339 339 5r 339OH c End of a linear chromosome I 5 339 Synthesis of primer 5 339 339OH 5 J Elongation of DNA JRemoval of primer 52 3 3 l J Y Gap left by removal of primer First round of replication RNA primer 39 removal Replication 3 539 539 339 gt End of 339 539 chromosome Second round of replication 1 5 39 3 5 D One chromosome is shorter than the other Telomerase RNA template 4 Nucleotide a S39CCCCAA s 339GGGGTTGGGGTT 9 Telomerase l b RNA template c c39gi a gc39t c cmcct v vs 1ccccTr I QCLAA39CCCCAMC GGGTGTI39GGGGTTG c New DNA d EVEKIKIHIIIIIIIIIIII gccceACCCCAAx Telomerase is a ribonucleoprotein d 3 CCCCAACCCCAA39 39CCCCAA IGGGGTTQ GTTGGGGTT fgccccxxAccccxxAm 539CCCCAA GcccTchccTTg GTTGGGGTT s39ccc AA 339 GGGGTTGGGGTTGGGGTTGGG How is this DNA synthesized CCCCAACCCCAAC CCAA 39 339 GGGGTTGGGGTTGGGGTTG GGTT i D0 most somatic cells have telomerase activity 339 GGGGTTGGGGTTGGGGTTGGGGTTGGGG 9 539 OH 339 SI L 1 Nonconven onal base pairing DNA replication gt A GGGGTTGGGGAACCCC 339 GGGGTTGGGGTTGGGG 539 Progerias are associated with shortened telomeres HutchinsonGilford syndrome WW 0 b Strand dis lacement c l p A B W m lllllllllllllllllll llllllllllllllllllll a b Li ation d J 9 A B m 1809 rotation i Recombinant duplexes b Ligation wa by nic A h Heteroduplex DNA molecule a Endonuclease nicking V of 2012 Pearson Education Inc kg 9 Holliday structure chi form Homologous Recombination exchange of info Without LOSS A Holliday Model a type of homologous recombination B The homologous chromosomes line up from both parents C The exchange occurs because a exonucleas chewing up DNA from the end D It only chews one strand of each of the pairs E What happens When you see Holliday junction A Crossing over has happened P X B a V i Noncrossover k Crossover recombinants recombinants A B A b A a II 0 lm w w 4 1 A c Jquot ti I w A 60 9 1 I w U1 Homologous Recombination exchange of info without LOSS B Doublestranded Break Model H l V 539 g 39 g l Holliday junctions Ch 11 DNA Organization Chromosome structure allows incredible DNA packaging E coli bacterium c9 Bacterial chromosome E coli genome is 46 mbp About 1000K longer than cell Human cell 18 meters of DNA DNA structure has three levels to consider Primary structure nucleotide sequence Secondary structure double stranded helix Tertiary structure higher order packing DNA Withou x g 3 3 3 3 Relaxed g f circular DNA 3 b Add two turns overrotate c Remove two turns underrotate t Free Ends can be Supercoiled Lowest energy state for B DNA 100 bp 10 complete turns m w e S M Na h l m e S O V e d S U l h S a t t n S e M l N S W W F f E V e A w m n w m N m m n O l e D m m m r r S O 01 n o w w w a M S O S e m V e H w m w a u e p N U S S n O on a t 0 v1 d d j A m e H i a m w rw P S Proteins b Twisted loops of DNA Bacterial DNA is packaged with proteins not histones Eukaryotic Chromosomes are Complex complexes Chromatin complex of DNA and proteins in eukaryotic chromosomes 12 of protein mass nonhistone chromosomal proteins scqffolding proteins and DNA replicationmaintenance proteinstranscription proteins Heterochromatin highly condensed chromatin Interphase chtomatin Chvomosomc 39 ucleus Euchromatin chromatin can be transcriptionally active open chromatin 2 Heterochromatin 4 Silentquot Euchromatin Active Eukaryotic Chromosomes are Complex complexes 3quot f v LIij 13 quot5 V u 1 9 21 I IJ f V 39nI39su y a 1 Pli wrr 39 3 quot M 39 39 z e quot kl Mam l s z 39 39 namp 9 394 A quots 73 l quot i vr f fnx J 39 y bnb 1 I wf hl gq axv 5 I l 39a I v VI 1 r v i 39 I x quotI g r to 37 a 3 y Y P 39 I V m was u 139 f 36 by w r quot139 u r P 1 39 39 v 39V A p V l I a w b x vinex VA 39A39zg g w I 1 I h I megL r i v 1 E r 3I1 2133 7 den 39 Y a u I s a 9 gm as 5 N4 39 i W I so 39t I f I Z t gt A r r h I I fi gh f 39 m 5 39 v t LA 1V 39 39 71 v 1 39 quotI l 397 I quot5 um um fr v 5f I 39 f p 51 A 45732quot c by K I 39 39 m 551 l I 131 v v I I I v H I I e r s 1 I I 2 I 1 I V 39 t 1quotquot I 39 39 v I l 1 7 79a 3 1 39 l 1 r V v l lt A I 39 r I I Iquot I r v r h 2 26 C W quot a s quot W gt 1 I Scaffold proteins nonhistone play role in foldingpacking during mitosis or meisos when the DNA has to compact to divide They function to hold DNA in the correct condensed structure d Metaphase chromosome Vaax 391 39 quot v Chromatln 1s a hlghly Nucleosome core 1 D o 39 1400nm 39 f quot 539 quot cg Chromatid 39 39 39 1 391 3 g 700nm diameter x 39 complex structure 39i i quot i 39 c Chromatin fiber i j x 300nm diameter 2 9 quot f4 2 it I CC439 r I g s 4 2 1m 1 3 g 39 39 5i 1 r3 Looped domains H1 Histone C quot b Solenoid 30nm diameter Spacer DNA Hlstone protelns are plus Hi histone only found in eukaryotes Q Histones 0 Histone octamer plus 147 base pairs of DNA a Nucleosomes DNA 6nm x 11nm flat disc How does transcriptionreplication occur in this mess a Core histones Linker DNA of nucleosome lrx u n i Beadsonastrmg I F 4 I VIEW of chromatin Nuclease b 39 200 bp of DNA proteins Nuclease c Hnm umIewuu lnuo a n 2 2 A u 4 d h 7 I 59 V o o Im a a39 v1 Q 21 w can 5 4 0 o I 43 quotso u v C r w was swgt r 1 vrrt 0 39O uotvu o quotInquot 1 0 m3 vmmao maggo So Nucleosome Two copies of H2A H2B H3 and H4 DNA in White Ii c I 1 okn l A 1 77 I 1 v94 ht V 3025 313833 DNA 30 nm H1 histone 39 U y n 7 t7 1 v I 10nm 39 NA Histone o g 39 octamer f H1 histone 39 0 Nucleosome I a 30nm solenoid U n no 2 2 Q Nucleosomes d Metaphase chromosome Nucleosome core 1 FA 63 2 6 3quot 1400 nm 1 a 0 s 39 3quot aura Chromatld f A 3 700nm diameter c Chromatin fiber 300nm diameter Looped domains H1 Histone 39 39 b Solenoid 39 n 30nm diameter Spacer DNA plus H1 histone Q Histones g 0 i Histone octamer plus 147 base pairs of DNA 2nm diameter 1 a Nucleosomes amp 6nm x 11nm flat disc Chromatin Remodeling 9 Structure must change to allow access to DNA Histone tails 9 targets for binding Acetylation 9 neutralizes positive charge relaxes histone hold Methylation and phosphorylation 9 these processes create a tighter hold on DNA and histones Histone protein DNA Positively charged tail O o o O Deacetylation Demethyiation HDAC KDM Demethylation KDM Acetylation Methylation HAT KMT O O Methylation KMT Cutrem Opinion in Neurobiology ATPEFEHEIEHTI39 EHH uMTIEH FIEMIEI DE LIME n alnggIglrlpmlun fem Hi l THJ FEEJFiH EEgEL l Emma A 3 2 2 2 1 P 1 3 1 1 2 1 1 2 1 3 1 2 q 3 2 4 5 6 7 8 2012 Pearson Educauon Inc Band p223 p222 p221 p21 114 3113 p112 Centromere q12 q13 q21 q22 q23 q24 q25 q26 q27 q28 39 1 mm 2 C m n m In m m Ll n 0 57 r a 0 Dr 2 I G 2 IB B IB fJ MA 0 r LE 2012 Pearson Educahon Inc Chiasma Loops Central axis with chromo meres 2012 Pearson Education Inc Centromeres are important for chromosomal segregation Centromere is a region of chromosome Where spindle fibers attach if you do not know this go back to START do not pass GO Chromosomes Without centromeres are lost d LU l Eh rom osomeb reakage Centromere b Anaphase V n of mitosis 3 After cytokinesis i Q Chromosome fragments degrade Point centromere small at one general point of chromosome Regional centromere takes up a region of the chromosome usually in most plants and animals CEN region more like a point but can be used to explain that the centromere is in a specific region CEN region Point centromere 0f bakerP s yeast U u r A ATTTCCG AA C rZQiig a wiqi imayzii qej Mpggiiiigguairglyiyzigwi57 C H V quot 7 7 M 5 39g igkv39 i39i mjfj 39fr39 CTAAAGGCTT Region Region II Region I 80 90 bp more than 90 A T I A quot I 1 JD 1 59 y quot39g xmquot Contromeric DNA Panoc amc S cerevlslae 25 22 u me 9 bur cnt III D melanogaster M H sapiens quot 0391 Mb alphasatellite arrays mquot Cell Volume 128 Issue 4 2007 647 650 2012 Pearson Education nc Telomeres maintain ends of chromosomes Function 1 Structural serve as a cap at ends to block unraveling 2 Replication of end a Generally does not occur in somatic cells shortened to death b Singlecelled organisms and germ cells do have to deal With this Problem 1 Replicative enzymes cannot replicate ends of chromosomes 2 Chromosomes would get shorter to the point of big problems Solution Have an enzyme that replace ends block this in cancer cells as therapy Telomere repeats can be very big2501500 copiesrepeats per chromosome Table 112 DNA sequences typically found in telomeres of various organisms Organism Sequence Tetrahymena protozoan S39CCCCAA 3 3 CCCCTT 5 Oxytricha protozoan 5 CCCCAAAA 3 3 GGCCTTTT 5 Trypanosoma protozoan 5 CCCTAA 3 339 CCCATT 5 Saccharomyces yeast 539 C23 ACA6 339 3 CZ3 TCT6 5 Neurospora fungus 539 CCCTAA 3 3 CCCATT 5 Caenorhabditis nematode 5 CCCTAA 3 3 CCCATT 5 Bombyx insect 5 CCTAA 3 3 CGATT 5 Vertebrate 5 CCCTAA 3 3 GCGATT 5 Arabidopsis plant 539 CCCTAAA 339 3 CCCATTT 5 Source V A Zakian Science 2701995 1602 Repeats can be very big 2501500 copies per chromosome 539 339 339 539 Y Y Y 1 DNA sequence at end of chromosome Telomerase is a ribonucleoprotein a Elongation b Translocation Telomerase Telomerase RNA template RNA template Nucleotide Nucleotide D0 most somatic cells have telomerase activity Repetitive DNA Highly Middle repetitive repetitive Satellite Tandem Interspersed DNA repeats retrotransposons Multiple Mini Micro SINES LINES copy genes satellites satellites rRNA VNTRs STRs Alu Ll genes 2012 Pearson Education Inc Transposable sequences jumping genes DNA that moves around SINE short interspersed element Alu family most common in human gt5 of genome LINE long interspersed element Retrotransposons RNA intermediate using reverse transeriptase Pseudogenes euptelpmerie repeate nilquoter L1 THELTFI SUI IIIp 1Fkh 23 kt interepereedrepeate minieatellite mierpeatellite I I Ir HHH Ell 35 hp Ell 5 pp mpnpm er G T H D arm alpha eatell ite h h tandem repeat 340bp dimer 1EIIIIIII 2IIIIIIIII kt eentrpmere eatellite II II II Ir Ir Ir II II tandem repeat Ehp mnnnmer E F kh EI 3 quote39 L1 TH ELTFl SIZIIIIIJp 1Tkp 23 kt intereperaed repeale minieatellite mierpeatellite I I I IHIII ll 35 Ip Ell 5 Ip mpnprn er G T telprnere TTAGGGLF 512 kt rp ee ee 4p ee m p A Freltergatea netelled Fungir Irprerteljretea Ehr etea ii39er39tebr etee Humane eukaryetee F39Ienta HEHFHDTEIHEEDIHE EELIEHIEES rnake up pnlp a ernall FraeIipn pf39Ine thfprpkerpptee arean an Earppre atheirepmpleairp inereaeee pep erellp ep1pa ppeetne prep pnipn pf39tneir lH iInaI plpee an rapeFer pre1 ein The pa heading up ape neee nape been epneip erepjunk pm perhape 39n are uellp nelpe 1p explain area nierri e39 eernplemp F39ereem pF thpt Eppin ptFpr 39I HJ 1151 I EI quotHi IE 39I E I H i 5 CHE 3 Bali 4 m 5 3251522 F2 423 2123 d3


Buy Material

Are you sure you want to buy this material for

75 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."

Allison Fischer University of Alabama

"I signed up to be an Elite Notetaker with 2 of my sorority sisters this semester. We just posted our notes weekly and were each making over $600 per month. I LOVE StudySoup!"

Jim McGreen Ohio University

"Knowing I can count on the Elite Notetaker in my class allows me to focus on what the professor is saying instead of just scribbling notes the whole time and falling behind."

Parker Thompson 500 Startups

"It's a great way for students to improve their educational experience and it seemed like a product that everybody wants, so all the people participating are winning."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.