New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

BSC 114

by: Ashley Bartolomeo
Ashley Bartolomeo
GPA 3.9

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

Notes on everything on test number 3
Principles Of Biology I
Edwin Stephenson
75 ?




Popular in Principles Of Biology I

Popular in Biological Sciences

This 19 page Bundle was uploaded by Ashley Bartolomeo on Sunday March 27, 2016. The Bundle belongs to BSC 114 at University of Alabama - Tuscaloosa taught by Edwin Stephenson in Winter 2016. Since its upload, it has received 32 views. For similar materials see Principles Of Biology I in Biological Sciences at University of Alabama - Tuscaloosa.

Similar to BSC 114 at UA

Popular in Biological Sciences


Reviews for BSC 114


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 03/27/16
Bio Test Number 3 Chapter 14 a. The Basics of Mendelian Genetics  Genetic Nomenclature  Monohybrid Crosses  Dihybrid Crosses What Are Genes And What Do They Do?  Gregor Mendel o “Father of Genetics” o Austrain Monk o ~1860: breeding experiments in monastery garden Genetic Nomenclature  Mendel started with strains of peas with variable characters o Character: feature that differs between individuals. Example: flower color o Trait: differences in a character, eg., “purple flowers” and “white flowers”  Starting strains were obtained from seed suppliers and were true­breeding o True­breeding: all individuals are identical, and self­fertilization gives rise to  offspring like parents, generation after generation  Peas will self­fertilize, but can be made to hybridize* o Stamens (male organs) removed to prevent self­fertilization o Pollen (male gametes) transferred from white to purple  * Hybridize: produce offspring between genetically different strains.  Hybrid: offspring  of genetically different parents Monohybrid Crosses  Monohybrid cross: a mating in which one character is followed  Mating:          P: purple x white        F1: 100% purple flowers  Nomenclature: o P (parental) generation o F1 (first filial): offspring of the P mating o F2: offspring of an F1 mating o “x” indicates a mating, or a cross  P:    purple x white        F1: 100% purple  F1 plants allowed to self­fertilize  F1: purple x purple       F2: 75% purple, 25% white          3:1 purple : white ratio  Six other characters gave same result: o One trait “disappears” in the F1, but reappears in the F2 o 3 : 1 ratio in F2  Mendel’s conclusion: phenomena are universal Mendel’s Explanation  Every individual has two copies of each gene  There are different variants (alleles) of the gene o Eg., a “purple” allele and a “white” allele  In an individual with two different alleles, only one contributes to the character o The expressed trait is dominant o The non­expressed trait is recessive  Each gamete has only one of the two alleles The Genome, Genes and Alleles.  An Analogy  The genome contains the instructions (genetic code) to make proteins (and other  molecules)  A cookbook contains the instructions (recipes) to make delicious foods  There are two genomes in every cell (except the X­ and Y­ chromosome genes in males)  The human genome contains 20,000 – 25,000 genes, and two copies of each*.  There  may be variation between genes (each variant = allele), most of its harmless and part of  normal genetic variation  Some alleles are harmful because they result in non­functional proteins  * Except the X­ and Y­ chromosome genes in males, and mitochondrial genes (both  sexes)  Phenotype: physical attributes; eg., purple and white flowers  Genotypes: genetic makeup, eg., which alleles are present  Let “P” represent the purple flower color allele  Let “p” represent the white flower color allele o Since each individual has two alleles, there are three possible genotypes:  PP (purple phenotype) (homozygous)  Pp (purple phenotype) (heterozygous)  Pp (white phenotype) (homozygous) o Homozygous: both alleles are the same o Heterozygous: two alleles are different Monohybrid Crosses Punnett Squares  A Punnett square diagrams the outcomes of fertilization o Vertical: the 2 egg genotypes, P and p o Horizontal: the 2 sperm genotypes, P and p o 4 boxes represent the 4 possible fertilizations Probability  Probability: branch of mathematics that deals with the likelihood of some event  Probability that a particular result occurs: # of outcomes with a particular result / total #  of possible outcomes Law of Segregation  Mendel’s Law of Segregation o There are different variants (alleles) of some heritable factor* that causes a trait o In an individual with two different alleles, only one contributes to the characters  (dominance / recessiveness) o During gamete formation, alleles segregate from each other, so that each gamete  has one allele o Each individual receives 1 allele from each parent o *Gene: a heritable factor that causes a trait Testing The Law of Segregation  if Mendel’s theory is correct, the F2 purple class should consist of: o 1/3 genotype PP o 2/3 genotype Pp  What will the result be if each crossed to a white flowered plant (genotype pp)?  Predict the outcomes of the following crosses: o 1. PP x pp  100% Pp (purple) o 2. Pp x pp  50% Pp (purple) 50% pp (white)  Mendel found that 1/3 of the F2 purples gave the #1 result and 2/3 gave the #2 result o The theory has passed a test Laws and Theories  A scientific theory is an explanation of a phenomenon that cannot be observed directly,  accounting for the “inner workings” of the system  Mendel’s Law of Segregation is actually a theory  How do you prove that a theory is true? o You can’t.  It is impossible to prove that something is true o You test predictions of the theory (eg., purple F2s should be 2/3 Pp and 1/3 PP).   if the predictions are confirmed the theory is increasingly likely to be true o You show that all other “rival” theories are not true.  Eventually one is left with  only one surviving theory, which is widely accepted as correct.  These are  sometimes renamed as “laws” Dihybrid Crosses  Previous crosses were monohybrid crosses: 1 character only  Dihybrid cross: 2 characters  P: yellow, round seeds x green, wrinkled seeds  F1: 100% yellow, round phenotype  (YyRr genotype) (yellow dominant to green; round dominant to wrinkled)  F1s self­fertilize  F2: 9/16 yellow, round; 3/16 yellow, wrinkled; 3/16 green, round; 1/16 green, wrinkled     9:3:3:1 ratio Law of Independent Assortment  Independent Assortment: segregation of alleles for one gene does not affect segregation  of alleles of a second gene  Ratios are consistent with complete independence:  o ¾ of the F2 are yellow o ¾ of the yellow F2s are round o ¾ x ¾ = 9/16 of the F2 are both yellow and round  Alleles for two independent genes segregate independently during gamete formation o Example. YyRr parent: gamete with Y can have R or r, with equal probability  Probability, Genotypes and Phenotypes  For independent genes, probability of any dihybrid phenotype/ genotype can be  calculated from each monohybrid probability o Yy x Yy.  What fraction of progeny have dominant phenotype? ¾ o Rr x Rr. Same question. ¾ o YyRr x YyRr.  What fraction of progeny have both dominant phenotypes? ¾ x ¾  = 9/16 Same Principles Apple to Trihybrid and More Complex Cases  Yellow is dominant to green, round is dominant to wrinkles, purple is dominant to white  In a self­cross of a yellow, round heterozygote, what fraction of the progeny will have the phenotype: o Green, round   ¼ green x ¾ round = 3/16 green, round  In a self­cross of a yellow, round, purple heterozygote, what fraction will have the  phenotype: o Yellow, round, purple    ¾ yellow x ¾ round x ¾ purple = 27/64 o Green, round, white       ¼ green x ¾ round x ¼ white = 3/64 B. Complex Phenotypes and Human Genetics Major Topics  Complex phenotypes  Human genetics Complex Phenotypes  Some phenotypes do not conform to simple dominance / recessiveness o Incomplete dominance o Co­dominance o Multiple alleles o Epistasis o Polygenic inheritance  Transmission of genes follows Mendelian rules; genotype: phenotype relationships are  different  Incomplete Dominance  Incomplete dominance: heterozygote has an intermediate phenotype o Example: Snapdragon  Segregation of alleles follows Mendelian rules  White spotting in cats o SS cats are mostly white o Ss cats have white on tail, legs, chest, ears o ss cats have no white at all Co­dominance  Co­dominance: the heterozygote has properties of both homozygotes o Example: human MN blood groups o Gene encodes glycoproteins expressed on surface of red blood cells.  Two alleles  M and N, encode two protein variants o MM individuals have only M protein; MN individuals have only N proteins; MN  heterozygotes have both Multiple Alleles  Multiple alleles = genes have more than 2 alleles o Example: three alleles of the I gene, Ia, Ib and i.  i is recessive to the other two o IaIa and Iai have type A blood o IbIb and Ibi have type B blood o Ia and Ib are dominant to i o ii have type O blood o IaIb have type AB blood, that is Ia and Ib are co­dominant ABO Blood Types  The I gene encodes and enzyme that synthesizes an extracllular carbohydrate o Ia enzyme produces “A” type carbohydrate o Ib enzyme produces “B” type carbohydrate o i enzyme produces no carbohydrate ABO Blood Types and Transfusion  ABO blood group is important in transfusion.  Immune system produces antibodies  against foreign molecules, but not against self o A phenotype individuals have anti­B antibodies o B phenotypes individuals have anti­A antibodies o O phenotype individuals have both anti­A and anti­B antibodies o AB phenotype individuals have antibodies to neither A or B Epistasis  Epistasis: genotype at one gene affects phenotypic expression of a second gene  Shows up as a deviation from 9:3:3:1 ratio in dihybrid crosses  Example: B and C genes affect mouse hair color.  9:4:3 ratio.  The white genotype cc  prevents expression of the black/ brown phenotype Polygenic Inheritance  Polygenic inheritance: multiple genes affect the same character and have additive effects  on phenotype o Examples:  Skin color  Height  Human Genetics Pedigree Analysis  Traits are followed through families using pedigrees  Key: o Circles = females, squares = males o Affected = filled, unaffected = unfilled  Distinguishing dominant and recessive traits: o Dominant traits are always expressed in one (or more) of the parents o Recessive traits are often not expressed by either parent Genetic Diseases  Most human genetic diseases are recessive, caused by genes that produce defective  proteins: o Cystic fibrosis: chloride channel protein o Tay­Sachs disease: enzyme that degrades lipids o Sickle cell disease: hemoglobin protein  Some conditions and diseases are dominant: o Achondroplasia (dwarfism) o Huntington’s disease (nervous system deterioration) Genetic Counseling  A couple’s first child has cystic fibrosis, although neither of the parents do.  What is the  probability that the couple’s second child will have cystic fibrosis?  To solve the problem: o Determine the parents’ genotypes  Each must be Cc, since their first child was cc, but neither parent has the  disease.  Both parents are carries o What is the probability that the two heterozygotes will produce a child with  genotype cc?  ¼   Prenatal diagnosis o Sample of fetal tissue is obtained: amniotic fluid (contains fetal cells), or from  chorionic villus (fetal portion of placenta) o Karyotype analysis (detects wrong # or other chromosomal defects o DNA analysis to detect specific mutations Learning Goals  Genetic nomenclature  Dominance and recessiveness  Monohybrid crosses and the Law of Segregation o Predict genotypes and phenotypes for monohybrid crosses o Use of Punnett squares  Dihybrid crosses and the Law of Independent Assortment o Predict genotypes and phenotypes for dihybrid crosses  Genotype: phenotype relationships for o Incomplete dominance o Co­dominance o Multiple alleles o Epistasis o Polygenic inheritance  Human genetics o Symbols and practice of pedigree analysis o Detecting dominant and recessive traits by pedigree analysis o Predictions in genetic counseling  Chapter 15 Chromosomes a. Sex­linkage Major Topics  Mendel and chromosomes  Sex­linked inheritance Mendel and Chromosomes   Genes ala Mendel and chromosomes during meiosis: o Segregation  Organisms have two copies of each gene, but gametes contain only one  Somatic cells contain two copies of each chromosome, but gametes only  one o Assortment  Genes segregate independently of each other  Non­homologous chromosomes segregate independently o Chromosome Theory of Inheritance (early 20  century): Genes reside on  chromosomes  Alleles on chromosomes segregate according to Mendel Sex­linked Inheritance  Drosophila as a genetic model  Morgan chose Drosophila to examine genetic mechanisms: o Short generation time (~10 days) o Hundreds of offspring from one pair o Survives well in the lab  First genetic variant: white eyes (vs. normal red eyes)  Drosophila genetic nomenclature: o White eye allele w (recessive) o Wildtype allele w+ (dominant; red eyes)  P: red­eyed female x white­eyed male  F1: all red (conclusion?) o Red is dominant to white  F2: (F1 brother x F1 sister) o Females: 100% red o Males: 50% red, 50% white  Explanation: females and males are genetically different, XX and XY respectively.  The  Y chromosome is not a functional homolog of the X* o Males are haploid for genes on the X  X and Y = sex chromosomes  Other chromosomes = autosomes  *Although the X and Y are not homologs (do not contain the same genes) they segregate  during meiosis.  Sperm cell has an X or a Y, never both  Conclusion from previous results: the white eye gene is on the X chromosome o Provided the first conclusive evidence in support of the chromosomal theory of  inheritance, that genes reside on chromosomes  A. XY: (humans, fruit flies)  B. XO: females have two X; males have one X (no Y chromosome)  C. ZW: females are WZ, males are ZZ (birds, butterflies)  D. Haplo­diploidy: females are diploid, males are haploid (bees, wasps, ants) Humans  Key feature of sex­linked traits: fathers transmit X chromosome to daughters, but never  to sons o A. An effected father produces heterozygous daughters o B. A heterozygous mother produces 50% affected sons, but 100% normal  daughters (although ½ of daughters will be carriers)  Sex­linked traits are more often observed in males (because have only 1 X chromosome) o Duchenne muscular dystrophy o Hemophilia o Red­green color blindness Mammals X Inactivation  Female mammals inactivate one X, so that each cell has only one active X  Inactive X = barr body  Inactivation occurs early in development, is random, and pattern of inactivation is  inherited thru subsequent mitoses  Tortoiseshell and calico cat: alleles for black and orange fun on X.  Each patch of black  fur represents a “clone” of cells in which the orange allele X has been inactivated o White fur is due to a separate gene (epistasis) B. Linkage and mapping.  Aneuploidy Major Topics  Linkage, crossing over and gene mapping  Aneuploidy and alterations in chromosome structure Mendel and Chromosomes Independent Assortment  Mendel’s Law of Independent Assortment o P: YYRR x yyrr        F1: YyRr 100% o F1 progeny are self crossed o F2: 9:3:3:1 phenotypic ratio  What is the outcome if the F1 heterozygote is test­crossed? o Test cross: cross to an individual homozygous for recessive allele(s)  A test cross: o F1 YyRr   x   yyr      (yyrr = the “tester strain”)  Much simpler since the tester strain produces only 1 gamete type Dependent Assortment  What would happen if allele pairs C and D and c and d behaved as inseparable units  (“dependent” assortment)  P:    CCDD x ccdd      F1: CcDd 100%  Cross F1  CcDd x ccdd  F2: CcDd 50%; ccdd 50%; Ccdd 0%; ccDd 0% (eg., 1:1:0:0 ratio) Partially Dependent Assortment  In practice, some genes behave as if intermediate, neither independent nor completely  dependent   P:   EEFF x eeff       F1: EeFf 100%  Cross F1  EeFf x eeff  F2: EeFf 40%; eeff 40%; Eeff 10%; eeFf 10%  This was the result in early genetic experiments, but the exact numbers if the F2 progeny  vary depending on the gene pair Linkage  P: gray body, normal wings x black body, vestigial wings  F1: all gray body, normal wings x black body, vestigial wings  F2: 42% gray body, normal wings; 41% black body, vestigial wings; 9%gray body,  vestigial wings; 8% black body, normal wings  Explanation: the black and vestigial genes are on the same chromosomes  Genes on the same chromosome do not sort independently but tend to be inherited  together  These genes are linked, specifically the b+ and vg+ alleles and the b and vg alleles are  linked  Linkage: genes are on the same chromosome Linkage, crossing over and gene mapping  Mendel’s Law of Independent Assortment is true is genes are on different chromosomes  For genes on the same chromosome: o Usually deviate from independence (no classes are 25%) due to linkage o Usually deviate from “dependence” (no classes are 50% or 0%) due to crossing  over  *Linkage: genes are on the same chromosome  Crossing over: breakage and rejoining between non­sister homologous chromatids  Occurs in prophase I  F2 progeny classes are neither 25% (expected of Independent Assortment) nor 50% / 0%  (expected of complete dependent assortment)  The two most frequent F2 classes represent the phenotypes of the P generation, and are  called the parental classes  The two least frequent F2 classes are called the recombinant classes  Morgan: the extent of crossing over is proportional to distance along the chromosome  between the genes  Can be used to map gene positions  The recombinant (non­parental) classes are 391/2300 = 17% of the total  1% recombination = 1 map unit = 1 centimorgan  Distance: black and vesitgal genes are 17 map units = 17 centimorgans apart  Map distances are additive  An example: genes A and B are 9 cM apart, and B and C are 3 cM apart.  How far apart  are A and C?  It depends on the relative positions of the genes o 12 cM if the gene order is A­B­C o 6 cM if the gene order is A­C­B  Experiments like the previous are used to construct a linkage map  Genes that are very far apart on the same chromosome behave as if they are on different  chromosome (eg., obey the Law of Independent Assortment)  Example: o AaBb and aabb (parental classes): 55% of progeny o Aabb and aaBb (recombinant classes): 45% of progeny o Genes are 45 cM apart  But suppose the genes were slightly farther apart: o AaBb and aabb (parental classes): 50% of progeny o Aabb and aaBb (recombinant classes): 50% of progeny o Recombinant classes never exceed 50% o Genes are neither >50 cM apart, or on different chromosomes Mendel and Chromosomes  Why didn’t Mendel discover linkage? o Studied 7 traits, which are all on separate chromosomes, except two traits that are  very far apart on the same chromosome Aneuploidy and Alterations in Chromosome Structure  Aneuploidy: too few or too many copies of a chromosome o Monosomy (1 chromosome) o Trisomy (2 chromosomes)  Caused by error in chromosome distribution during meiosis (non­disjunction).  Affected  gamete will produce an aneuploidy zygote  Most common autosome aneuploidy: Trisomy 21 = down syndrome  Aneuploidies for other autosomes are very rare.  Why?  Aneuploidies for larger  chromosomes are embryonic/ fetal lethal  Sex chromosome aneuploidy.  Tolerated better, because of inherent mechanisms to adjust gene dose o XXY­ Klinefelter Syndrome.  Male sex organs, some female development.   Testes undeveloped and sterile.  Mental retardation common o XYY­ tall, but otherwise normal o XO­ Turner Syndrome (only viable monosomy in humans) Sterile females o XXX­ normal female  Deletion: portion of chromosome is missing.  Many/ most have dominant mutant effects o Cri du chat syndrome: missing end of chromosome 5.  Individuals have strange  cat­like cries as infants.  Mental retardation, facial abnormalities, etc.  Translocation: ends of two chromosomes are exchanged.  Break in chromosome may  disrupt important gene o Philadelphia chromosomes causes a form of leukemia Learning Goals  The relationship between chromosomes behavior and genes are predicted by Mendel  The Genetics of sex determination and sex­linked traits  Mechanism and an example of X inactivation  Linkage o Exceptions to Independent Assortment and the evidence that genes reside on  chromosomes o How linkage is detected in crosses o How quantitative analysis of linkage is used to construct genetic maps o Why distant genes on the same chromosome seem to be unlinked  Human genetic traits caused by aneuploidy and alterations of chromosome structures Chapter 16 The Molecular Basis of Inheritance Major Topics  Genes are made of DNA  DNA structure  DNA synthesis  DNA and chromosomes Genes Are Made of DNA  Genetic character: bacterial pathogenicity o 1. One strain, “S” of bacterium Streptococcus causes a lethal infection o 2. Another strain, R does not o 3. Heat killed S is not dangerous o 4. Exposure to extract from S (extract = non­living “soup” of cell contents)  transforms the harmless R strain into a pathogenic strain (transformation)  A scientific theory to explain the previous results (theory = an explanation of underlying  principles): o Strain S has the “pathogenicity” allele.  Strain R has the “non­pathogenicity”  allele (bacteria are haploid, so each has only 1 allele) o The pathogenicity allele in the S extract replaces the non­pathogenic allele in the  living R cells, making them pathogenic  By destroying various molecules in the extract and testing for pathogenicity, DNA was  identified as the genetic material DNA Structure Components and Polynucleotides  Each nucleotide contains 3 components: o Base (T, A, G or C) o Deoxyribose sugar o Phosphate  Adjacent nucleotides are joined into polynucleotides through sugar­phosphate bonds  Each DNA strand has a polarity based on sugar orientation, 5’ to 3’ Double Strands  Two polynucleotide strands pair side by side to make a double­stranded DNA molecule Base Pairing  Parallel strands are held together by hydrogen bonds between complementary bases: o A­T o G­C  Pairing is always 1 purine and 1 pyrimidine Anti­parallel  The two strands have opposite 5’ to 3’ polarity (are anti­parallel) Helical Structure  Two strands wind around each other in 3­D helical structure, the double helix  Watson and Crick’s structure was based on two types of data: o Chargoff’s Rules.  Analytical chemistry shows that amount of A = T and amount  of G = C o X­ray diffraction experiments of Rosalind Franklin, showed helical structure,  spacing of bases, and position of sugar and phosphates on outside Measurements  DNA molecules are measured in base pairs  One base pair = a pair of complementary nucleotides   DNA molecules are huge: average human chromosome = 1 x 10^8 bp o Kilobase (kb) = 1000 bp o Megabase (Mb) = 10^6 bp DNA Synthesis Overview  Simplified overview: 2 strands separate and each strand acts as the template for synthesis  of the complementary strand o Old strand in dark blue.  New strand in light blue o Result: 2 identical double­stranded molecules Biochemistry  Nucleotide to be added is a triphosphate, eg., dTTP  dTTP  dTMP (added to DNA) + PPi  Addition occurs only at the 3’ end of the growing strand  Catalyzed by enzyme DNA polymerase (enzyme that adds nucleotides) Replication Fork  The two “old” strands separate in local regions, producing a replication “bubble”  Each bubble has two replication forks where new nucleotides are added  At the replication fork new nucleotides are added one at a time  Each new strand is synthesized 5’ to 3’  At each replication “fork” one strand is synthesized toward the fork, and one away from  the fork  As synthesis continues, more “old” DNA becomes single­stranded, and the fork moves  Because DNA is synthesized only 5’ to 3’, one strand is synthesized discontinuously, that is, in short fragments o Leading strand = continuous strand o Lagging strand = discontinuous synthesis.  Short fragments are called Okazaki  fragments Chromosome Level  Replication forks move apart until the entire molecule is replicated o Circular chromosomes (bacteria): single origin of replication o Linear chromosomes (eukaryotes): many origins of replication  Each chromatid contains 1 dsDNA molecule (1 old strand; 1 new strand)  DNA replication occurs during S phase: 2 DNA molecules = 2 chromatids  After mitosis, each chromosome = 1 chromatid = 1 DNA molecule DNA Repair  Mispaired or damaged nucleotides result from: o Chemical or light damage, especially UV light o Mistakes in DNA synthesis  Excision: a nuclease recognizes and removes the mispaired region  Repair: DNA polymerase fills in the gap by the synthesis mechanism DNA and Chromosomes  Each eukaryotic chromatid = 1 ds DNA molecule o Average chromosome contains a 4 cm long DNA molecule.  All DNA per diploid  G1 cell = 2 meters o DNA is highly compacted by coiling and packaging with proteins  Chromatin: combination of DNA & proteins o Histones: small basic proteins (associate via opposite charge to acidic DNA  molecule) o Nucleosome: complex of 8 histone proteins o DNA is wound around nucleosomes: “beads on a string”  Nucleosome fibers are further wound into 10­nm and 30­nm fibers and arranged in loops  in the chromosome Learning Goals  The evidence that DNA is the genetic material  The structure of nucleotides and polynucleotides  Double stranded DNA structure o Complementary base pairing; polynucleotide polarity; antiparallel nature of the  DNA double helix  The mechanism of DNA replication o Why the complementary structure of DNA allows its replication o What happens at the replication fork o Replication at the level of chromosomes  DNA repair  Chromatin structure and packing into chromosomes Chapter 17 Gene Expression a. Transcription and RNA processing Major Topics  Genes and proteins  Transcription  RNA processing Genes and Proteins  The properties of a protein (shape, amino acid composition, folding, catalytic function,  etc) depends on the sequence of amino acids that compose the protein.  How is that  determined?  Protein function (shape, structure, enzyme specificity, etc) depends on…  …The sequence of amino acids, ie., the primary structure of the protein (translation)  The primary structure of the protein is determined by the sequence of a messenger RNA  (transcription & RNA processing)  The sequence of a messenger RNA is determined by the sequence of a gene “One Gene : One Protein” Experiment  Beadle and Tatum  Wildtype* fungus Neurospora grows on minimal medium (medium lacks arginine)  Conclusion: cells can make their own essential compounds (including arginine)  *Wildtype: the normal strain, ie., one that is found in nature  Several mutant* strains are identified that cannot grow on minimal medium  Conclusion: mutants are defective in making some essential compound  *Mutation: defect in a gene.  A mutant strain contains a mutation in a gene  The 3 mutant strains survive on minimal medium supplemented with arginine  Conclusion: the mutants are not able to synthesize arginine.  The mutant defect is the  inability to synthesize arginine  Some of the mutant strains survive on media supplemented with ornithine and citrulline  (molecules similar to arginine)  Differences between the strains define a biochemical pathway  Interpretation: arginine is synthesized from precursor molecules, as follows: Unnamed  precursor  ornithine  citrulline  arginine  Each step () is catalyzed by an enzyme, which is represented by a class of mutants; each class is in a different gene  Since the mutants differ in growth on ornithine and citrulline, it is possible to determine  the order in which the genes act  Therefore, each gene encodes one enzyme  “One gene : one enzyme”*  encode: contains the instructions for  * Later expanded to “one gene : one protein” Transcription and Translation  Flow of genetic information: DNA  RNA  protein o Transcription: synthesis of RNA using DNA template  RNA processing: RNA molecules are modified o Translation: synthesis of protein using RNA template  Transcription and translation are similar in prokaryotes and eukaryotes except: o In eukaryotes, the original RNA copy is often modified before becoming a  messenger RNA (RNA processing) o In eukaryotes the mRNA must exit the nucleus (thru nuclear pores)  Transcription copies a limited region of one DNA strand o Gene = a segment of DNA that is transcribed o Each gene has a start signal and stop signal o Some DNA segments are not part of any gene and are not transcribed (“spacer  DNA”) RNA Structure  RNA is usually single stranded o Contains ribose instead of deoxyribose sugar o Contains uracil (U) base, instead of thymine (T) Transcription Transcription Units  Chromosome = long piece of DNA, 10^6 – 10^9 base pairs in length  Transcription units (= genes): shorter segments that are transcribed  Spacer DNA is not transcribed  RNA polymerase: the enzyme that carries out transcription Initiation  Each transcription unit is defined by a start signal (promoter) and a stop signal  (terminator)  Each signal is a particular DNA sequence  Other proteins are required for transcription initiation: bind to promoter and nearby  sequences  Very complex in eukaryotes: cluster of many accessory proteins forms at promoter  Simpler in prokaryotes: one or a few proteins Elongation  Short segments of DNA (10­20 nts) become transiently single stranded and act as  template for RNA synthesis  RNA molecule is extended one nucleotide at a time, using nucleoside triphosphates,  analogous to DNA synthesis  Direction of RNA synthesis: always 5’ to 3’ Termination  Transcription ends when (or just after) the RNA polymerase transcribes the terminator  sequence RNA Processing  In prokaryotes, the product of transcription is the mRNA, often used without further  modification  More complex in eukaryotes o Product of transcription is a pre­mRNA or primary transcript undergoes RNA  processing o mRNA is exported from nucleus (1) Capping and (2) Polyadenylation  Capping: a modified nucleotide is added to the 5’ end of the RNA o Purpose: necessary for ribosome attachment.  May also affect mRNA stability  Polyadenylation: 50­200 adenosine nucleotides are added to the 3’ end o Purpose: increases mRNA stability (3) Splicing  RNA splicing: internal segments of RNA molecules are removed, and adjacent parts  joined back together o Removed segment = intron o Retained segment = exon  Splicing continued o Organelle where splicing takes place = spliceosome  Purpose: introns encode meaningless sequences and must be removed before translation o But why do genes contain introns? Summing Up  Only 1.5% of the human genome consists of protein­coding sequences  The non protein­coding portion of the genome consists of: o ~26% intron sequences o ~72% spacer DNA and genes that encode RNA products B. Translation, the Genetic Code and Mutations Major Topics  Translation  Genetic Code  Mutations Translation  Translation: protein synthesis by ribosomes, based on sequence of bases in messenger  RNA  Participants:  o Messenger RNA: produced by transcription (plus RNA processing in eukaryotes) o Ribosome: molecular “machine” that carries out translation o Transfer RNA: “Adapter” molecule in translation Which is Transcription and Which is Translation?  Transcribe: same language converted from one medium to another.  An interview is  transcribed, it., converted from oral to written o Transcription: DNA to RNA (different forms of the same nucleic acid  “language”)  Translate: one language to another., eg., Spanish to English o Translation: nucleic acid “language” to protein “language” Translation Participants mRNA  Messenger RNA: RNA that is “read” by ribosome to make a protein  Each set of 3 nucleotides specifies 1 amino acid o Group of 3 nucleotides in mRNA = codon Genetic Code  Codon: a 3 nucleotide sequence in an mRNA molecule o 61 codons each specify one of 20 amino acids o Methionine (Met) is usually the first amino acid; AUG is usually the start codon o 3 codons (UAA, UAG and UGA) have no amino acid; act as “stop” signals (stop  codons) Ribosomes  Ribosomes: molecular “machine” that carries out translation, ie., synthesizes proteins o Complex of several dozen proteins and 3 RNA molecules o 2 ribosomal subunits, large and small Transfer RNAs  Transfer RNAs: act as “adapter” molecules during translation o RNA molecules of ~80 nucleotides o Folded due to intramolecular base pairing o Amino acid attached to 3’ end by enzyme aminoacyl tRNA synthase  o One or more tRNAs for each maino acid o Anticodon: a 3 nucleotide region that base pairs with the codon on mRNA during  translation Mechanism  Initiation: ribosome begins translation at 3 nucleotide sequence AUG, which codes the  amino acid nethionine  Elongation: ribosome moves 3 nt, reading the next 3­nt sequence and attaching the 2   amino acid to Met o Continues over and over until termination occurs  Termination: occurs at a 3­nt sequence that does not specify any amino acid Simplified Example  mRNA: 5’ AACGUGCAUGCCUGAAUUCUGAGCGAU 3’  Initiation: ribosome / Met­tRNA finds an AUG codon.  Two different ways o Prokaryotes: recognizes and binds to a sequence close to the AUG codon o Eukaryotes: binds to the 5’ end of mRNA and scans to find the first AUG codon  Elongation: ribosome moves 3­nt to the next codon CCU, Pro­tRNA recognizes CCU  codon, and ribosome attaches Pro to Met  Elongation: ribosome moves 3­nt to the next codon GAA, Glu­tRNA recognizes GAA  codon and ribosome attaches Glu to Met­Pro  Elongation: ribosome moves 3­nt, tRNA recognizes Phe codon and attaches Phe to Met­ Pro­Glu  Termination: ribosome moves 3­nt to UGA, terminates translation and releases protein  Met­Pro­Glu_phe How Ribosomes Work  3 functional sites in the ribosome, E, P and A  1. P site: tRNA with growing polypeptide attached.  tRNA with its amino acid enters the  A site  2&3.  peptide bond between the polypeptide and the amino acid tRNA in the A site.  GTP hydrolysis provides energy.  Polypeptide now attached to A site tRNA  4. Ribosome moves 3 nucleotides down the mRNA (GTP  GDP).  Polypeptide tRNA  now in the P site.  tRNA exits from the E site Odds and Ends  Protein folding: protein folds into its 3D shape during synthesis, and afterward  Polyribosomes: a single mRNA may be translated by more than one ribosome at the same time  Intracellular targeting: proteins destined for rER, nucleus, mitochondria, chloroplast, etc.  have targeting signals (ie., “address labels”) as part of the amino acid sequence Transcription/ Translation Summary Types of RNAs  Messenger RNA: “template” for translation, nucleotide sequence specifies amino acid  sequence  Transfer RNA: accessory molecule in translation  Several others not discussed: o Ribosomal RNA, small nuclear RNA, SRP RNA  All RNAs are synthesized by transcription Initiation and Termination  Initiation/ termination of transcription and translation are at different sequences (RNA  processing omitted for simplicity) Mutations  Mutation: abnormal genetic information  Types of mutations o Large scale: aneuploidy, deletions and translocations o Small scale: point mutations (one or few nucleotides) Point Mutations Substitutions  Substitution: one nucleotide substituted for another.  Types of substitutions, based on  effect on protein o 1. Missense mutation: change in 1 amino acid (example: sickle­cell disease)  More substitutions o 2. Nonsense mutation: codon changed to a stop codon (UAA, UGA or UAG),  causing premature termination of the protein o 3. Silent mutation: nucleotide change has no effect on amino acid sequence Frameshift Mutations  Frameshift mutation: 1 or 2 base insertions or deletions o Protein reading “frame” is based on translation start site  Silly example: o The big red bug ate our mom  Delete first b: o The igr edb uga teo urm om  Insert new letter: o The big red bux gat eou rmo m  Disruption in reading frame causes wrong amino acid at all points “downstream” (=  frameshift) o Most sever if at 5’ (beginning) end of gene/ mRNA Causes  Mutagen: a chemical or condition that produces mutations.  Do so by breaking DNA, or  damaging bases o Examples: chemicals in cigarette smoke, UV light, X­rays, etc. Multiple Definitions of “Gene”  Mendel: a gene is a discrete heritable unit that produces a phenotype  Beadle and Tatum: one gene contains the instructions to produce one enzyme (or protein)  Modern view: a gene is the DNA sequence that encodes a protein or RNA product Learning Goals  Experimental evidence in support of the one gene – one enzyme theory  The mechanism of transcription o Promoters and terminators o RNA polymerase o The biochemistry of nucleotide addition  RNA processing  Capping – what it is and what it does  Polyadenylation – what it is and what it does  Splicing – what it is and what it does o Introns and exons o Organelles ­ spliceosome  The identification and basic structure of the components of translation: messenger RNA,  ribosome, transfer RNA  Use the codon table to determine the protein sequence of a sample mRNA o Special codons for initiation & termination  Mechanisms of translation  Mutation: terminology and consequences of mutations o Substitution: missense, nonsense, silent o Frameshift o Mutagens 


Buy Material

Are you sure you want to buy this material for

75 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Jim McGreen Ohio University

"Knowing I can count on the Elite Notetaker in my class allows me to focus on what the professor is saying instead of just scribbling notes the whole time and falling behind."

Anthony Lee UC Santa Barbara

"I bought an awesome study guide, which helped me get an A in my Math 34B class this quarter!"

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."

Parker Thompson 500 Startups

"It's a great way for students to improve their educational experience and it seemed like a product that everybody wants, so all the people participating are winning."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.