New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

Lecture 23-25 Notes/Study Guide

by: Molly O'Neil

Lecture 23-25 Notes/Study Guide biol 208

Marketplace > Towson University > Biology > biol 208 > Lecture 23 25 Notes Study Guide
Molly O'Neil
Dr Firestone

Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

Here are my completed notes from lectures 23-25.
Dr Firestone
75 ?




Popular in Biodiversity

Popular in Biology

This 12 page Bundle was uploaded by Molly O'Neil on Friday November 20, 2015. The Bundle belongs to biol 208 at Towson University taught by Dr Firestone in Fall 2015. Since its upload, it has received 55 views. For similar materials see Biodiversity in Biology at Towson University.


Reviews for Lecture 23-25 Notes/Study Guide


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 11/20/15
Lecture 23 Before class do the following 0 read Ch 357 in the Raven 10th ed Freeman 5th ed p 559571 0 watch the following Videos 0 ying squid I httpswwwyoutubecomwatchvderlTJbueO o hydroplaning dolphins I httpswwwyoutubecomwatchvo6yzpe8r4xg 0 sh on land mudskippers I httpswwwyoutubecomwatchvaAz7iMcC8e0 Your Inner Reptile Finish answering the questions on the Lecture 22 skeleton notes Land Vertebrates Amphibians Mammals and Reptiles Echinodermata star sh Sharks skates rays Amphibians Mammals Turtles Lizards snakes Dinosaurs 39 H L Crocodiles alligators Dinosaurs f quotquotg Dinosaurs Birds Whv move onto land Less competition pathogens and parasites Escape predators Eat prey Challenges of land Hotcold Dry 9 needed to have impermeable skin reptiles and mammals Gravity 9 arms and neck Adaptations to land Compare the skeleton of a sh to that of an early amphibian the rst land vertebrates were amphibians Shoulders and spine connected directly to the skull Bones in the ns are short won t be doing much A Generalised Bony Fish Skeleton Upereulum Hyumandihula Dentary i Mazdlla 39 Urnstyle Basaha R1135 Branchinstegal Palm SEEPUIV EYE Runes Peetural Arch SH 1 II A I I IA 1 A f v ll IRAN l A M 39l quotquotquot3944 w M NipJ D 39 quot 4 d1 i z 395 39 A 39 L l I L W I Tiktaalik had arms so it could work against gravity had a shoulder and neck doesn t need to move its whole body in order to walk How does the skeleton of an amphibian help deal with some of the challenges of land Why are gills a bad idea on land What adaptations solved this problem gills dry out too fast lungs amphibians can breathe through lungs or skin they use positive pressure take a mouth full of air and then swallow it humans negative pressure breathing increase the size of the lungs which sucks air in What are the pros and cons of having impermeable skin like mammals or reptiles 0 Pro retain moisture don t dry out as quickly More resistant to parasites pathogens pollution 0 Con prone to overheating have sweat glands or just avoid the heat How are amphibians like mosses while reptiles are like Gymnosperms or Angiosperms Amphibians Reptiles Moss Need water to reproduce gametes need to swim need to be Angiosperms and 0 Seeds amniotic egg Gymnosperms baby animal boxed both have seeds lunch protective coat can be out of water baby plant boxed lunch When hatches it will be a protective coat larger organism and can take on the environment 0 Internal fertilization Reptiles perfected the adaptations to land 1 have legs that are better for running can run faster than amphibians 2 impermeable skin 3 more efficient lungs 4 negative pressure breathing 5 more efficient heart and circulatory system its closed but more efficient 6 amniotic egg 7 internal fertilization You Should Be Able To 1 Explain why different animal species moved onto land becoming amphibians Compare these to the reasons why plants moved onto land List the challenges the first animals faced on land Which adaptations solved each challenge Compare and contrast these challenges and adaptations to those of plants on land The challenges are going to be similar Did plants and animals solve them the same way Both amphibians and reptiles have lungs but they breathe differently Compare and contrast positivepressure breathing to negativepressure breathing Lecture 24 Before class do the following read Ch 358359 in the Raven 10th ed Freeman 5th ed p 854858 704708 watch 0 httpswwwyoutubecomwatchvWple8pUSu4 define the following vocabulary terms ectothermy endotherm an animal that does not use internally generated heat to regulate its body temperature endothermy endotherm the innermost of the three basic cell layers in the most animal embryos gives rise to the digestive tract and organs that connect to ot liver lungs ect gigantothermy a phenomenon with significance in biology and paleontology whereby large bulky ectothermic animals are more easily able to maintain a constant relatively high body temperature than smaller animals by virtue of their smaller surface area to volume ratio torpor an energy conserving physiological state marked by a decrease in metabolic rate body temperature and activity that lasts for a short period of time overnight to a few dats or weeks Occurs in some small mammals when the ambient temperature drops significantly hibernation an energyconserving physiological state marked by a decrease in metabolic rate body temperature and activity that lasts for a prolonged perion weeks to months Occurs in some animals in response to winter cold and scarity of food Baby it s cold outside What adaptations allow plants to survive the winter in general store sugars in roots get thicker stems o deciduous trees get rid of their leaves leaves are not an asset if they re going to freeze get rid of aerial parts rest goes dormant o Evergreens reduce surface area to volume ratio in the leaves they have a thick cuticle stomatal crypts for reducing water loss tracheids with a torus very brous o Annuals survive the winter as seeds a I y Y K dormant baby plant is what survives the 391 39 39 K r39iquot winter everything else dies Plants that keep their leaves after they die for insulation AA Oaks sycamore and other trees build themselves their own coat out of dead leaves Keeping warm Endothermy best example mammals but multiple animals can do this When you use your metabolic pathway breaking down sugar for heat light bulb s purpose is light but it also gives off heat mitochondria turn sugars into ATP but some is lost as heat if you re cold and you shake that will increase heat you can increase your activity decouple the mitochondria your body temperature is a lot higher than the outside temperature White line sphynX mot M maintains a high activity can get up to 44 degrees Celsius they have to eat a lot more Pro active when cold Con have to eat a lot 4 reptiles sh plants can be endothermic Skunk cabbage 9 owers when there is still snow on the ground burns a ton of sugar by decoupling mitochondria and this melts the snow around the ower heats up 30 degrees Celsius during the winter Insulation Animals use hair fat feathers they can borrow and go down underground the temperature is more stable down there it s about 60 degrees Fahrenheit if you go down far enough Gigantothermv How can being really big help you stay warm Ex big thing vs little thing made out of wood 98 degrees F For larger block SAN ratio goes down harder to get things in and out when the object is larger rate of heat loss goes down further distance to get to the coreoutside the core is where you store heat Ex dinosaur Ex leatherback sea turtle modern day example can get to be almost gt 900 kg or 2000 lbs a little endothermic it can increase its body temperature X3 higher than true ectotherm resting metabolism mammals are X6 loses heat slowly because low SAN ratio Countercurrent heat exchangers As you move down on the left side the blood gets colder which maintains core temperature which stays high reduce heat lost to surface good way to maintainkeep core temperature high at the cost of your extremities Ex artic wolf whales and additional adaptations would be needed to allow extremities to function at lower temperature veins and arteries need to be right next to each u other mm Torpor Both Hibernation Overnight one at night or Body temperature drops to Months at a time winter during the day not generally ambient temperature done for a long period of time Trigger temperature Dormant Trigger day length day length gets short enough so animal will eat like crazy to build up fat reserves and then builds up hibernation Ex bats hummingbirds Few signals to wake up if Ex amphibians reptiles the outside temperature gets reptiles high enough if the temp gets too low emergency circuit gets ipped day length To wake up the body will start shivering violently takes days Froggv Popsicles Canada wood fogs Allow their blood to go freeze but their cells the liquid around the cells can freeze Pump glucose into the cells Prevents water from moving out of cells when blood freezes Frog has no brain activity or heart rate when frozen Cold What cold 0 Geometridae moths function when it s really cold cell membranes will be more liquid phospholipids in the fatty acids are unsaturated Enzymes have a temperature range enzymes need to be able to function at very low temp Very eff1cient very big wings and a very tiny body it can oat through the air like a dandelion uses very little energy 0 Ice sh live in saltwater below freezing have no scales absorb oxygen through skin no red blood cells would make blood too thick had an antifreeze protein in its blood 0 Protein binds 0 Ex ice cubes forming in a tray form on the outside of a fish 0 Prevents them from growing Mammals What are the four traits all mammals share 1 Many have placenta placentals 2 Hair and fur protection sensory organs camou age insulation defense porcupine some have lost it 3 Endothermy all of them 4 Mammary gland 5 Karatin is a protein that makes a variety of structures What are some of these structures Scales skin outer later nails class hooves horns Birds Turtles Lizards snakes K J Crocodiles alligators Dinosaurs f Birds What mechanisms could have caused small insulating feathers to become big enough to achieve ight Sexual selection ridiculously big feathers How feathers evolved from scales Note birds still have scales on legsfeet Similarities Made from keratin Formed from skin tissue Replaces in same manner Scale 9 hollow lament 9 many hollow laments 9 symmetrical small 9 ight feathers What had to evolve before birds could y Flight feathers 9 laments 9 scales Hollow bones they need to be light enough Strong pectoral muscles Breast bone more surface area for muscle attachment Birds needed to evolve three things that reptiles didn t have Flight feathers Hollow bones Breast bones You should be able to De ne and give an example of the vocabulary words Describe at least four adaptations organisms have evolved to deal with cold Compare and contrast the adaptations of animals to those of plants Compare and contrast scales feathers and furhair Describe the ice sh and how it adapted to live in freezing water Describe the typical traits of mammals Explain how dinosaurs and birds evolved feathers Explain what had to evolve for birds to be able to y U 39gtE E t Lecture 25 Before class do the following 0 read Ch 359 in the Raven 10th ed Freeman 5th ed p 629633 0 complete the Explore Your Inner Animals click and learn activity wwwhhmior2biointeractiveexploreyourinneranimals 0 answer the questions on Blackboard Primate Evolution Work on the following questions in small groups We will then get together and discuss the answers as a class Miocene to Homcene Ohgocene A o Eocene 58 Mya Strepsirrhini Haplorhini 1 Why is it incorrect to say Humans evolved from monkeys or Monkeys evolved from humans Humans and monkeys evolved from the same distant common ancestor but that ancestor didn t look exactly like either one of us 9 Neither of us evolved from one another We both evolved from the same primate ancestor EX our ancestor was never a knuckle walker while the monkey s ancestor did 2 How are primate hands different from the hand of early mammals Opposable thumbs evolved at Catharrhini the large yellow space longer ngers nger nails instead of claws giving us sensitive nger pads more used for climbing 3 How did this give early primates an advantage They were able to use tools and grip things so they can live off of small branches so they can grip 4 Why is it important for treedwelling primates to get out to the tips of tree branches What adaptation allows them to do this The branches hold ripe fruit and other foods Primates needed to be able to get out to them Having ngers that allowed them to grab the branches was essential for them to do this 5 Why did primates with color vision have a competitive advantage over other primates They could distinguish different foods and tell the difference between ripe fruit red and unripe fruit They also run around during the day instead of at night so they need to see color 6 Why don t monkeys have back problems Monkeys don t have a curved spine so they won t have as many back problems They have all of their weight on their hands instead of on their back Their vertebrae are not being compressed like with humans 7 What had to evolve before humans could start making and using tools Short ngers and opposable longer thumbs they were able to close in on each other and grip something The brain got bigger as well and needed more neurons for processing 8 How are human brains similar to shark brains They have the same sections forebrain midbrain and hindbrain 9 Primates that can see color have a third opsin gene likely created by duplicating one of their original two opsin genes How does this happen What other gene have you seen in this class that was duplicated Gene duplicates in the same manner Crossing over in meiosis you can get a duplicate gene Hox genes are duplicated 10 How does a gene work What does it mean to say a gene is broken How does one break a gene A gene needs to be turned on or expressed in order to work Transcription and translation through proteins When you have a mutation in a gene the DNA sequence changes DNA codes for amino acid sequence which forms the protein Insertion substitution etc 11 We ve talked a lot about the traits we share with other primates and mammals What can broken genes tell us about how we are related to other species For example we have genes that used to code for yolk proteins but they no longer produce yolk protein Also look at the image below which shows the sequence of the GULO gene responsible for producing an enzyme that produces vitamin C Rats have a functional GULO gene but we do not Neither to chimpanzees or organgutans Rat GGAGAAGACCAAGGAGGCCCTACTGGAGCTAAAGGCCATGCTG Human AAAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCGTGCTG Chimp AAAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTG Orangutan AAAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTG Functional sequence is the top line human Mutations are at the red letters Humans chips or orangutans do not produce vitamin C We have the same broken gene broken in exactly the same manner 0 What traits are associated with primates Red green color blind Opposable thumbs amp long ngers 9 gave us grasping hands Binocular vision Large brains Many are bipedal Use tools You should be able to 1 Explain how we are similar and how we are different from our primate ancestors 2 Explain how we know that humans evolved from primates 3 Explain how genes can be duplicated Describe what happens after duplication to create entirely new genes 4 List the traits associated with primates


Buy Material

Are you sure you want to buy this material for

75 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Bentley McCaw University of Florida

"I was shooting for a perfect 4.0 GPA this semester. Having StudySoup as a study aid was critical to helping me achieve my goal...and I nailed it!"

Anthony Lee UC Santa Barbara

"I bought an awesome study guide, which helped me get an A in my Math 34B class this quarter!"

Jim McGreen Ohio University

"Knowing I can count on the Elite Notetaker in my class allows me to focus on what the professor is saying instead of just scribbling notes the whole time and falling behind."


"Their 'Elite Notetakers' are making over $1,200/month in sales by creating high quality content that helps their classmates in a time of need."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.