New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

MolGen 4500

by: Dylan P

MolGen 4500 MOLGEN 4500 - 0020

Dylan P
GPA 3.67

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

MolGen 4500 class notes
General Genetics
75 ?




Popular in General Genetics

Popular in Biochemistry

This 65 page Bundle was uploaded by Dylan P on Wednesday December 9, 2015. The Bundle belongs to MOLGEN 4500 - 0020 at Ohio State University taught by Vaessin in Fall 2015. Since its upload, it has received 202 views. For similar materials see General Genetics in Biochemistry at Ohio State University.

Similar to MOLGEN 4500 - 0020 at OSU

Popular in Biochemistry


Reviews for MolGen 4500


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 12/09/15
Genetics is one of the oldest sciences      Something happens when a species breeds and gives birth to a young with similar traits to the parents   Mendelian Genetics - Chapter 2       Schwann proposed cell theory around 1830      Darwin’s Origin of Species 1859      Darwin’s proposed pan genesis included gemmules to describe physical units representing body parts etc.      Lamarck: “use it or lose it” theory of heredity   Mendel’s Experiments       Used common garden pea      Followed discrete traits       Kept detailed records       Determined units of inheritance       Basis of Mendelian or transmission genetics  Mendel’s Postulates       Unit factors exist in pairs (alleles)       One unit factor is DOMINANT and one is recessive       Paired unit factors segregate randomly  Monohybrid Cross:       Trait transmutation from one generation to another       Unit factors = genes  Phenotype: physical expression of a trait  Genotype: allelic makeup of a trait  Homozygote/homozygous: identical alleles (DD, dd)  Heterozygote/heterozygous: different alleles (Dd)  Pure breeding lines: homozygous Probability Theory:       Independent Events       Chance of event 1 occurring is undefended of event 2       Product Law: multiply the probability of each event to determine probability of both events      Sum Law: Outcome can be accomplished in more than one way            Sum the probabilities of each way of obtaining the outcome  Meiosis I       Independent assortment of homologs       Prophase II: Same number of chromosomes as Metaphase I  Independent Assortment:       1st meiotic anaphase, homologs separate independently       Possible combinations = 2^n      Humans: n=23; therefore 2^23= 8x10^6      8million gametes possible just because of random assortment of homologous chromosomes  Backcross: crossing of an F1 individual to either one of the P1 parents (or parent genotype)  Testcross: crossing of an F2 offspring to homozygous recessive individual to determine genotype of the F2 individual  Punnett Square Dihybrid Cross:       Follow 2 pairs of contrasting traits       Independent Genes            Independent events (can use product law)       Probability calculation (forked line method)  Forked Line Method: alternative way to analyze crosses  Test Cross: unknown genotype with a homozygous recessive  #’s of Genotypes and Phenotypes       First, determine # of heterozygous gene pairs in cross (n)       2^n = # of different gametes             = # of different phenotypes       3^n = # of different genotypes  Trihybrid Cross       3 factors       Punnett square cumbersome       Use forked-line method for phenotypic calculations       3 Monohybrid crosses       (3^3) = 27 genotypes  How often will either P1 phenotypes occur in F2 ?  Genetic Events and Laws of Probability       Binomial Theorem            2 alternative outcomes            Probability based on # of trials            Can calculate the probability of # of outcomes of one type of n trials           p = (n!/s!t!) x a^s b^t Cystic Fibrosis       2 heterozygous parents for CF       Q: They have 5 children, what is the probability that 3 will be normal?  Human Genetics       Cant do large scale crosses       Reconstruct genotypes from analysis of family histories       Pedigree Analysis  Lethal Alleles       Can be recessive or dominant lethal            2 copies of mutant present (homozygous): recessive lethal allele       1 copy of mutant lethal (heterozygous): dominant lethal; Huntington Disease  Autosomal Recessive Traits       # of males = # of females       Affected usually produce unaffected       Most affected have unaffected parents       Parents of affected sometimes related       Individuals with affected sib has 25% chance of being affected       Trait may skip generations (carriers)  Cystic fibrosis: autosomal recessive disorder Cf-/Cf- affected  Autosomal Dominant Traits       # of males = # of females       Affected has usually affected parents       Individual with affected parent has 50% chance of being affected       Does not skip generation  Penetrance:** percentage of individuals that show some degree of expression of the mutant genotype       Huntington disease, all with dominant mutant gene get the disease: Penetrance = 100% Expressivity:** observed range of the mutant phenotype       Trisomy 21 (Down Syndrome) has variable expressivity in observed phenotype  Extensions to Mendelian Genetics  Alteration of expected Mendelian Frequencies       Multiple alleles      Partial (incomplete) dominance       Codominance       X-linked genes  Codominance: ABO Blood Type       Phenotype determined by Isoagglutanin alleles       IA produces A antigen on cell surface       IB produces B antigen on cell surface       IO produces no antigen       IA and IB behave dominant to IO, but codominant to each other            Transfusion with incompatible blood types            Immune system antibodies will react to non-self antigens, coagulate the transfused blood, PROBLEM!       O is a Universal Donor b/c it has no antigens, will not cause immune reactions       AB can only donate blood to other AB individuals       AB is a Universal Accepter  Incomplete Dominance      Neither allele is dominant, both alleles expressed= incomplete dominance            Phenotype of flowers are of intermediate color            Examples of incomplete dominance are rather rare  Other Genes can Affect ABO Phenotypes   Bombay phenotype, genetically B, phenotypically O       Bombay Individuals can only accept blood from other Bombay Individuals       “H" substance            A & B antigens are carbohydrate groups added to “H” substance            hh mutants do not have H substance, cannot add A or B antigen, makes genetically A, B, or AB individuals look O phenotypically            Cross of IAIB Hh x IAIB Hh reveals altered phenotypic ratios            Follow Blood type phenotype only  Follow 2 Characters altered ratios       Albinism in mice (typical monohybrid inheritance pattern, 3:1)       Blood type (codominance)       What is the phenotypic result?      Final Phenotypic Ratio 3:6:3:1:2:1 (Not the expected 9:3:3:1)  Coat Color in Mice       Wild type color is agouti: A allele       Mutant allele AY produces yellow mice in heterozygotes, therefore AY is dominant       However, when AY is homozygous, it is lethal (recessive lethality)       Results in altered phenotypic ratios  Pleiotropy: expression of a single gene has multiple phenotypic effects, is also common Epistasis:  the expression of one gene pair masks or modifies the effect of another gene pair      Labrador coat color genetics: B is dominant black, b is recessive brown, and recessive ee masks the Bb allele and makes yellow      Blood type and the Bombay phenotype      9:3:4 Ratio Recessive Epistasis: the allele causing the epistasis is recessive. The recessive ee homozygote is considered epistatic to any allelic combination at the first gene   Expressivity: Observed range of the mutant phenotype       Trisomy 21 (Down Syndrome) has variable expressivity in observed phenotype  Penetrance: percentage of individuals that show some degree of expression of the mutant genotype  Sex-linked and Sex-Influenced Inheritance       Autosomal genes, but expression dependent on hormonal constitution of the individual            Sex-linked expression: phenotype is absolutely limited to one sex                Tail and neck plumage in domestic fowl                Sex combs in Drosophila males             Sex-Influenced: sex of an individual influences the expression of a phenotype                 Pattern baldness in humans  Chromosome Theory of Inheritance : Chapter 4  Mitosis: produces 2 identical daughter cells  Meiosis: reduces genetic material content & number of chromosomes by exactly one half       Essential for sexual reproduction            S phase: The DNA genome is copied            G2: Cell gets ready for Mitosis  Diploids: Chromosomes exist as homologous pairs       Types of chromosomes based on position of centromere (distinctive region on chromosome)  Karyotype: Photograph of squash of chromosomes       Picture taken at metaphase of cell cycle (following DNA synthesis)  when sister chromatids are still attached to one another  N vs. C      N= number of chromosomes in a haploid set (N=23)      2N= diploid (2N=46)      C= amount of DNA in an N nucleus  Genomes can also be expressed in the number of base pairs       Chicken has more genes than humans  Cell Cycle      2 general portions       Interphase (“resting” phase)       Mitosis: cell division  Mitosis:       When in life cycle?            In embryo            During organ development            Pathogenic events       Places and times            Renewable tissue (have stem cells)       Prophase      Metaphase: chromosomes line up      Anaphase       Telophase  Mitosis      Prophase: centriole migration       Prometaphase: 4 chromosomes, 8 chromatids, 8 centromeres            Sister chromatids       Metaphase: chromosomes line up       Anaphase: chromosome migration to opposite poles       Telophase: daughter chromosomes at opposite ends, cell divides (cytokinesis)  centromeres are regions of the chromosome that bind proteins that result in transport of chromosomes to opposite poles of the cell  Kinetochores and Centromeres       Centromeric DNA, specific DNA that allows binding by centromeric proteins       Kinetochore proteins bind to centromeric proteins       Allows attachment to spindle bikers which facilitates transport to poles       2 pairs of centrioles: microtubule organizing center (MOC)  Cell Cycle regulation and checkpoints       Cell cycle features highly regulated by numerous gene products       Cell cycle checkpoints are places in the cell cycle where DNA or the cell is checked for damage and if damage is detected, repair or self destruction of damaged cell occurs       Specific times in cell cycle when damage to cell is assessed prior to proceeding to mitosis       Prevents damaged cells from replication g      Apoptosis: cell death  G1/S: DNA damage       S: Incomplete DNA synthesis  G2/M: DNA damage       M: Incomplete spindle formation  Cell division cycle mutations       Checkpoint in cell cycle as decision process for proceeding to division       Many of these genes produce kinase enzymes (add phosphates to other proteins)            Specific kinases depend on binding to another protein (cyclins) to achieve active form            These are “Cyclin-dependent kinases” (Cdk)  Cyclin Protiens       Cyclin levels vary during cell cycle  Meiosis      Key difference is Meiosis I: Reduction division 2N —> N       Meiosis II: N—> N       Dyads (one pair of sister chromatids) move to each poles: Reduction step       Meiosis II looks very similar to Mitosis  Germ Cells      Subset of cells that do not give rise to any particular tissue       Later migrate to the gonads       Then undergo meiosis to form gametes (germ cells)  Human Germ Cells       Primordial germ cells in yolk sac       All oocytes present at birth, resting at diakinesis stage of cell cycle       1st follicle cell matures, -12yrs, oocyte at ovulation goest to metaphase II, lost unless fertilized       Oogonia develop, 1/month       Meiosis results in differentiated ovum and polar bodies       If egg fertilized, oocyte no longer arrested in metaphase II  Human Sperm Cells       Stem cell population present       Spermatogonium (2n)       Undergo meiosis to spermatocytes (N)       Further differentiation into sperm       Meiosis result in 4 sperm cells  Nondisjunction       Separation of chromatids fails to occur       Can happen in meiosis I or meiosis II       Abnormal games produced (monosomic, trisomic)       Most nondisjunction are lethal       Trisomy 21: Down syndrome       Probability increase with age  Sex Determination and Sex Chromosomes  Examples       Ratio of X chromosomes to sets of autosomes determines sex in Drosophila        Temeprature-depenedent sex determination in reptiles       Haploid vs. diploid in honey bees (male needs are haploid, while female bees are diploid)  Mammals:       Primary sex determination: gonads       Secondary sex determination: overall male or female phenotype       Early vertebrate development similar       Early vertebrate gonad development also similar  Secondary sex determination       Ovary: estrogens       Testis  Steroids:      Powerful regulators, each sex has specific receptor for each       Essential difference between estradiol and testosterone is a methyl group  Turner Syndrome (XO)  What determines maleness on Y?       Observe XX males and XY females            HOW?   What Determines Maleness on Y?      Observe XX males and XY females…How?            SRY gene makes males** SRY: Sex Determining region       Encodes gene that tigers gonadal tissue to develop testes       This product is called testis-determining factor (TDF)      SRY is present in all mammals examined       Found in mouse (Sry) Evidence of SRY as male determining region       Human males with 2X chromosomes       Often, these individuals have SRY region attached to one of the X chromosomes       Human females, 1 X , 1 Y       Their Y is generally missing SRY region       Supports hypothesis of SRY region in male determination  Experiment       XX mice injected with SRY            Mouse SRY DNA injected into normal XX mouse eggs            Most of these offspring develop into males            Demonstrates power of SRY region in male development            However, male offspring not fertile, need other Y genes       Mice injected with human SRY            Do not get sex transformation            Human SRY is different enough to not function in mouse  Dosage Compensation: Barr Body       One copy of X inactivated       Prevents excess of X-linked gene products       Happens mid-gestation       Result is Barr body       All subsequent daughter cells inactivate same copy of X       Multiple X genotypes inactive all but 1 X If X inactivation “turns off” all but one X chromosome, why aren’t Klinefelters individuals XXY normal?       100% of all the X chromosomes are not inactivated, some are still active      Barr body has small regions that stay active  Mechanism of X Inactivation       Region called X-inactivation center (Xic)       Expression of this regions leads to inactivation of this X       Correlation of constant expression of Xic and X-inactivation       RNA product of Xic hypothesized to coat that X & inactivate it: cis acting       Many aspects still unknown  Klinefelter’s Syndrome XXY       Appear male but with rudimentary testes, unable to produce sperm       Some feminine characteristics occur  Genetics of the Calico Cat       X linked allele       B= brown hair color; O= orange hair color  And vice versa with the other color  X-linkage       Many animals, some plants, one sex contains a pair of “unlike” chromosomes       Genes present on X, but absent on Y are said to be “X-linked” genes  Fruit Fly X-linked example       White eye mutation       Normal color is red       Results were different depending on which parent exhibited the recessive mutant trait  X-linkage       In males, whatever alleles are on the X are expressed  X-linkage in humans      Identified in [pedigrees by crisscross pattern of inheritance: all sons exhibit mutant trait inherited from the mother       Color blindness, Hemophilia A, B  Chromosome Mapping in Eukaryotes  Independent Assortment       Genes on different chromosomes separate separately  BUT: What if two genes are on the same chromosome?  Non-sister chromatid crossover will shuffle alleles  Crossover must occur between 2 genes to get an exchange  Morgan’s Fly experiment       Found expected progeny & unexpected progeny       Y chromosome does not contribute to somatic phenotype       No crossover occurs in male flies       Crossover occurs on the X and the autosomes in females       Frequency of crossover? Very common       Method:            Create pure mutant strain female            Cross to wt male and create heterozygous females       Recombinants were not directly provided by parent Observations:       Observe wt and mutants (parentals)       Also observed recombinant genotypes       Sturtevant observed this rate of recombination could be correlated with distance between the genes       1% recombination = 1 map unit = 1CM (Centimorgan)  The highest percentage of crossover games that we can observe is 50% Applying the chi square test       Null: the observed values are not different from the expected values       Alternative: observed values are different from the expected values            Degree of Freedom: number of choices - 1 (n-1)           Parental and Recombinant: DF=1  Experiment 2: They are linked! 3 allele cross      Use to determine distance and order between the 3 genes       Used to build genetic maps of gene location Double crossover event (DCO)        Drosophila 3 point mapping cross       Determine the number of non-crossover, single crossover, and double crossover           NCO largest # of offspring -PARENTAL-           DCO smallest # of offspring            Allele that changes position in DCO is in the middle      White is in the middle ** Mapping sample problem wil come up on exam!  **  Mapping Human Genes I       Somatic Cell hybridization (1960s)  Synteny Testing      Determine location of gene B  Location: 3 Mapping human genes II       FISH method, Lod Score method, pedigree analysis  DNA: Structure, Recombination, and Replication Genetic Material Qualities?       1. Replication      2. Storage      3. Expression      4. Variation by mutations       Proteins and nucleic acids were considered possibilities       Pre 1940s, protein was leading contender            Protein abundant in cell            Wide variety of proteins in cell            DNA shown to be made up of 4 nucleotides, nucleic acids “too simple” to be genetic material            Proteins contained 20 different amino acids, thus more potential variation  Central Dogma: DNA > RNA > Protein  Model systems and differential labeling       Choice of the correct organisms to perform an experiment       Methodology to differentially label or separate molecules of interest       We will observe the combination of these two techniques for the remainder of this course** Evidence for DNA as Genetic Material       Early work by Frederick Griffith       Analyzed virulence of various strains of Diplococcus pneumoniae: caused by polysaccharide capsule of bacterium      Those with capsule virulent & grow as smooth, shiny (S) colonies      Those without capsule are avirulent & grow as rough (R) colonies             Work extended in the 30s showed that transformation could happen in vitro       Suggested that a chemical substance was responsible for the observed transformation phenomena  Avery, McLeod, and McCarty concluded DNA was the transforming molecule       Differential separation of cell molecules from virulent strain       Test these separate components for ability to transform avirulent into virulent       Only molecule with genetic material is DNA  Hershey-Chase Experiments       Provided convincing evidence of DNA as genetic material       Key was the model system used (E.coli and its viruses) and differential labeling of proteins and nucleic acids            Provides method to “differentiate not thing for another thing" Model System      E.coli: bacteria easily grown and analyzed       T2 bacteriophages: a virus of E. coli that replicates within E. coli following infection            T2 phages ~50% protein, 50% DNA      Proteins labeled with radioactive 35S, DNA labeled with radioactive 32P: Differential labeling!  Key Results:      Remove phage ghosts, only radioactive phage ghosts were those labeled with 35S       Viable phage were radioactive only from those that were labeled with 32P, therefore it was DNA that served as the genetic material  DNA as genetic material in eukaryotes       Indirect: DNA found only where primary genetic function occurs, correlation of policy and the quantity of genetic material molecule       Direct: UV light is most mutagenic at wavelengths that RNA and DNA absorb the most Structure of DNA      Nucleic acid chemistry helped to work out the structure of DNA      DNA IS a nucleic acid, nucleotides are building blocks of nucleic acids      3 components: nitrogenous base, pentose (5 carbon) sugar, and a phosphate group           Nitrogenous bases: 2 types                 Purines: 9 member double ring (A & G)                 Pyrimidines: 6 member single ring (C, T & U)  DNA and RNA       RNA: join Ribose to purine or pyrimidine in specific manner, result is ribonucleosides            add a phosphate group       DNA: join 2-Deoxyribose to purine or pyrimidine in specific manner; result is deoxyribonucleosides            add a phosphate group       NMP, NDP, NTP Deoxy.  Watson-Crick DNA model       Previous studies were integrated into their model       Built models based on the known constraints experimentally determined (by others)       Early 50s: Watson learns about x-ray diffraction pattern projected by DNA           X-ray diffraction patterns produced by DNA fibers- Rosalind Franklin and Maurice Wilkins       Knowledge of the chemical structure of nucleotides       Erwin Chargaff’s experiments demonstrate that ratio of A and T are 1:1 & G and C are 1:1      53: Watson and Crick propose their double helix model of DNA structure  Features of Double Helix:       2 polynucleotide chains coiled around a central axis, forming right handed helix      2 chains are antiparallel - run in opposite directions       The bases lay flat, perpendicular to the axis, stacked on one another 3.4 Angstroms apart      Approx. 10 base pairs per turn of helix       There are major grooves alternating with minor grooves       Double helix is 20 Angstroms in diameter  Alternative DNA Forms      Using different isolation conditions, different forms of DNA obtained       2 forms known at the time of Watson and Crick model: A and B       B-DNA is the “normal” form of DNA in vivo       Other forms now found: C, D, E, P, and Z DNA (roles in vivo still not understood)  RNA      Structure resembles DNA with exceptions       Ribose sugar replaces deoxyribose       Uracil replaces Thymine       Most RNA is single stranded, but can base pair with itself or other nucleic acids  BOTH      Absorb UV light most strongly at 260nm       The amount of UV light absorbed is related to the concentration of RNA or DNA in a sample       Higher S, in general, larger molecules       Ribosomal RNAs the largest, e.g.. eukaryotic 18S rRNA  Nucleic Acid Centrifugation       RNA’s differentiated by their sedimentation behavior       Measure is called Svedberg coefficient (S)  DNA Replication and Recombination  Replication takes place during S phase (DNA synthesis occurs)  Challenge of Replication:       Human DNA       Over 3billion base pairs on 23 chromosomes       Must replicate it and do it accurately       Even a one in a million error rate would lead to 3000 errors per replication       Therefore the system must be VERY accurate  1. DNA Replication       Hypothesis:            Watson and Crick(53): Semi conservative replication, each DNA strand could serve as a template for its own replication                 1 old strand and 1 new strand in each double stranded DNA            Conservative: new and old strand re-anneal with one another following replication            Dispersive: mixed between the new and the old strand (unlikely)  Testing of Hypothesis of semi-conservative replication       Meselson-Stahl Experiment            Use heavy (15N) that could be incorporated into DNA            Simplicity of this experiment combined with powerful results leading to the robust conclusion: Great Experiment  Eukaryotic Replication       Later work on other eukaryotic organisms supports the ubiquity of semi- conservative replication Raises New Questions…!        Origin of replication: where replication of DNA begins       Replication fork: where DNA strand are unwound       Replicon: length of DNA replicated at one fork  Studied first in prokaryotes       245 bp region (oriC)       DNA replication is bi-directional in E.coli  Short Answer      Complex system employed to achieve replication       Again first studied in E.coli       Compared process Kornberg Experiment       Looking for enzyme that was able to replicate DNA in an in vitro system       Isolated an enzyme he called DNA polymerase I (DNA Pol I)       Major in vitro requirements: dNTP’s, template DNA (with partial complement), primer, Mg2+      GET DNA EXTENSIONS  Kornberg Experiments       Looking for enzyme that was able to replicate DNA in an in vitro system       Isolated an enzyme he called DNA polymerase I (DNA Pol I).       Major in vitro requirements: dNTP’s, template DNA (with partial complement), primer, Mg2+       GET DNA EXTENSION        Kornberg sought to determine the accuracy of the newly synthesized DNA Problem      Much slower rate of synthesis than in vivo       Worked better on single stranded template       DNA pol I degraded DNA  Experiment       Kornberg sought to show that DNA pol I could create “biologically active DNA”  IF DNA pol I could make DNA that was biologically active, THEN it must be the major catalyzing force in DNA       Relied on in vitro method to discriminate newly made (-) strand and subsequently made + strand       Final + strands used to infect E. coli       IF these final + strands were capable of producing mature phage particles following transfection, THEN DNA pol I replicated DNA that was biologically active       Conclusion:           DNA pol I had demonstrated biological activity            DNA replication was accurate, any alteration would have probably rendered it non-viable  Other DNA polymerase       II and III       All can elongate DNA from a primer 5-3  Issues/Obstacles that must be overcome  Eukaryotic Replication  DNA Recombination  DNA pol III holoenzyme       Dimer of 10 different subunits       Think BIG Structure, most proteins have mass between 10-100kDa                 Alpha 5-3 polymerization            Epsilon 3-5 exonuclease       Second group of 5 subunits form y complex involved in enzyme loading       Energy comes from ATP  Replisome      DNA pol III holoenzyme and other proteins at replication fork       Huge complex of proteins       DNA needs to be unwound - helicase      Supercoil needs to be released - gyrase       Single strands need to be stabilized - SSBP       A free 3’ OH group is needed - primes generates a short RNA primer            Replication can start  How is DNA unwound       oriC origin of replication       Consists of repeating sees of 9 and 13 bases      Unwinding creates coiling tension: supercoiling       What is the primer used for:      DNA pol I, II, and III cannot initiate polymerization       Short segment of RNA (5-15 nucs) made complementary to DNA  Proceeds unti the next RNA primer encountered       Called Okazaki fragments            1000-2000bp in E.coli  RNA primers are removed through DNA pol I       Fills in the primer region with DNA  The ends are then filled in with DNA ligase       Catalyzes phosphodiester bond and seals the gap in the DNA All polymerases possess 3-5 exonuclease activity  Leading and Lagging strands are synthesized concurrently  Eukaryotic DNA Replication       Slower process       Larger DNA fragments must be replicated            Studied firs in yeast            Multiple origins of replication, called autonomously replicating sequences (ARS) in yeast            Contains consensus seq of 11bp           ARS bound in G1 of cell cycle by specific protiens       Forms origin recognition complex (ORC)       Replication begins in S phase after involvement of other singles (kinases)       Histone proteins must be disassociated prior to synthesis and re-associated after       Synthesis begins with pol alpha (low speed)      Then, DNA polymerase switching ads to pol ∂ (high speed)       Okazaki fragments are smaller       Multiple origins of replication result in reasonable length of time to replicate large genomes (still this can take multiple hours for complex genomes)  Eukaryotic Chromosome Telomere Replication       Antiparallel nature of DNA leads to problem at the end of chromosomes (telomeres)       Telomere replication solved by an elegant mechanism       Special enzyme (Telomerase) contains proteins and RNA       RNA serves as guide and template       Base-pairing overlap followed by reverse transcription of the overlap       Leads to extension of the lagging strand  Telomere Replication       Solved by an elegant mechanism       Special enzyme (Telomerase) contains protein and RNA       RNA serves as guide and template       RNA has seq. 3’ - AACCCC - 5'      Basepairing overlap followed by reverse transcription of the overlap            Telomerase binds to 3’ G-rich tail            Telomerase is translocated and steps are repeated            Telomerase released; primes and DNA polymerase fill gap            Primer removed; gap sealed by DNA ligase  Eukaryotic Chromosome Telomere Replication       Telomerase function found in all eukaryotic organisms studied       Human telomerase has RNA with seq. 3’- AAUCCC-5'      Telomerase not active in most somatic cells — >ends degrade over time  Telomerase: Key to Aging?       Telomerase shorten with age       Cells from older humans undergo fewer replications before undergoing senescence       Not present in somatic cells  Eukaryotic DNA Recombination       General (homologous recombination)       Like replication, recombination is directed by specific enzymes       Series of enzymatic processes accomplish process  Chromosomes need to find the same spot or there will be mutations      One strand is extended into the other  Gene Conversion       Consequence of DNA recombination       Recombination leading to mismatch if wild type and mutant type are in the recombined region       Mismatch can be excised on either strand      Subsequent repair can lead to conversion to mutant or wild type  Chapter 7 Anatomy and Function of a Gene: Dissection Through Mutation       1. Mutations occur in the DNA molecule       2. Various entities act to create mutations in the DNA molecule       3. Cellular machinery acts in numerous ways to correct mutations       4. Some mutations escape correction processes       5. Fixed mutations can lead to altered phenotypes  Pyrimidines: Cytosine & Thymine  Purine: Adenine & Guanine  Mutations      Point mutation       Altered number of copies of repeated sequences       Insertion of large segment of foreign DNA into normal gene sequence  Point Mutations      Changes to single base (point)       Causes            Spontaneous, arise in absence of known mutagen at some low “rate”            Induced by mutagens (agents that increase the rate of mutations)       Mutation rate: number of mutating gametes/ total number of gametes Types of Mutations       Transition: purine to purine or pyrimidine to pyrimidine (A/G C/T - 4 possibilities)       Transversion: purine to pyrimidine or pyrimidine to purine (A/T, A/C, G/C, G/T, C/A, C/G, T/A/ T/G - 8 possibilities)       Insertions/Deletion: Addition or deletion of one or more bases (TAAAGCT to TAAAGGCT - insertion)  Regulate expression of a possible gene & can effect function Mutations Summary      Replication slippage leading to increased number of repeat units      Point mutation      Insertion Repeat Unit Expansion      Human Diseases           Huntington Disease, Mytonic Dystrophy, and Fragile X Syndrome   DNA weakens and strands separate                                          Not as efficient but provides some stability                                                                                                                                              Normal Lineage 6-54 copies (Normal)            Susceptible Lineage 50-200 copies (NTM)           NTM’s daughter, phenotypically normal 50-200 copies (Daughter)           Increase of CGG repeats —> Disease Phenotype 200-1300 copies (Affected Person)                 Fragile X Syndrome                      Repeat expansion is in 5’ untranslated region (UTR)                      Gene encodes for FMRP normal expressed in the brain                      FMRP Not present —> No mRNA transport —> No translation of those mRNAs —> Improper brain development                 Fragile sites and Cancer                     Now shown to be associated with some cancers                      FHIT gene locus is located within a fragile site on chromosome 3, FRA3B                     DNA often found broken and incorrectly fused in cells from tumors                      ~80+ fragile sites now known  Mutagens:       Non-chemical mutagens, Chemical mutagens, Base isomers       Consequences:            Base replacement           Base alteration leading to mis-pairing           Base alteration leading to non-pairing      Non-chemical mutagens           X-ray - Single and double stranded breaks of DNA           UV Irradiation - Photodimers       Chemical            Base analogs - 2-aminopurine & 5-bromouracil            Base alteration chemicals - alkylating agents (add alkyl groups)            Intercalating agents - insert in double helix —> Indel —> Frameshift mutation  Base Isomers: tautomeric shifts       Normal (keto) form of base skewed to rare (enol) form OR normal (amino) to rare (imino) of base       Ionization of bases can also lead to shift to rare form            Can lead to mis-pairing of bases       Tautomeric shift leading to mutation, in this case as a result of tautomeric shift of adenine  **Went from a T-A to a C-G**       This is a very rare event but there is a possibility of this happening and even the DNA not fixing the strand  Spontaneous Mutations       Low Rate       Causes           Oxidative compounds, Depurination, Errors in DNA replication       Consequences           Base mispairing, Non-pairing or base substitutions  Mutation Site Heterogeneity       Mutation Hot Spots            Some positions/regions more susceptible to mutational changes  Assessment of Mutagenicity       AMES Test       Utilizes 2 Salmonella typhimurium mutant strains, both his- (requires histidine to grow)       Assay measures reversion (mutation) to wild type       Compounds modified by liver enzymes prior to test…Why?  EXAM WILL COVER CH 6, 7, 8 (NOT 11!!) Assessment of Mutagenicity       AMES Test      Utilizes 2 Salmonella typhimurium mutant strains, both his- (requires histidine to grow)       Assay measures reversion (mutations) to wild type his+       Compounds modified by liver enzymes prior to test…Why?            Simulates what happens and how liver enzymes actually modify the substances       Any chemical that significantly increases the number of colonies appearing on the treatment lat is mutagenic, and thereof potentially carcinogenic  Mobile Genetic Elements: DNA moving around within the genome! (Bacteriophages)       Many originated from viral infections       Transposons           Class I                 Transpose through DNA intermediate                 "Copy and past" or "cut and past" movement mechanism                 Have inverted terminal repeats                 Has tranposase enzyme gene                Example: bacterial IS elements, bacterial transposons, Drosophila P elements, Maize Ac/Ds           Class II : Retro-trasnposons                 “Copy and past” mechanism                 Transpose though RNA intermediate, RNA revers transcribed to dsDNA by reverse transcriptase        Replicative Transposition        Non-replicative Transposition  Transposable Elements       Insertion Sequence      Transposons            Pro/ Eukaryotic  One Gene One Enzyme Hypothesis       Beadle and Tatum experiments in Neurospora (model system)       Nutritional mutants            Mutate Neurospora            Isolate mutants that will not grow on minimal media (no amino acids, purines, pyrimidines or vitamins; but carbon, nitrogen, and some source of minerals)                                                            How do we determine this pathway???                 Assume that: We isolated 7 mutations in this pathway that, Complementation analysis allowed us to group them in three, Complementation groups  Nutritional Mutants       Used to determine biochemical pathways       Led to One Gene: One Enzyme hypothesis       Logic of this experiment still used to determine epistasis of gene functions in linear regulator pathways                  One Gene: One Polypeptide       Studies of hemoglobin showed that some proteins could be made of multiple subunits      Each polypeptide is encode by a separate gene       Example of sickle-cell anemia  In what direction does DNA synthesis occur in continuous and discontinuous strands?       5’ to 3’ (both)       A, B, C, D —> Outcome/ Products **(EXAM)**      Mutations 3, 5, 7, 11, 14  A B C D Product 3 + + - - + 5 + - - - + 7 + + + - + 11 - - - - + 14 + + + + +      11 cannot be rescued by anything (Last enzyme) before the product       A is the one closest to the product          —>  D —> C —> B —> A —> Product           14       7       3        5      11 Chapter 8: Gene Expression: The Flow of Information from DNA to Proteins 2 Major Questions      How is genetic information encoded?       How does information transfer from DNA to RNA occur?  Genetic Code:       Code is in linear form      RNA sequence is derived from complementary bases of DNA      Each “word” of the code in the mRNA contains tree ribonucleotide “letters"      Each three set is called a codon       The code is unambiguous, each triplet specifies a single amino acid (or stop)       The code is degenerate, more than one triplet can code for the same amino acid      The code contains a “start" and “stop" signal       Translation of mRNA is continuous       The code is non-overlapping       The code is “nearly” universal  How was the code determined?      Evidence supported a non-overlapping code      1961- Jacob and Monod postulated the mRNA       mRNA was discovered, the code that is translated is in mRNA  What was the code:      Theoretical argument of a triplet       3 letters represents the minimum to encode information to specify 20 amino acids  Other arguments against an overlapping code      Point mutations would affect more than one amino acid, but this was not observed      Crick argued for an adaptor molecule, not consistent with an overlapping code      BOTTOM LINE: evidence did not support an overlapping code Deciphering the CODE:      1961- Nirenberg and Matthaei characterized the first specific coding sequences  Method      In vitro system (cell free) that could synthesize protein       Enzyme (polynucleotide phosphorylase) that produced synthetic mRNAs, which serve as template for polypeptide synthesis in cell free system       The probability of the insertion of a particular ribonucleotide is proportional to its availability in the system       Provides a means to decipher the code  Simple Experiments       Homopolymers       Radioactively label each of the 20amino acids  Heteropolymers were used next:       Next moved to heteropolymers with known concentrations (proportions) of each ribonucleotide      Could predict the frequency of the triplets based on proportions       Match the property of amino acids incorporated with the proportion of potential triplets       Examine the percentages of incorporation of any given amino acid       Propose what triplet might encode that amino acid       Many experiments where done to work out the code  Triplet Binding Assays       1964- Nirenberg and Leder       Led to specific assignments of triplets            Single triplets could be bound by ribosomes       Lads to binding of anticodon      Experimental technique eventually led to determination of specific triplets coding for 50 of 64 codons       Established degeneracy of the code: >1 codon for 18 of 20 amino acids  Final Table       61 triplets codons that specify amino acids       3 termination codons, stop amino acid incorporated                                 Degeneracy of Code      Code is degenerate: almost all amino acids encoded by 2, 3, 4 codons Wobble Hypothesis      Pattern of degeneracy      Third letter of the code is usually the one that is different: 3rd position free to “wobble”      First 2 positions are most critical      Allows 1 anticodon of tRNA to pair with >1 codon in mRNA   Genetic Code is nearly universal  Transcription       Synthesizes RNA from a DNA template       First step in the transfer of information from DNA (nucleic acid) to protein (amino acids)       Transcription of DNA results in an mRNA molecule complementary to the gene sequence from one of the 2 DNA strands  RNA is transcribed by RNA polymerase       If mRNA is made from DA, then there must be an enzyme to do the job       Weiss et al.: RNA Polymerase            Think about the overall similarity between DNA pol  PROKARYOTE       RNA pol recognizes specific sequences in the DNA molecule called promoters      Promotes can be strong or weak      TATAAT box - 10 bases upstream of initial transcription location       Another promoter farther upstream       Promoters are conserved regions  Eukaryotic Transcirption  Transcription Initiation       RNA polymerase recognizes specific sequences in the DNA molecule called promoters       Promoters can be strong or weak       TATAAT box (Prinbrow Box) 10 bases upstream of initial transcription location       Another promoter farther upstream (-35 region)       Promotres are conserved regions  RNA Pol does not need a free 3’OH to start synthesis  Eukaryotic Transcription       Transcription occurs int he nucleus       Three major forms of RNA pol      More complicated upstream regulation of transcription       Promoters and enhancers involved       mRNAs of eukaryotes are further processed  Eukaryotic Promoters      cis (next to) and trans (across) acting elements       TATA box (cis factor)       CAAT box (cis factor)       Enhancer sequences (cis factor)       Trans Factors (facilitate binding), eg. TFIID, TFIIA, TFIIB, Enhancer binding proteins  RNA Molecules and RNA Processing  4 major classes of RNA       Ribosomal RNA (rRNA)      Transfer RNA (tRNA)      Messenger RNA (mRNA)           transcribed by RNA pol II       Other RNA Classes:            Small nuclear RNAs, small nucleolar RNAs           Small interfering RNAs (siRNAs), micro RNAs (miRNAs), and others that are being discovered  Introns            Heteroduplex: hybridization between mRNA & DNA, areas that don’t hybridize           —> Introns       Introns = Exons - 1  Introns and Intron Removal       rRNA introns; Group I introns; self excised       Mitochondrial mRNA and tRNA Group II introns: also self excised       Nuclear mRNA introns: removed by cell spliceosome machinery  Self Excising Introns       Ribozyme: RNA molecules that act as enzymes      Group I IntronsL found in rRNA genes, guanosine as a co-factor      Group II Introns: found in mRNA and tRNA of mitochondria and chloroplasts, NO co-factor required  Intron Removal: Spliceosome       Cellular machinery to remove introns in mRNAs      Includes numerous small nuclear RNAs complexed with proteins to form small nuclear ribonucleoproteins       snRNAs only found in the nucleus, Uridine rich, got the names U1, U2, etc      This processing represents a regulatory step where different introns may be alternatively removed to created alternative mRNAs  Central Dogma: DNA —> RNA —> Proteins  Small RNA molecules in eukaryotes       Present extensively       Participate in a wide variety of pathways to regulate gene function and expression       Discovery led to Novel Prize in 2006 for Andrew Fire and Craig Mello       Object of intense recent study       Source of novel treatment and investigative methodologies  Module 3:  MY SEQUENCE FOR ASSIGNMENT: GCTGACCATTAAGCCAGGGGAGCATGGGTC Chapter 9: Digital Analysis of the Genome  Background      Human Genome Project- An accurate sequence of the human genome was completed in 2003      By 2013, the genomes of >7000 species have been sequenced       The general ideas behind genome sequencing are simple:            Fragmenting the genome           Cloning DNA fragments            Sequencing DNA fragments            Reconstructing the genome sequence from fragments            Analyzing the information found in genomes  Restriction enzymes fragment the genome at specific sites       Each restriction enzyme recognizes a specific sequence of bases anywhere within the genome            Cuts sugar-phosphate backbones of both strands           Restriction fragments are generated by digestion of DNA with restriction enzymes            Hundreds of restrain enzymes now available       Recognition sites for restricting enzymes are usually 4-8 bp of double-strand DNA            Often palindromic- base sequences of each strand are identical when read 5’ to 3’            Each enzyme cuts at same place relative to its specific recognition sequence       Blunt ends- cuts are straight through both DNA strands at the line os symmetry       Sticky ends- cuts are displaced equally on either side of line of symmetry            Ends have either 5’ overhangs or 3’ overhangs                  Ecoli makes this enzyme because of the defense against phages  Different restriction enzymes produce fragments of different lengths      Average fragments length is 4^n, where n is the number of bases in the recognition site           4base recognition site occurs every 4^4 bp           6base recognition iste occurs every 4^6 bp      What would be the average size of fragments produced by a restriction enzyme with an 8-base recognition its? How man sites would there be in the human genome?   Mechanical forces can be used to fragment DNA at random locations       Mechanical forces can break phosphodiester bonds            Passing DNA through a thin needle at high pressure            Sonication (ultrasound energy)  Gel electrophoresis distinguishes DNA fragments according to size       After electrophoresis, visualize DNA fragments by staining gel with fluorescent dye, and photograph gel under UV light       With linear DNA fragments, migration distance through gel depends on size       Determine size of unknown fragments by comparison with migration of DNA markers of known size                  Chapter 9: Digital analysis of the Genome  Gel electrophoresis distinguishes DNA fragments according to size Cloning fragments of DNA      Genomes of animals, plants and microorganisms are too large to analyze all at once      Molecular cloning is a means to purify a specific DNA fragment away from all other fragments and make man identical copies of the fragment      Two basic steps:            Insert DNA fragments into cloning vectors to make a recombinant DNA molecule             Transport recombinant DNA into living cell to be copied  Creating Recombinant DNA molecules with plasmid vectors       Plasmid cloning vectors have three main features           Origin of replication            Restriction site(s) for cloning insert DNA            A selectable marker (antibiotic resistance)       Note: Bacterial artificial chromosomes and yeast artificial chromosomes are alternate cloning vectors that can carry large inserts                            Digestion of the vector and human genomic DNA with a restriction enzyme results in complementary stick ends                 5’ Overhangs       Ligase is used to seal the phosphodiester backbones between sector and insert  Molecular cloning step 2; Host cells take up and amplify recombinant DNA       Transformation- the process by which a cell or organisms takes up foreign DNA            In Ecoli, only 0.1% of cells will be transformed with plasmid            Selection: Only the cells with plasmid will grow on media with ampicillin            Each cell multiples to produce millions of genetically identical cells, each with a recombinant plasmid  Libraries are collections of cloned fragments       Genomic Library: long-lived collection of cellular ones that contains copies of every sequence in the whole genome inserted into a suitable vector            Each colony contains a different recombinant plasmid, each with a part of the human genome Sanger sequencing uses DNA pol to make new DNA       DNA pol requires:            Template- a single strand of DNA to copy            Deoxyribonucleotide triphosphates (dATP, dCTP, dGTP, dTTP)            Primer- short single stranded DNA molecule that is complementary to the template  Recombinant plasmid is a good template for Sanger sequencing       Primer is designed to be complementary to plasmid sequence adjacent to the unknown insert sequence       Template and primer interact through hybridization       DNA fragments include the primer and nucleotides complementary to the unknown DNA       The DNA fragments are a nested array- they each differ in length from the proceeding and succeeding fragment by one nucleotide  Incorporation of a ddNTP terminates DNA synthesis       ddNTPs lack a 3’ OH   Nested fragment are separate by side using electrophoresis       A special gel can separate DNA fragment that differ in size by only one nucleotide       Smaller DNA fragments migrate quickly and appear at the bottom of the gel  DNA sequence trace and inferred DNA sequence from automated Sanger sequencing       Computer reads of sequence complementary to the template strand       Sequence is read from left to right (5’ to 3’ synthesis from primer)       Ambiguity in sequence is recorded as “N”  We are reading the complement! It is the complement of what is actually being sequenced  Human Genome Project began using the hierarchical strategy       Construct BAC genomic library       Identify sets of overlapping BAC cones       Shear DNA from each BAC separately to make smaller clones       Sequence DNA       Assemble sequences based on overlap  Celery developed the whole genome shotgun strategy for genome sequencing       Shear genomic DNA to make shotgun (uncharacterized clones)       Sequence DNA       Assemble sequences based on overlap       The whole genome shotgun approach can be highly automated  Each shotgun clone was partially sequenced from both ends       Paris of sequence give spatial information            Two ends of a 200kb insert are 200kb apart in the genome  Shotgun strategy helps overcome problems due to receptive DNA  Finding a gene in the genomic sequence: A long open reading frame may be part of a protein-coding exon       Dna can be read in six reading frames       An open reading frame is a reading frame uninterrupted by stop codons Species relatedness and genome conservation between H.sapiens and other vertebrates      Branch points represent a series of nested common ancestors       DNA sequence that are conserved in highly divergent species may be part of a genes       The human and zebrafish genomes are only 2% conserved       Within protein-coding sequence, the conservation is 82%  Cross species homology can discoed using a computerized visualization tool  Locating transcribed regions is a direct method of finding genes       mRNAs are not easily sequenced            Too rare to purify            Sequencing technology not widely available       mRNA can be made into cDNA for sequencing            Retroviruses have RNA genomes            They use reverse transcriptase to copy RNA into cDNA  Converting RNA to cDNA   Long Poly(A) tail       mRNA digested with RNAse       3’ end of cDNA folds back and acts a primer for 2nd strand synthesis       In the present of dNTPs and DNA pol, the first cDNA strand acts as a template for synthesis of the second cDNA strand       Double stranded cDNA can be cloned into a plasmid  A comparison of genomic and cDNA libraries       Random v. Transcribed sequences                       A comparison of genomic and cDNA libraries   The arrangement of genes in the genome       The human genome has about 20,000 genes       The part of the genome corresponding to eons is the exome (part that is represented/ expressed in the mRNA)            Taking cDNA and sequencing it (they will look different depending on where it is from and stages)       Most of a genome is non-coding DNA:            Exome = about 2% (less material and where the proteins are encoded)            Introns            Centromeres, telomeres, transposable elements            Simple repeating sequences Neighboring gens can be transcribed in the same or opposite directions       Both chromosomal strands are the template strand for some genes  Templates will differ            GCC1 & PAX4: 3’ <— 5’           ARF5 & FSCN3: 5’ —> 3’  The genome continues distinct types of gene organization       Gene-rich regions            Chromosomal regions that have many more genes than expected from average gene density over entire genome            Example in human genome- class III region of major histocompatibility complex       Gene poor regions           Regions of > 1 Mb that have no identifiable genes            3% of human genome is comprised of gene deserts            Do they exist simply because the genes are hard to identify (big genes?)       Biological significance of gene-rich regions and gene deserts is not known Genomes undergo evolutionary change      Exons often encode protein domains- sequences of amino acids that fold into functional units      The approx. numbers of each domain in the genome are shown for each of the three species  Exon shuffling can create new genes      After exon shuffling, protein products have novel domain architectures                       Introns provide a space for evolution and provide some degree of irregularity  The genome contains gene families       Gene families are groups genes closely related in sequence and function             Pseudogenes look like gens, but do not function as genes       Duplication and Divergence!!  Gene family nomenclature       Orthologous genes: arose from the same gene in the common ancestor, usually retain same function (Alpha in human & chimp)       Paralogous genes: arise by duplication, often refers to members of a gene family (Alpha, Beta)                            Chromosomal rearrangements      Syntenic blocks: colored segments contain at least two genes whose order is conserved in the mouse genome            Chromosomal rearrangements: have moved the blocks to different places in the mouse genome  Combinatorial amplification at the DNA level results in greater complexity from fewer genes      Human T-cell receptor family            DNA rearrangement combines V, D, and J segments into a gene            Result is about 1000 different combinations                           Combinatorial strategies at the RNA level may lead to gene amplification and diversity       Example- three neurexin genes            Two alternative promoters, five sites for alternative splicing            Can generate 2000 different mRNAs  Repositories of sequence data      GenBank-            Database established by the NIH in 1982           Still the most widely used repository for sequence data       RefSeq-            Single, complete, annotated version of a species’ genome            Agreed upon standard for comparison            Maintained by the NCBI (  BLAST searches find homologous sequences       Basic Local Alignment Search Tool  Hemoglobin carries oxygen in the blood       Adult hemoglobin consists of four polypeptide chains            Two alpha globins           Two beta globins The composition of hemoglobin changes during development       Embryonic and fetal hemoglobins bind more tightly to oxygen to facilitate transfer of oxygen from the mother to the embryo or fetus      Adult hemoglobin binds oxygen less highly to allow delivery of oxygen to the organs   Thalassemia associated with alpha-globing deletions             NCBI: MUST USE FOR SEQUENCE       BLAST: Human DNA            Look for the gene information: RefSeq RNA                 Screenshot for question one and three can be the same. If sequence says splice variants       PubMed for additional publications       FlyBase (invertebrate)       ExPASy: compute pI/MW Short Hybridization probes can distinguish single-base mismatches       Hybridization of short ( < 40 bases) oligonucleotides to sample (target) DNAs (allele-specific hybridization)            If there is no mismatch between probe and target, hybrid will be stable at high temperature            If there is a mismatch between prove and target, hybrid will not be stable at high temperature                  Hybridization probes are used on microarrays for genotyping       Allele-specific oligonucleotides (ASO) are attached to a solid support (like a silicon chip)       Two oligonucleotides are shown here, but many can be put on one array  Genomic DNA used to probe the ASO chip (microarray)       Preparation of genomic DNA            Fragmented            Adapter attached            Amplified by PCR and denatured to make single stranded                 Fluorescent dye coupled to end of single-stranded DNA        Positional cloning: From DNA markers to disease-causing genes       Positional cloning: object is to identify disease causing genes by genetic linkage to polymorphic loci       Strategy:            Same as linkage analysis using two phenotypes, except one gene tracked by phenotype, the other by DNA genotype            Use microarrays to simultaneously analyze millions of two-point crosses, each one a test for linkage between a disease locus and a DNA marker  The steps involved in positional cloning       Region of interest narrowed by finding closely linked DNA markers       Candidate genes are located in the region of interest       Sequence and expression of candidate genes are determined in normal and diseased individuals  An example of positional cloning       Neurofibromatosis-            Autosomal, dominantly inherited            Causes proliferation of nerve tissue            Positional cloning example determines whether or not a SNP is linked to the neurofibromatosis gene            Generation III is the result of a testcross Large family pedigree used to locate the Huntington disease gene       Mapping of Huntington disease-            Detection of linkage between the DNA marker G8 and the HD locus            Segregation of the G8 DNA marker (four alleles - A, B, C, and D) in a large Venezuelan pedigree affected with HD  The Lod score is a statistical tool for studying linkage       used to determine if data are sufficient to conclude with confidence that a disease gene and a marker are linked  Genetic diseases can display allelic or locus heterogeneity       Allelic heterogeneity- disease caused by different mutations in the same gene            Compound heterozygote- individual with different mutant alleles of the same gene            Individuals with certain alleles may respond to drug treatment, while others do not       Locus heterogeneity- disease caused by mutation in one of two or more different genes  Genome sequencing is becoming routine       Sequencing an entire genome now costs as little at $1000      Sequencing the whole-exome (limited to expressed parts of the genome) is less expensive       High throughput or massively parallel sequencing is like Sanger sequencing with a few modifications            Indvidual DNA molecules are anchored in place            Each base is identified before the next one is added            Increased sensitivity eliminates need for cloning or PCR                 (video on Canvas)  Analyzing Genomic Variation  Genome sequencing reveals a sea of variation       Each individual differs at > 3 million locations from the RefSeq human genome       How can we tell which polymorphism causes a disease?            Transmission pattern            Predicted effect on protein function            Clues from other genome sequences  SNP patterns in a rare dominant trait       Expect heterozygous polymorphism       Common variants are poor disease candidates   Rare recessive trait       Expect affected individuals to be homozygotes or transheterozygotes  Pinpointing a disease gene requires a combination of approaches       CMT: Charcot-Marie-Tooth Neuropathy       The results of genome sequencing can appear ov


Buy Material

Are you sure you want to buy this material for

75 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."

Jennifer McGill UCSF Med School

"Selling my MCAT study guides and notes has been a great source of side revenue while I'm in school. Some months I'm making over $500! Plus, it makes me happy knowing that I'm helping future med students with their MCAT."

Jim McGreen Ohio University

"Knowing I can count on the Elite Notetaker in my class allows me to focus on what the professor is saying instead of just scribbling notes the whole time and falling behind."


"Their 'Elite Notetakers' are making over $1,200/month in sales by creating high quality content that helps their classmates in a time of need."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.