New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

Bio 105 Exam 1 Study Guide

Star Star Star Star Star
1 review
by: Alexandra Notetaker

Bio 105 Exam 1 Study Guide Biology 105

Alexandra Notetaker

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

These are questions based on notes and important materials covered in lectures
Principles of Biology
Brigitte Blackman
Study Guide
50 ?




Star Star Star Star Star
1 review
Star Star Star Star Star
"Eugh...this class is soo hard! I'm so glad that you'll be posting notes for this class"
Rosalind Blanda

Popular in Principles of Biology

Popular in Biological Sciences

This 4 page Study Guide was uploaded by Alexandra Notetaker on Thursday February 18, 2016. The Study Guide belongs to Biology 105 at Humboldt State University taught by Brigitte Blackman in Spring 2016. Since its upload, it has received 60 views. For similar materials see Principles of Biology in Biological Sciences at Humboldt State University.


Reviews for Bio 105 Exam 1 Study Guide

Star Star Star Star Star

Eugh...this class is soo hard! I'm so glad that you'll be posting notes for this class

-Rosalind Blanda


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 02/18/16
Define the terms: Life Biology Evolution Matter Adhesion Cohesion Buffers Acids Bases Isomers Glycositic linkages Lipids Fats Trans fats Phospholipids Peptide Bond Nucleoside Peroxisomes Cell Wall Extracellular Membrane Energy Carbon Dating Isotopes All the chemical bonds ions Van der waals Osmosis Osmoregulation Paramecium Macromolecule Dehydration Synthesis Fatty Acid Ester Linkage Steroid Cholesterol Tertiary Structure Quarternary Structure Cytoskeleton Concept Questions What are the similarities and differences between prokaryotes and eukaryotes? What are the components of life? What do we really know about science? What are the differences between a controlled experiment and a controlled study? Polar vs. Nonpolar Molecules Why does Water stick to stuff? What are the factors that stabilize the Earth’s temperature? Why is water such an odd molecule? Why is water a great solvent? What are the main differences between an animal and a plant cell? Why can carbon form such a diverse number of molecules? What are the three types of isomers? What are the seven functional groups and their properties? What are the 4 major macromolecules and where do we most commonly see them? What are Carbohydrates comprised of? Describe Monosaccharide nomenclature. Where is the Carboxyl Carbon in a monosaccharide? What is the difference between an alpha and beta glucose molecule? Draw it. How do you depict carbon chains in Amylose and Amylopectin What are the structural carbs? What are the types of Lipids and are they hydrophobic or hydrophilic? What are the two types of fatty acids and where do we commonly see them? What do Trans fats produce? Why are omega fatty acids important? What are the differences between an omega 3 and an omega 6 fatty acid? Describe a Phospholipid. Compare fatty acids and cholesterol in an arctic fish versus a tropical fish What are amino acids? How many different types are there? Draw a Peptide Bond. How are proteins structured? Where is the free/Carboxyl end on an amino chain? What is the cause of Sickle Cell Disease? Write everything you know about nucleic acids. What are the types of RNA and what to they do? Where is the 5’ and the 3’ end on a nucleic acid? How is the double helix of DNA held together? Code the following sequence for DNA and RNA: 5’ GAGCCATGCATTATCTAGATTAA 3’ What are the nucleotide proteins in the previous sequence? What is the difference between DNA and RNA? Draw the phosphate group in a protein Draw a cell and label the parts. What are the main differences between Prokaryotic and Eukaryotic cells What do all cells share? What limits cell size? Why are bacteria small? Describe endomembranes in bacteria. What are the semi-autonomous cells and what are the theories of how they came to be? Draw and label all the parts of a mitochondrion What are the components of a cytoskeleton? What is the difference between flagella and cilia? Draw a microtubule doublet. What makes up a microfilament? What is an intermediate filament? What are the different types of cell junctions and what do they do? State the function(s) Monosaccharide Disaccharide Polysaccharide Starch plant storage Rough and Smooth Endoplasmic Reticulum Mitochondria Golgi Apparatus Plasma Membrane Cytoplasm Cell Wall Chloroplasts Nucleolus Nuclear envelope Chromatin Ribosomes Vacuoles Lipids Fatty Acids Phospholipids Proteins Enzymatic Proteins Storage Proteins Hormonal Proteins Contractile and Motor Proteins Defensive Protein Transport Protein Receptor Protein Nucleus Microvili Cytoskeleton Microtubules Microfilaments Intermediate Filament


Buy Material

Are you sure you want to buy this material for

50 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Bentley McCaw University of Florida

"I was shooting for a perfect 4.0 GPA this semester. Having StudySoup as a study aid was critical to helping me achieve my goal...and I nailed it!"

Anthony Lee UC Santa Barbara

"I bought an awesome study guide, which helped me get an A in my Math 34B class this quarter!"

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."


"Their 'Elite Notetakers' are making over $1,200/month in sales by creating high quality content that helps their classmates in a time of need."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.