BIOL2140 Exam 3 Spring 2016 name:________________________________

What is octet rule?

BIOL2140

Genetics

Spring 2016

Exam 3

18% of your final grade

1. Put your name on each page of the exam in case pages  get separated.

2. Answer to the best of your ability.

3. Write legibly!!!

4. Unless otherwise stated, calculate using 2 decimal places. 5. You do not need to turn in this front page.

6. Cheating is not tolerated. Cheating, action(s) reasonably  perceived as cheating, or attempted cheating will  negatively affect your final course grade, and may be  referred to the appropriate dean or committee for further investigation, which may be recorded in your academic  file.  

What is hydrogen halide?

1

BIOL2140 Exam 3 Spring 2016 name:________________________________

1. Using the phylogenetic tree below, answer the following questions: Learning goal(s): Define terms associated with evolution and use  that knowledge to identify mechanisms of evolution in an example. -Calculate evolutionary relationships using a phylogenetic tree We also discuss several other topics like What are the mechanism for chlorination?

a. Which species is (are) most closely related to Panagrolaimomorpha?  (1 pt)

What is delocalized e?

Cephalobomorpha and Tylenchomorpha

b. Which species is the outgroup? (1 pt)

Plectida

c. The Dracunculoidea and Gnathostomatomorpha diverged following  the formation of a river in the middle of their territory. What type of  speciation would that represent? (1 pt)

Allopatric

d. Describe two pre-zygotic isolating mechanisms that could have  caused divergence in the worms discussed in part “c”. Briefly provide  details about how each could possibly arise. (4 pts) Don't forget about the age old question of What is the domain of the function?

Many possibilities here. Ecological, behavioral, temporal, mechanical,  and/or gametic with the appropriate details as to how they could have  occurred.

2. A chromosome (DEFGHIJ) has undergone a variety of mutations.  Name the type of mutation that led to the following chromosome  arrangements. (2 pts each)

2

BIOL2140 Exam 3 Spring 2016 name:________________________________

Learning goals: Determine types of chromosome mutations that  might give rise to specified genetic observations.

a. DEFGFGHIJ

tandem duplication

b. DFEGHIJ

paracentric inversion

c. DEFIHGJ

pericentric inversion

d. DEFGHJ

deletion

e. DEFGHDEFIJ

displaced duplication

3. A normal chromosome and its homolog carrying an inversion are  given below ( represents the centromere).

Learning goals: Predict the effect of inversions and translocations on  meiosis.

normal KLMNOPQ

inversion KNMLOPQ

a. What type of inversion is this? (1 pt)

paracentric

b. During meiosis, a crossover occurred between homologs in the  region between N and M (single cross-over) in an individual  heterozygous for the inversion. Fill in the table below with the  resulting chromosomes prior to metaphase and the fate of that  chromosome as meiosis completes. Don’t forget to indicate the  location of the centromeres! (6 pts)

Chromosome sequence

What happens to it?

KLMNOPQ

normal, OK

KLMNK

lost in meiosis

QPONMLOPQ

torn apart in  

meiosis

KNMLOPQ

OK, but inverted

If you want to learn more check out How do iq tests provide accurate measures of intelligence?

4. A translocation occurred between two chromosomes as shown below (N/T-normal/translocation, 1/2-chromosome 1/chromosome2): Learning goals: Predict the effect of inversions and translocations on meiosis.

N1 ABCDEFG

T1 ABCD789

N2 3456789

T2 3456EFG

a. What type of translocation is this? (2 pts)

3

BIOL2140 Exam 3 Spring 2016 name:________________________________

reciprocal translocation

b. Draw the chromosomes as they would line up during metaphase. (4 pts)

G G

F F

E E

ABCD- -6543

ABCD- -6543

7 7

8 8

9 9

c. What gametes would be produced by alternate segregation of  these gametes in meiosis? (4 pts)

Chromosomes composition in gametes

gamete 1

N1, N2

gamete 2

N1, N2

gamete 3

T1, T2

gamete 4

T1, T2

If you want to learn more check out What is human capital?

5. On the following diagram, label the 5’ and 3’ ends of the double stranded DNA, and the bases (hint: pay attention to the # of bonds) (also letter designations for base pairs are fine). The large O’s in the  drawing are phosphates, small O’s are oxygens, and dotted lines are  hydrogen bonds. (10 pts)

Learning goals: Describe the structure of DNA, including base pairing and the nature of interactions between bonds. Identify the 5’ and 3’  end of a nucleotide strand given structural information.

4

BIOL2140 Exam 3 Spring 2016 name:________________________________ If you want to learn more check out Identify the key elements of a customer­-driven marketing strategy.

Top- 5’-ACGT-3’

Bottom- 3’-TGCA-5’

6. What is the reverse complement of the DNA fragment 5’- GCGTTACATGGT-3’? (4 pts)

Learning goals: Calculate complementary DNA strand sequence and  write it in the 5’-3’ orientation.

5’-ACCATGTAACGC-3’

7. How many of each of the following does this double-stranded DNA  molecule have? (1 pt each)

Learning goals: Describe the structure of DNA, including base pairing and the nature of interactions between bonds.

5’ ATTCCTACCATAGGCAATGA 3’

3’ TAAGGATGGTATCCGTTACT 5’

a. hydrogen bonds 48

b. purines 20

c. phosphates 40

8. a. Is the structure below a DNA or an RNA nucleotide? (1 pt) DNA Learning goals: Differentiate between RNA and DNA.

b. Modify the structure above to convert it to the other type of  nucleotide. (2 pts) We also discuss several other topics like Exchange of equivalents is a theory of what?

Add the OH group in the right spot (2’ position)

5

BIOL2140 Exam 3 Spring 2016 name:________________________________

9. Identify two differences between mitochondria and chloroplasts. (1  pt)

Learning goals: Compare and contrast chloroplasts and mitochondria Several options here. M-All eukaryotes vs. C-plants, Larger genome in  C, C mutation rates are slower…

10. A phenotypically normal woman whose mother had a mitochondrial disease is planning a family. As her genetic counselor, what advice  would you give her regarding her chances of having an affected child  and why? (3 pts)

Learning goals: Briefly describe replication and inheritance of  organelles.

She could still have a child with the disease because mitochondrial  diseases are generally threshold diseases. She may not have had  enough damaged mitochondria to cause disease, but due to unequal  partitioning of cytoplasmic contents, her offspring could get enough  damaged mitochondria to cause disease phenotypes.

11. What base pair(s) is/are most likely modified by methylation in the  sequence below (clearly circle base pairs) (2 pts)

Learning goals: Identify sites of possible DNA methlyation in a  sequence.

5’ TGCATCGATGCACTGC 3’

3’ ACGTAGCTACGTGACG 5’

12. A drug that blocks the activity of prokaryotic DNA Pol I was added  to bacterial cells. What specific effect would that have on the cell? (2  pts)

Learning goals: Discuss properties of polymerases and predict the  consequences of a loss of activity in the polymerase.

RNA primers would not be replaced.

13. Answer the following questions about the diagram of DNA synthesis below: (3 pt each except for d)

Learning goals: -Identify components of replication, their function,  and the process they contribute to.

-Predict the consequence of a loss/inactivation of a component of  replication.

6

BIOL2140 Exam 3 Spring 2016 name:________________________________

a. What enzyme is located at (a) and what would happen to  synthesis if this gene had a mutation rendering it non-functional? Topoisomerase or gyrase-DNA would build coiled pressure due to  unwinding by the helicase and synthesis would pause or stop  because helicase would be unable to unwind any more.

b. Which enzyme is functioning at (b)? What would happen to  synthesis if this gene had a mutation rendering it non-functional? Helicase. DNA strands could not be separated and DNA synthesis would pause/stop.

c. What enzyme adds RNA nucleotides at (d)? What would happen  to synthesis if this gene had a mutation rendering it non functional?

Primase (or DNA pol alpha)-synthesis could not be initiated because  there would be no free 3’OH for DNA polymerase to use to begin  synthesis.

d. Label the strand that will form Okazaki fragments (1 pt). Accepted either here because helicase was on wrong strand. The bottom  one was the lagging strand based on the direction of synthesis.

14. A mutation in the replication licensing factor blocks geminin  binding. What specific effect will that have on the cell? (3 pts) Learning goals: Predict the consequence of a loss/inactivation of a  component of replication.

You would see unrestrained synthesis because licensing would not be  blocked .You would build up extra copies of a large portion of your  genome.  

15. Investigating a patient with an unknown disorder, you notice his  chromosomes have much shorter ends than you would anticipate for a  man his age. Provide at least one hypothesis for what might be  mutated in his cells and why you believe that might be the case. (4  pts)

Learning goals: Identify components of replication, their function,  and the process they contribute to.

Predict the consequence of a loss/inactivation of a component of  replication.

7

BIOL2140 Exam 3 Spring 2016 name:________________________________

A mutation in either telomerase or the telomere associated RNA gene.  Loss of either element would not enable his telomeres to lengthen at  the end of synthesis, leading to shorter telomeres (and thus  chromosomes) with every cell division.

16. If the sequence of a double-stranded DNA molecule is  

5’ CGATGCATGACTG 3’

3’ GCTACGTACTGAC 5’

and the template strand is the top strand, what is the sequence of the  RNA molecule encoded by this sequence (write it 5’ to 3’ and label the  ends)? (4 pts)

Learning goals: Identify coding (nontemplate) and template strands.  Predict RNA sequence given either strand.

5’-CAGUCAUGCAUCG-3’

17. What is the RNA sequence transcribed from the DNA shown below?  (3 pts)

Learning goals: Identify coding (nontemplate) and template strands.  Predict RNA sequence given either strand.

 promoter +1

5  G ′ TAACTATAATTGCGAACGATGCTAGCA 3′

     3  C ′ ATTGATATTAACGCTTGCTACGATCGT 5′

5’-GAUGCUAGCA-3’

18. The sequence in question 17 is from a bacterial cell. In this  sequence, the bolded, underlined letters were mutated from a T-A pair  to a G-C pair.  

Learning goals: Identify basic promoter elements in promoters and  predict the specific consequence to transcription if mutations occur.  Predict consequences to transcription of a loss or functional mutation  in elements involved in transcription.

a. What affect, if any, do you think this would have on transcription? (2 pts)

Nothing, it is outside of the -10 and -35 consensus sequences b. What binds to the promoter to help initiate transcription? (1 pt) sigma factor

c. What part of the transcription initation complex binds to the TATA box in the promoters of eukaryotes? (1 pt)

8

BIOL2140 Exam 3 Spring 2016 name:________________________________

TBP

19. What would be the impact of (2 pts each):  

Learning goals: Predict consequences to transcription of a loss or  functional mutation in elements involved in transcription.

a) a mutation that renders Rat1 non-functional in a eukaryotic cell?

RNA transcripts would be longer (sort of-the mRNA would not, but there would be a lot of sequence transcribed after the cleavage site…).  

b) mutating the sequence encoding the cleavage site of a eukaryotic  RNA transcript?

That particular gene would be larger because RAT1 would not bind.

20. The following sequence represents an intrinsic termination site in  bacteria (you are given the template sequence here). Identify the  elements required for termination and draw a diagram of the RNA that  will be transcribed from this DNA, including its nucleotide sequence  and any secondary structures that form.(6 pts)

Learning goals: Compare and contrast eukaryotic and prokaryotic  transcription.

-Predict consequences to transcription of a loss or functional mutation  in elements involved in transcription.

3’ ACGAGGCAGCTAGCACCAGCTAGCTGCCAAAAAAAAAGTCATG 5’ Stem loop A tract

G G

 U U

G C

C G

U A

A U

G C

C G

U A

G C

C G

9

BIOL2140 Exam 3 Spring 2016 name:________________________________

C G

 UGCU- -UU…  

10

BIOL2140 Exam 3 Spring 2016 name:________________________________

Bonus

1. Species I has 2n=6 and species II has 2n=14. What would the  expected chromosome numbers be in individual organisms with the  following chromosome mutations? (1 pt each)

Learning goals: Distinguish types of aneuploidy and polyploidy and  predict the consequences these have for mating.

a. Autotretraploidy in species I.

12

b. Tetrasomy in species II.

16

c. Monosomy in species I.

5

d. Allotetraploidy including species I and II.

20, 16, 24

e. Allotriploidy including species I and II.

13, 17

2. Determine the consensus for the sequences shown below (use the  degenerate nucleotide table on page 1): (5 pts)

Learning goals: -Develop a consensus sequence from aligned  sequences.

sequence 1   A G C T T A G C T G

sequence 2   C C C T C G G C T G

sequence 3   A G C A C C G T T A

sequence 4   A G C T T T G C A C

sequence 5   A G C A C A T G A G

sequence 6   G T C A T C T C A G

             A G C W Y N G C W G

11