New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

Questions, answers and summary of main ideas for Pop Gen Test 1

by: Marina Notetaker

Questions, answers and summary of main ideas for Pop Gen Test 1 BIO 6143

Marketplace > Mississippi State University > BIO 6143 > Questions answers and summary of main ideas for Pop Gen Test 1
Marina Notetaker
GPA 4.0

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

This study guide include more than 40 questions that are likely to be on the test. Include definitions, pop frequency exercises, interpretation of graphs and sequences. Followed by answers and extr...
Population Genetics
Brian Counterman
Study Guide
50 ?




Popular in Population Genetics

Popular in Department

This 13 page Study Guide was uploaded by Marina Notetaker on Wednesday September 7, 2016. The Study Guide belongs to BIO 6143 at Mississippi State University taught by Brian Counterman in Fall 2016. Since its upload, it has received 41 views.


Reviews for Questions, answers and summary of main ideas for Pop Gen Test 1


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 09/07/16
STUDY GUIDE – TEST 1 – POPULATION GENETICS The following questions are to test your knowledge for the test. The test is really long; you will write a lot on the lest! Basically, you have some questions involving basic maths and concepts, interpretative graphs and definitions. I tried to point out to questions in which Dr Counterman said in class he would probably ask about. In the same way, the questions involve more than 90% of this first block, so if you put all together, the answers will be a summary of everything he said in class. Answers at the end of all questions. Total of questions: more than 40 main questions (not counting a,b,c, etc) Good luck! 1) What is the central dogma? 2) a. What is mutation? How can we calculate the mutation rate? b. Which type of cells mutations can happen? Which one is important for population genetics? c. If one individual presents 20 genomic differences in a specific locus when comparing to another individual from same species, how many generations it took to this happen? 3) Give definitions to the following terms: a. Genome b. Gene c. Exon d. Intron e. Locus f. SNP g. Allele h. Polymorphism i. Genotype j. Haplotype k. Phenotype l. Fitness m. Relative frequency n. Frequency distribution o. Significance difference 4) What is quantitative trait? How it can be classified? 5) Which factors that adding together will likely to give the phenotypic variation within a population? 6) Given the following sequence of a specific locus on the genome, find and mark on the regions where is (a) SNP (b) alleles (c) haplotype. Individual 1: …ATTGCTGAATTGTGTGTACTG… …TAACGACTTAACACACATGAC… Individual 2: …ATTGCTGAATGGTGTGTACTG… …TAACGACTTACCACACATGAC… 7) The following graph is a result of a research that measured the height of sons and fathers. By looking at the graph answer the following questions: a. How can we estimate a genetic component as height? b. What type of trait is given? c. Byhavingastraight forwardincreasingline,what it cantell us about this trait? 8) The following graph gives the measurement of people with lactose intolerance before 1850 and after 2010 in a population of south American Indian tribe. a. Indicates what the axis x and y measure. b. What happened in this population? c. Draw the mean trait of each population. 9) The following picture is a family pedigree. Blue represents individuals that present a mutation in a specific gene. Squares are males and circles are females. a. How many generations this pedigree has? b. In the first generation, for a single chromosome how many types of gametes you can have? c. When a mutation is generated in the first generation, how many possible phenotypes you can have on the second generation? d. How mutations can disappear at third generation and on? Why it does not happen in this case? 10) The following picture indicates allelic history. a. What the colors indicates? b. How many types of alleles are found on species C at the present time? c. Circulate the MRCA from the 2 species. What MRCA means? d. What the arrow on the left indicates? e. What is the theory in which MRCA is based on? What are its assumptions? What are its uses? 11)The following picture shows the allele frequency over time in a population. a. What happened with the allele represented bythe purple line at the end of 200 generations? Give the definition. b. What happened with the other alleles at the end of 200 generations? Give the definition. c. What would be possible causes to these changings in allele frequency? d. What is the term that explains these changings in allele frequency? e. What are the best models that can simulate and explain these changings in allele frequency? 12)What are the main consequences that mutations can cause? 13)What often cause miscarriage? Is that easy to diagnose? 14) What are the factors that influence a genetic variance to be persisted or perished? 15) What are the basic assumptions of the Hardy-Weinberg Equilibrium (HWE)? 16)What are the main models that explain evolution? 17) MRD1mutation is amutation that occursin shepherdpure-breed dogs causedbya4bp deletion at theMDR1 gene. The consequence is the production of a truncate protein known as p-glycoprotein (P-gp). Normal fully functional P-gp is responsible for pumping out of tissues most of chemicals and drugs, increasing the drug resistance of the body. Mutation in both alleles of the gene cause susceptibility to drug intoxication and even death in dogs treated by Ivermectin (drug often used for treating parasites). A Collie breeder have scanned their animals. The colors indicate: blue = normal homozygous (PP), red = mutant homozygous (pp) and green =heterozygous (Pp). If dogs are mating at random, noselectionoccurs,population sizekeepconstant, answer the following questions. a. What is the allele frequency? b. What is the genotypic frequency? c. What is the proportion of carriers in the kennel? d. What is the proportion of affected puppies on the next generation? And carriers? 18)What are the main assumptions from the molecular clock? Who was the first person that described it? What it allows to analyze? In other words, what is that used for? 19)Who was the first researcher that studied molecular clock? What was the study about? 20)How can we determine divergence time? 21)A study analyzing different sequences of DNA found the following result. Doberman: GTAGGTTCAA Rottweiler: GTAGGCTCAA Poodle: GTTGGTACAT a. Supposing that mutation rate in dogs is 0.001. What was the divergence time (unit of years) between Rottweiler and Poodle? b. Supposing that the common ancestor between Doberman and Rottweiler lived 100 years ago, what is the mutation rate? c. How would the Q matrix look like? And the neighbor-joining tree? 22) Considering the following DNA hybridization study, in which b =31.8, b = 4 and b = 058 and the most common ancestor among all samples lived 15 mya. Calculate: a. How does DNA hybridization work? b. When was the divergence time between Pan and Pongo? c. What is the mutation rate? 23)What are the non-genetic data that proves humans are primates? 24)What are the genetic data (so far seen in the course) that proves humans are primates? 25)What is the oldest primate discovered? How old? 26)What is the oldest modern human fossil? How old? 27)What is the oldest extant primate fossil? How old? 28)What is the possible origin of humans (location)? 29)What were the samples used by Chen & Li (2001)? 30)What type of markers we have in an autosomal chromosome? 31)What were the main analysis that Chen & Li (2001) do? What they were trying to answer? 32)What were the main conclusions Chen & Li (2001) have? 33)Draw a tree that have τ locus and τ species and define each of one. Also define τ genome. 34)What were the samples used by Patterson et al (2006)? 35) What made Patterson et al (2006) study different com Chen & Li (2001)? 36)What were the main analysis that Patterson et al (2006) do? What they were trying to answer? 37)What were the possible reasons that studies involving divergence time could have gotten a wrong estimation time? 38)What were the main conclusions Patterson et al (2006) have? 39)How Patterson et al (2006) developed their speciation model? What they used to calibrate the molecular clock? 40)What were the reasons for Patterson et al (2006) create a new speciation model? 41)What are the differences between the two main types of speciation model? How can we test which one fits better with the available data? 42)What were the odds about the X chromosome? How can it be explained? 43)Why α would be more similar between human and chimpanzee but not between human and gorilla? 44)a. What is linkage disequilibrium? b. which factors can increase D? c. which factors can decrease D? d. what are the uses of LD studies? STUDY GUIDE 1 - ANSWERES – POPULATION GENETICS Any concerns and doubts about the material contact me: 1. The central dogma is how the genetic information containing on DNA sequences can generate a phenotype. In other words, how genotype ends up characterizing phenotype. So, the basic idea is that DNA is transcribed in RNA byRNA polymerase. Then the messenger RNA pass through some changings (post transcriptional changes, such as slicing), is transported to the cytoplasm and is translated into proteins by ribosomes. 2. a. General definition is any change in the DNA sequence. The frequency varies depending on replication error rates. DNA polymerase has an error rate of 1 nucleotide every 10 nucleotides. Formula is: DNA replication error rate / size of genome. Other way to see the formula: total of duplications/ total base pairs generated b. It can occur in somatic (2n – diploid) and gamete (n – haploid) cells. Population genetics refers to gametes because it’s the one that will have the genetic information that will pass through generations. c. In theory, the number of differences between 2 genomes is equally to the number of generations, once two individualssharesamecommonancestor. Inotherwords,thenumberofdifferencesbetweentwogenomesreflects the number of meiotic events. So that, it would be expected that 20 generations happened. 3. a. All of the genetic information or hereditary material in an organism. It can be either nuclear or non- nuclear genome (mitochondrial). b. Evolutionarily, it is a unit of hereditary. Classically, it is the sequence of DNA that encodes for a protein/phenotype. Formed by introns and exons. Remind that it has different concepts depending on the field. So, in the molecular field, it is defined as an open reading frame associated with regulatory elements. c. Nucleic acid sequence that represents the mature RNA spliced (on eukaryotes). It’s the coding gene. d. Any nucleic acid sequence within a gene that is removed from the final mature RNA. It is known as non-coding gene. Some have special functions as regulating the genomic expression. e. Specific place at chromosome where a genetic element is located. It is a region on the gene. It can be only a base pair (bp) or a group of them. One locus can have different alleles. f. Single nucleotide polymorphisms are specific sites on the genome in which more than one possible base pair can be found. It will originate different genotypes within the population. g. It is a form of gene that exists in a specific locus. They are changings on a specific locus that differ two individuals. h. Multiple forms of an allele within a population. i. Specific allelic composition of a cell. j. Single genome copy. It is based on the allele. k. It is the manifestation of a specific genotype. Also associated to other variables, such as environment. l. It is the ability of an individual to propagate its genes. Phenotypes rely on fitness. m. The proportion of occurrence of a specific variant in a population. ALWAYS ranges from 0 to 1. n. Frequency of the variants in a population set. Usually it forms a normal distribution. o. It is when the difference between samples or groups of samples is more or less than expected bychange. 4) Phenotype can be characterized by quantitative trait and discontinuous trait. Quantitative trait is the measurement of a phenotypic trait. It can be classified as continuous (weight, height), meristic (bristle number in Drosophila) or discrete with continuous liability (susceptibility to diseases). Discontinuous trait are the ones that does not form a normal distribution, such as sex; it is not measured by different levels, it is either ‘yes’ or ‘no’. 5) Phenotype can be a result in variations in (a) any additive variation (b) dominance of an allele over another (c) epistasis which is how one gene will influence to the other gene to be expressed (d) environment. 6) Haplotype Individual 1: …ATTGCTGAATTGTGTGTACTG… …TAACGACTTAACACACATGAC… Allele 1 Individual 2: …ATTGCTGAATGGTGTGTACTG… Allele 2 …TAACGACTTACCACACATGAC… SNP 7) a. Estimation of a genetic component can be given by calculating the covariation of the parental and offspring trait (cov of x,y) and then dividing by the variation of the offspring. This resulting variation will give you the heritability of a trait. b. It is a continuous quantitative trait. c. The straight line shows that a relationship between the genetic component of parents (fathers) and offspring (sons). Increasing straight forward line means a positive correlation between parental and offspring characteristics. In other words, as higher as the height of a parent can be, higher it will be its offspring, because they are positively or directly correlated. 8) a. At this graph x = time, in which, x1 = 1850, when the original population had that average (mean) on this particular trait and x2= 2010. Y represents the frequency of gene that gives a specific trait (lactose intolerance). µ2 b. Over time this population suffered a selection. The µ1 selection pressure (arrow), selected individuals that in the original population had more extreme response to the trait. So in the original population most of people had a mild lactose intolerance (trait). Extreme values on the left or to the right indicates people without lactose intolerance or extreme lactose intolerance. The data does not suggest which area would indicate these characteristics. But over time, for example, people without lactose tolerance (supposing they were on the extreme values on the right) were naturally selected originating a population in which the normal distribution is shifted to the right. c. µ1 = mean of original population (1850). µ2 = mean of selected population (2010) 9) a. 3 generations. b. 4 types of gametes, 2 coming from the male (XY) and 2 from the female (XX). c. Second generation you can have 3 phenotypes instead of 2 initial phenotypes. d. At third generation and on, mutations can undergo recombination and disappear on next generations. However, on this case it doesn’t disappear because the mutation is probably related to the sex (X). More likely to be a recessive male disease, in which XX = normal female, Xx = heterozygous female, xx = sick/ mutated female, YX = normal male and Yx = sick/ mutated male. Because the mutation jumped one generation, the female on the first generation was XX, while male was Yx. Just an observation about Y, it does not recombine/ crossing over, so once it has a mutation, it comes through generations. That’s why usually mutations on Y chromosome reduce fitness. 10) a. each color indicates one type of allele b. two (one is lost, from the ancestral allele) c. MRCA = most recent common ancestor. It can be found by tracing back the alleles until the common point. d. Time, from the past to the present. e. MRCA is part of the coalescent process. The coalescent theory says that you can trace backwards in time and identify events in the past since MRCA appeared. The main assumptions are no recombination event occurs, random mating, no selection. You can only trace backwards by looking at genetic differences (variation). By coalescent theory you can applystatistical methods to calculate: mutation rate, age of MRCA, recombination rate, ancestral population size and migration rate. 11) a. Allele undergo fixation. Fixation or substitution happens when a mutation turns to be part of the survived group. It means that after fixation all population have same allele. No polymorphisms are found within this population, but can be found between different populations. Usually, different lineages accumulate different substitutions. Within human population there is no fixed allele, but it does between human and chimpanzees. So fixation can be found in speciation events. b. Other alleles got lost in the population. c. Some causes for fixation or loss of alleles include: selection, small population, mating choices (sexual selection), allele with effect on fitness. Note: small populations are more predispose to have loss of alleles or fixation over time. d. Genetic Drift is the change in the frequency of a gene variant (allele) in a population due to random sampling of organisms. Genetic drift can be simulated by statistical methods and computer programs. e. Two main models are used to simulate allele frequencies over time in a population: Wright & Fisher model (WF) and Moran model. Both have same assumptions as Hardy-Weinberg Equilibrium. * WF is the most used and known. It will find the expected patterns of the allele frequency and the number of generations to an allele become fixed or lost. This model does not account for mutation, recombination, selection, changings in population size, non-overlapping populations. However, it assumes that mutation occurs in a constant rate. * Moran model is less popular. However, allows generations to overlap. 12) Mutations can effect on: - Structure: causing physical change on DNA molecule. It includes from SNP to large changes on DNA sequence, such as deletion, duplication, insertion, inversion and translocation. - Function: it can either can loss or gain of a gene function. Moreover, it can be lethal or back mutation. Back mutations are the ones that are undone after some generations, also known as homoplaizia. - Protein: it can affect the amino acid code. In this case it can be missense (change amino acid at particular codon), nonsense (gives a premature stop codon) or frameshift (changes all reading frame). General classification for mutations on a protein is synonymous mutations (change codon but not the amino acid) and nonsynonymous mutations (change codon and final amino acid). - Fitness: mutations can increase survivorship or not. So, can be classified as deleterious (negative effect on fitness, most of mutations are slightly deleterious), neutral (no effect) and adaptive (fitness advantage). 13) Miscarriages are often caused bylethal or deleterious mutations that occurs before born and are “against life”. Really difficult to diagnose but it is estimate that approximately 50% of fertilization end up on miscarriages that are not even perceptible. 14) Factors that are responsible for genetic variation includes: - frequency of the genetic variant - size of the population - relative fitness of the genetic variant - effect of the variant on mating choice 15) HWE assumptions include: - population size is large and constant - alleles have no effect on fitness - random mating choice - no migration 16) Two main models of evolution: neutral model and selectionist model. CHARACTERISTIC NEUTRAL MODEL SELECTION MODEL SAMPLING random Not random. Based on relative fitness of a genotype MUTATIONS Nearly neutral. Mutations are Deleterious mostly harmless. Most of mutations are slightly deleterious ADAPTION Occurs through new novel of Occurs in big steps followed by combinations of genetic variants changes of small effects with small effects FIXATION Few mutations are fixed by Fixation occurs due to selection selection 17) a. Allele frequency: P = 32/50 = 64% and p = 18/50 = 36% b. Genotype frequency: PP = 12/25 = 48%, Pp = 8/25 = 32% and pp = 5/25 = 20% c. Carriers in the kennel 0.32. d. Puppies affected will be p = (0.36) = 0.1296. Proportion of carries on next generation will be 2Pp = 2.(0.36).(0.64) = 0.46. 18) Molecular clock is a method that allows estimate the time that mutations or substitutions occurred based on the number of genetic differences between samples/ individuals. It can be used to estimate when the MRCA existed. First described by Kimura (1962). The assumptions are: - mutation rate is constant over time - mutation rate is equal among lineages, so it is equal for two branches of a genetic tree 19) First research published using molecular clock was written by Zuckerhandl & Pauling (1965), in which they measured protein differences between humans and other animals. The number of differences (genetic data) was positively correlated to the age of first fossils from these animals (non-genetic data). 20) Divergence time can be determined by following these steps: - sequence the genome - count the number of differences between genomes from different individuals - calibrate your molecular clock by mutation rate - apply the formula D = 2Tµ, in which D = number of differences, T = number of generations (usually years), µ = mutation rate 21) a. D = 0.4(4/10). So, 0.4 = 2.T.(0.001). The divergence time occurred 200 years ago. b. So, 0.1 = 2.T.(100). The mutation rate is 0.0005. c. Q matrix Rottweiler Doberman Poodle Rottweiler Rottweiler - - - Doberman -10 - - Doberman Poodle -40 -30 - Poodle 22) a. DNA hybridization is one of the ways to measure genetic distance. It takes DNA samples from different individuals and denature it. Then part of the single stranded DNA sample from each individual is mixed together with the other individual in a separate tube. Then you measure the amount of time that takes to single stranded DNAs from same individual to anneal again and compare to the time the single stranded DNA from different individualstaketoanneal.Asmoredifferences youhavebetweensequences,longerwillbethetimeforannealing. b. First you need to calculate the mutation rate, then the divergence time. D = 2. (1.8) = 3.6 (length of both branches together). So, 3.6 = 2.(15mya).µ. Then, µ = 0.12. Once D pan/pongo 2, you can apply the formula 2=2.T.(0.12), then T = 8.3mya. Divergence time between pan and pongo is 8.3 mya. c. Mutation rate is 0.12 23) Non genetic data includes: - similar vertebra structure - similar stature - similar hands and feet - similar skull, teeth structure - similar immune system - big toes The hypothesis is that phenotypic similarities reflect genotypic similarities. So, as similar we are to a primate, more genetically close we are and more likely to share same common ancestor. 24) Genetic data includes: - protein similarities by Zuckerkandl & Pauling - DNA hybridization study - Chen & Li, 2001 25) Pleisiadapis, 55-58 million years ago 26) Idaltu, 195,000 years ago (found in Africa) 27) Orangutan, 12-16 million years ago – used for calibration of molecular clock, because you can collect blood samples / DNA samples from living Orangutan and compare to human. Old DNA fossil is too much degraded to use as calibration. 28) Probably from Africa because it is where the great apes are found since million years ago. Moreover, most of the hominids were found in Africa and by phenotypic similarities they are more closely related to modern human than great apes. After divergence of human species, human migrated and spread around the world. 29) Chen & Li (2001) samples include: - DNA sample from 4 species: 1 orangutan, 1 chimpanzee, 1 gorilla and 1 human: analyzed 53 autosomal loci ~24kb - GeneBank data: more 3 autosomal chromosomes (~115kb), 2 loci in X chromosome (~24kg), 1 loci in Y chromosome (~4.7kg) 30) Type of markers in a chromosome: - non-coding sequences or intergenic regions - coding regions which produce the amino acid sequence - introns - pseudogenes: also called false genes because they look like genes but the stop codon is at wrong place. Usually appear during duplication and recombination - Alus: also called jumping genes or transposon element. It is limited to primates, who have in high rate. Because of that it is very used in primate studies. Most of our genome is composed by these markers. Because it does specific insertions between human populations (lineages), it is used to find ancestry. 31) Chen & Li (2001) were trying to find the evolutionary relationship among hominids. For that they aligned sequences at each locus, identified polymorphisms and constructed SNP table. Their main analysis included: - variances between markers - variances between genes - variances between chromosomes 32) Chen & Li (2001) conclusions included: 1. For variances between markers: observed the frequency distribution of the markers and verified - different non-coding genes have different changing rate which break the molecular clock assumption - intros have a distribution shifted to the left which means that have fewer substitutions in the genome compared with intergenic noncoding regions. Intron change in less rate because it is inside the gene so the chance of ending up changing the exon is high and can be deleterious. - Alus was the most variable and divergent sequence. Highly polymorphic and count up to 10% of the whole human genome, in which ~0.5% are polymorphic, mainly at CpG islands. It is known that C -> T mutation rate occurs easier at CpG bases alone than in long sequence of CG. 2. For variances between genes: - analyzed genetic distances in 3 ways: rate of amino acid change, rate of nonsynonymous substitutions and differences between amino acid sequences. - found out that coding and non-coding regions have different mutation rate regardless of selection and neutrality assumptions - genes have less CpG islands than expected 3. Variances between chromosomes: - X is less divergent - Y most divergent * In sum they found differences across the chromosomes at several levels: between markers, between genes, between bases within a gene and between pattern of inheritance. 4. Neighbor-Joining Tree and human clade: - analyzed 53 loci and compared possible clades (human-chimp, human-gorilla, gorilla-chimp) - tree with the highest match (n=31) was human-chimpanzee clade. So we are closer to Chimps than other great apes. - distance between human-chimps was 1.24 (0.62/branch) 33) τ species: it is the event when species become isolated and reproduction dos not happen between them anymore. It is called complete speciation or time of speciation event τ locus τ locus: place where they start to accumulate genetic differences τ species between them (species) for a specific locus. It’s possible due to recombination. It’s called genomic divergence for specific locus. Τ genome: when comparing two different loci, it is the average of genomic divergence between τ locus 1 and τ locus 2. 34) Samples from Patterson et al (2006) included: - DNA samples from 5 different species: human, chimpanzee, gorilla, orangutan and macaque. - alignment of 5 species in 9.3Mb - alignment of 4 species (HCGM) in 18.3 Mb (excluded orangutan) 35) Differences of Patterson et al (2006) study: - included whole genome: increased genome sampling to ~ 20 million bp and characterized variance in genomic divergence time - developed a speciation model for human lineage based on genetic and non-genetic data - estimated dates for speciation model 36) They were trying to know the evolutionary relationship between humans and humanoids and how/when divergence happened. Main analysis of Patterson et al (2006) included: - identification and comparison of divergent sites - variation in autosomal divergence time - variation on X chromosome 37) Possible reasons that other studies could have had a wrong divergent time: - small data - ignored effects of recurrent mutations - ignored demography - failure to correct recurrent mutations that are twice higher on human-gorilla and chimpanzee-gorilla leading to overestimation of proportional genome in which human-chimpanzee are not close related 38) Patterson et al (2006) conclusions included: - analyzing divergent sites, they found that every 3,000 bp one divergent site exists among the species (A LOT!) - all variation in autosomal chromosome took around 4 mya (divergence time), which is a lot of divergence within them - variations on X chromosome showed that human-chimpanzee have low divergence, while gorilla had huge divergencecomparingwith humanand chimpanzee. Theyshowedthathuman-chimpanzeedivergenceis recently, so it is the cause of gorilla being more divergent. They estimate divergence time based on X chromosome in 7mya. 39)Basedon genomicdivergenceanddivergencetime,Pattersonetal(2006)estimatedamaximumand minimum speciation time. - maximum speciation time used orangutan fossil (17-20 mya) to calibrate the molecular clock. They found maximum divergence between human-chimpanzee was 5.4-6.3 mya - minimum speciation time used Toumai fossil (oldest fossil with humanoid aspect) to calibrate the molecular clock (6.5-7.4 mya). Because the existence of Toumai fossil before human-chimpanzee divergence, genetic and non-genetic data were in disagreement. Some possible explanations for that would be: - fossil record: Toumai age was incorrect and it could be younger than that - molecular clock with wrong calibration time For this reason, Patterson et al (2006) created the Complex model of speciation. 40) The complex speciation model by Patterson et al (2006) tried to explain: - weird pattern of X chromosome: less variation on human-chimpanzee and huge distance with gorilla - longtime of divergence on autosomal chromosome (4 mya) - Toumai fossil older than speciation time So they explained all these “issues” by a hybridization theory in which hominids and chimpanzees initially separated than exchange genes (hybridize) before the speciation event. 41) The major difference between both models is the gene flow, in which simplex model does not include hybridization. 1. Complex speciation model: - suggest hybridization between human and chimpanzee lineage after the initial speciation event. So, initial speciation event was followed by hybridization and then complete speciation - explains low divergence on X chromosome by hybridization - hybridization homogenized some genomic regions, such as X chromosome 2. Simplex speciation model - gives an alternative for hybridization which is α (male to female mutation rate) - tells that α has changed over primate evolution * To test which model fits better with the available data: using computer simulations based on HWE, you can test the allele frequencies after thousands and thousands of generations. When applying these simulations, complex model shows that afterthousands of generations chromosomeswouldhave minimal orlowdifferences (frequency distribution shifted to the left), while simplex model would show a normal distribution between human- chimpanzee differences. By doing simulations, no evidence of gene flow happened in autosomal data and so, the simplex model fits better. 42) In sum the problem found on X chromosome was that it was lesser divergent when compared to autosomal chromosomes. Patterson et al (2006) justified that by a gene flow between human and chimpanzees turning the X chromosome more similar between them. However, gene flow could not be proved yet and another explanation was given. Haldanes’ Rules tell that X chromosome accumulate more mutations that are deleterious, reduce fitness and are more predisposed to selection and by that, it becomes more uniform between populations. This rules are based on α, which is a mathematical formula. α ‘says’ that females and males have differences in number of meiotic events. While males represent 1/3 of X chromosome in a population and ½ of autosomes, females represent 2/3 of X chromosomes and ½ of autosomes. Males gain more mutations than females so they accumulate more mutations in the meiotic germline which leads to more mutations on autosomes. When α >> 1, leads to faster accumulation of mutations on autosomes relative to X chromosome. α is calculated by using the number of derived alleles (alleles only present in human chimpanzee lineage, for example). For human-chimpanzee α = 4-7, which is >>1. 43) Reasons are most based on the fact that humans have an intermediate character when comparing chimpanzee and gorilla, for example: - similarities on biological behavior: human is monandrous to polyandrous, while gorillas are monoandrous and chimpanzees are polyandrous. Gorilla and humans have more mating dominance than chimpanzees. - physiology on reproductive organs: chimpanzees have the hugest and largest production of sperm (~603x10 ), 6 so they can accumulate more mutations and more meiotic events occurs. Gorillas produce ~65x10 , so less 6 variance. Humans produce ~175x10 , so are more likely chimpanzees than gorillas. 44) a. LD is a non-random association of alleles at 2 or more loci, which can be measured on gamete frequencies. D is the gamete disequilibrium coefficient or measure of deviation from 2 locus equilibrium. b. Factor that can decrease: recombination. c. Factors that can increase: - drift - selection - migration d. LD can be used to map diseases across genome, as markers of blood lines (genealogy) and research about evolution.


Buy Material

Are you sure you want to buy this material for

50 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Bentley McCaw University of Florida

"I was shooting for a perfect 4.0 GPA this semester. Having StudySoup as a study aid was critical to helping me achieve my goal...and I nailed it!"

Allison Fischer University of Alabama

"I signed up to be an Elite Notetaker with 2 of my sorority sisters this semester. We just posted our notes weekly and were each making over $600 per month. I LOVE StudySoup!"

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."

Parker Thompson 500 Startups

"It's a great way for students to improve their educational experience and it seemed like a product that everybody wants, so all the people participating are winning."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.