New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

Exam 3 Study Guide

by: Luke Holden

Exam 3 Study Guide 3050

Marketplace > Clemson University > Biochemistry > 3050 > Exam 3 Study Guide
Luke Holden

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

This study guide was created by using Dr. Sri's review questions and objectives at the end of her power points. This includes explanations of those questions as well as a few sample questions that ...
Essential Elements of Biochemistry
Dr. Srikripa Chandrasekaran
Study Guide
Biochemistry 3050
50 ?




Popular in Essential Elements of Biochemistry

Popular in Biochemistry

This 11 page Study Guide was uploaded by Luke Holden on Sunday March 20, 2016. The Study Guide belongs to 3050 at Clemson University taught by Dr. Srikripa Chandrasekaran in Winter 2016. Since its upload, it has received 82 views. For similar materials see Essential Elements of Biochemistry in Biochemistry at Clemson University.

Similar to 3050 at Clemson


Reviews for Exam 3 Study Guide


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 03/20/16
BCHM EXAM 3 Study Guide Understand one­gene one­enzyme hypothesis  The hypothesis linked DNA to protein because every protein/enzyme needs one gene  (DNA that codes for a certain message). Gene and protein have an exclusive relationship  An example of this is for the synthesis of Arginine. This comes from a gene called arg. 1  that will make enzyme 1 and convert precursor to Ornithine which makes gene called  arg.2 that exclusively makes enzyme 2 that converts to Citrulline which makes gene arg.  3 that makes enzyme 3 and converts to Arg.  (see picture below) Will it  With extra  With extra  With extra  With extra Grow? Precursor Orinithine  Citrulline Arginine Wild Type Yes Yes Yes Yes Yes Arg, 1  No No Yes Yes Yes *mutation Arg. 2  No No No Yes Yes mutation Arg. 3  No No No No Yes mutation * If you see: Δ this means a mutation Understand significance of template and sense strand of DNA  The template strand is the strand of DNA that is transcribed and the sense strand of DNA  is the non­template strand. Since the mRNA is transcribed in the 5’ to 3’ direction, the  sense strand and the mRNA strand are identical except where there would be a T on the  sense strand there is now a U on the mRNA strand. Differentiate between pro and eukaryotic transcription  Prokaryotes­ promoter at ­35 & ­10 bp, Rho factor termination, lac and trp operon  Eukaryotes­ TATA (­25 bp) CAAT (­50) GC (­80) box, Enhancers/silencers that modify gene expression (thousands of bp downstream binds to an activator, loops entire DNA  and activator starts interacting with RNA polymerase and starts transcription),3 different  types of RNA polymerases, mRNA processing (5’ capping, 3’ poly A tail, splicing to  remove introns ) 1. Promoter sequences and interaction with RNA polymerases  A bunch of transcription factors (TF) bind to the TATA box (eukaryotic promoter  sequence) and attract RNA polymerase 2 (has to be phosphorylated) (eukaryotes) Initiation, Elongation and Termination of transcription in pro v/s eukaryotes  Transcription: o RNA polymerase choose a template strand (can pick either one) o Terms  Non template strand (sense)  RNA polymerase goes 5’3’! o Background information  Promoter­ region of nucleotides 20­200 bases upstream of the open  reading frame  Open reading Frame (ORF)­ This is the gene of interest that will be  transcribed  Promoter 10 bp before ORF in prokaryotes  Promoter 35 bp before ORF in eukaryotes  o When she gives us a DNA strand or mRNA strand she will always tell us which is which o Cheat code: THE NONTEMPLATE STRAND IS THE SAME THING AS THE  mRNA STRAND (EXCEPT “T” IS EXCCHANGED WITH“U”) RNA Polymerase­ The enzyme that reads DNA to synthesize RNA  Gene specific  Subunit Structure o Five poly peptides o Core enzyme: ααββ’(i) o o Sigma factor binds to the promoter and prevents DNA from going back into  heterochromatin  Promoter recognition  Binds to the core enzyme o Function of the subunits:  α­ promoter binding and assembly and regulation  β’­ DNA Binding  β­ Catalytic site (polymerization part) (The part that RNA is no for  (i)­ structural role , restores activity Sample Question: I will compare polymerases (DNA + RNA)  Prokaryotic Transcription o 3 Stages   Initiation and Elongation  RNA Poly binds to initiation  After 10bps = Elongation  Elongation is the process of transcribing mRNA.  Termination  Rho (ρ) factor­ ATP dependent helicase that stops transcription in  prokaryotes o ρ­ Attaches to mRNA and follows behind the RNA poly  o When RNA poly 3 stalls, the ρ factor can catch up and  essentially knock of the mRNA strand o This is kind of like you are swimming a way from a shark  and then catch a cramp…. You die  Eukaryotic Transcription RNA Polymerase Location Function I Nucleolus Transcribes large rRNA’s II  Nucleus Transcribes mRNA and  snRNA’s III Nucleus Transcribes tRNA 5s rRNAs  EUKARYOTIC POLYMERASE CANT INITIATE TRANSCRIPTION LIKE  PROKAROYTES!!!!! o Initiation  DON’T HAVE TO KNOW SPECIFIC TRNASCRIPTION FACTORS  Several transcription factors  TF’s bind to TATA box  Polymerase binds to the promoter  TFIH­ gets polymerase going via phosphorylation  Promoters: Promoter Consensus  Position Function Sequence TATA TATAAAA ­25 Indicates  transcription  Start Site CAAT GGCCAATCT ­50 Indicates Strong  promoter (High  Rate) GC Box GGGCGG ­80 Indicates House  Keeping gene  (All the Time  Enhancers­ Assist in the formation of the transcription complex  1000­2000 bp away  DNA will bend back on itself and attach IF to promoter   Gives the polymerase a sort of shove Compare and Contrast Prokaryotic and Eukaryotic Characteristic Prokaryotes Eukaryotic Polymerase RNA Poly: Can do it all! RNA poly I: large RNA rRNA RNA poly II: mRNA mRNA RNA poly III: tRNA small  tRNA tRNA Initiation Factors σ factor further binds to theTF IIs bind to the promoter promoter o Termination   RNA poly reaches the end of the terminator regions of DNA  Terminator: Poly A consensus sequences that code for hairpin structures  The hair pin forms kind of like Velcro where in latches on to itself and then it  falls off. mRNA splicing and significance  mRNA splicing takes place only in eukaryotes after termination. It is in the removal of  introns and the ligation of exons. This process occurs inside the nucleus and adds genetic  variation due to splicing at different locations.  What is the structure of a transcription factor? Know properties of the Transactivation domain  and DNA binding domain. Know examples and salient features of some of the common domains  in transcription factors. o DNA Binding Domain  Rich in α­ helices  Interact with the major groove with h bonds  Salt bridges and hydrophobic  interactions  Can bind to promoters and enhances o Active domain  Mainly acidic amino acids Bind to other factors, RNA poly II and activators How is the lac operon regulated in prokaryotes? Know how regulation is controlled in the  presence of various metabolites.  Prokaryotes prefer to use Glucose for energy but when glucose isn’t present, the  prokaryote will settle for making lactose to break down into glucose. When Glucose is  high in the prokaryote, the lac operon is therefore off and when glucose is low, the lac  operon is turned on.  +Glu +Glu ­Glu ­Glu +Lac ­Lac +Lac ­Lac Transcription  + Lac operon and use  ­ Lac operon  +++ Lac  ­/+ try to turn it on level some of lactose but  completely  operon  b/c no Glu but  not a lot b/c glucose is off “pumped up”  quickly turns off  present (1x) (50x) b/c no Lac Repressor Bound to allolactose Bound to  Bound to  Bound to operator operator allolactose CAP­cAMP No CAP­cAMP No CAP­ Increased  Increased CAP­ cAMP CAP­cAMP cAMP + Lactose ­Lactose Transcription No transcription Derepresesed Repressed Repressor is not bound  Repressor is bound to the operator + Glucose ­Glucose No cAMP= no cap Increase in adenylation No activation Increases cAMP= Increase in CAP What is the difference between lac and trp operons?  Operate inversely from each other  Trp­ operon is on when trp is absent from the prokaryote, repressor bound when there is  plenty of trp present   Lac­ operon is on when lac is present in the prokaryote, repressor bound when lactose is  absent Know the different modes of transcriptional regulation in eukaryotes­ (histone modification,  epigenetic regulation, regulation by activators, repressors, transcription factors and mediators)  Epigenetic Regulation (DNA modification) o Addition of methyl groups to cytosine (methylated)  Happens in CpG islands  It is associated with reduced transcription  Methylated DNA can change the way the DNA is read  Can be due to diet and stress o Histone modification  add acetyl to lysine or arginine  loosens DNA and enhances DNA Enhancers activators and Mediators o Activator binds to enhancer and stimulates transcription o Mediator proteins­ mediate interaction between enhancers and DNA o Transcription initiation complex: TF, Activators, RNA poly II and  mediator o LCR­ Locus Control Region  Example of enhancer region in DNA  Depressors and Silencers o Repressors bind to silencers o Inhibits DNA o You need to know this picture o Describe the synthesis (and specificity) of aminoacyl­tRNA’s. (tRNA Charging)  Synthesis: o two step reaction:  First an AA is attached to a phosphate group forming an anhydride bond  by using 2 ATP  Then, the AA is then attached to the tRNA by replacing the phosphate  with the tRNA as shown below: o Specificity:  one or more synthases per AA   tRNA/ anticodon recognition elements  Some even have proofreading ability How is post­transcriptional regulation of mRNA maintained in eukaryotes? What is alternate  splicing and how do miRNAs and siRNAs function?  Post transcriptional o Removal of introns o Splicesome Enzyme complex­ snRNP and snRNA’s (RNA interference)  can cut it in different ways  MicroRNA’s and siRNA’s­ small repeats that bind to dicer by forming a  hairpin and then degraded or block translation   Steps of RNA interference  The miRNA folds on itself  Dicer comes and makes it into smaller fragments  miRNA fragments come and bind to the protein complex  the protein complex and miRNA binds to the RNA  Then it is either degraded (miRNA) or blocks transcription  (siRNA) Summarize the main features or characteristics of the genetic code, including start & stop  codons.  Codon­ A three­base sequence of mRNA 1. Sequence codes for a specific amino acid 2. Some amino acids can be formed by more than one codon  Start codon­ AUG 1. Point where the genetic code is first read  Stop codon 1. Point where the genetic code is finished being read  Anticodon­ Three base sequence that pairs with codon on the tRNA 1. Both sequences are given in 5’ to 3’ direction. 2. Example: Codon UGC binds to anticodon GCA  What is meant by base pair “wobble” and why might it be beneficial?  On the third position of the codon (the 3’ position on the codon and the 5’ position on the anticodon), that bp can be a different nucleotide match as compared to the other ones.  This allows for the translation mutation s such as a nonsense or a silent mutations to be  avoided. This is because even if the codon is read incorrectly, the protein will be the  same. Name & describe the details in each of the three stages of protein synthesis, including the  structure & functions of ribosomes and any factors involved.  Prokaryotic translation: o Initiation: This is the first step when the mRNA strand arrives at the ribosome  Formation of the initiation complex  The shine­dalgarno sequence: this is a purine rich sequence  upstream from the AUG codon. Recognition of this sequence is  crucial and is recognized by the 16s rRNA strand. 1. Consensus sequence: AGGAGG  Sequence of events: 1. IF­1 and IF­ 3 bind to the 30 s subunit  IF­1 blocks the A site until the first tRNA is in  place  IF­3 blocks the 50s subunit from binding the 30s  subunit. 2. 30s subunit binds to the shine dalgarno sequence 3. 30s subunit slides in place over the AUG start codon  (5’3’) 4. Insure that the first AUG start codon is located 5. IF­2 with GTP binds to the 30s Asite 6. IF­1 is then displaced and the fMet­tRNA (ONLY PROK)  (Insert Picture) 7. GTP is hydrolyzed which makes IF­2 and 3 fall off 8. The 50s subunit then comes and binds the complex thus  creating the characteristic ribosome o Elongation:  The Ef­Tu protein carries the charged tRNA­s and then hyrolzes GTP to  attach it to the codon in the A site. GTP is then rehposphrylated and the  EF­tu is then reattached with a charged tRNA.  peptidyl transferase (in the large ribosomal subunit)then attahces the  growing polypeptide chain to the charged tRNA in the A site.  EF­G­GTP moves the ribosome in the 3’ direction which shifts the  tRNA’s over a site.  The energy released from the GTP causes the ribosome to change  conformation. o Termination:  The stop codon calls for the initiation factor which comes and bids to the  A site  This converts peptidyl transferase into hydrolyase which cuts the  polypeptide away from the tRNA and  Ribosome falls away o Multiple ribosomes bind to the same sequence of mRNA and forming polysomes  which amplify the protein. Describe & exemplify how some antibiotics function by impairing transcription and/or  translation.  Prokaryotes only: o Tetracycline: blocks the aminoacyl tRNA from binding to the a site o Chloamphenicol: blocks the peptidyl transferase on the ribosomes o Erythromycin: blocks the translocation of the ribosomes o Cordycepin­ cordycepin is similar to adenosine, some enzymes cannot  discriminate between the two. Therefore, it can participate in certain biochemical  reactions (for example, be incorporated into an RNA molecule, thus causing the  premature termination of its synthesis).   Eukaryotes only o α­ amanitin­ blocks transcription of mRNA by binding to RNA Poly II  ON HER POWERPOINT (LECTURE 13) WE ONLY HAVE TO KNOW THE ONES  THAT SHE BOXED! Identify the different type of mutations (missense, nonsense, silent, insertion and deletion)   Translation mutations: o Missense: This is where an incorrect Amino acid is inserted into the protein  sequence. This can be detrimental as it can influence mis­folding of the protein  and thus altering its function o Nonsense: This is a mutation where a stop codon is sequenced and causes early  termination of translation. Usually results in dysfunctional protein that is useless o  Silent: This typically occurs during the wobble hypothesis where the third  nucleotide of the codon is switched for another nucleotide. However, to our luck,  they code for the same protein and thus the protein goes on about its life.  You would not know these occur unless you looked at the genetic code.  Transcription mutations: o Frame shift mutations: can be an insertion or a deletion that cause the frame of  reading (codon) to be shifted over or back one  Insertion: This is when a n extra nucleotide is inserted into the mRNa  strand that cause the frame to be moved over in the 3’ direction.  Deletion: This is when a nucleotide is deleted and the frame is shifted over to the 5’ direction Given either sense, anti­sense or the m­RNA strand, identify the type of point mutation shown  Anti­Sense strand: 5’ ATGCCGATTACGGATTCCGGAAT  mRNA Stra:        3’ UACGGCUAAUCCCCUAAGGCCUUA o An insertion occurred Know the difference between transition and transversion mutation  Transition is when a bp change occurs where a purine is switched for a purine and a  pyrimidine is switched for a pyrimidine  Transversion­ This is a bp change that occurs where a purine is switched for a pyrimidine


Buy Material

Are you sure you want to buy this material for

50 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Jim McGreen Ohio University

"Knowing I can count on the Elite Notetaker in my class allows me to focus on what the professor is saying instead of just scribbling notes the whole time and falling behind."

Anthony Lee UC Santa Barbara

"I bought an awesome study guide, which helped me get an A in my Math 34B class this quarter!"

Jim McGreen Ohio University

"Knowing I can count on the Elite Notetaker in my class allows me to focus on what the professor is saying instead of just scribbling notes the whole time and falling behind."


"Their 'Elite Notetakers' are making over $1,200/month in sales by creating high quality content that helps their classmates in a time of need."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.