New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

Exam 2 Study Guide

Star Star Star Star
1 review
by: Sydney Diekmann

Exam 2 Study Guide Biol 2002

Sydney Diekmann
U of M
GPA 3.9

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

This study guide encompasses materials and concepts covered in class from week 5 until week 9. Concepts covered include: gene structure, expression, and regulation (lac gene), mitosis, meiosis, Men...
Foundations of Biology
Dr. Susan Wick, Dr. David Matthes
Study Guide
50 ?




Star Star Star Star
1 review
Star Star Star Star

Popular in Foundations of Biology

Popular in Biology

This 8 page Study Guide was uploaded by Sydney Diekmann on Monday November 2, 2015. The Study Guide belongs to Biol 2002 at University of Minnesota taught by Dr. Susan Wick, Dr. David Matthes in Fall 2015. Since its upload, it has received 101 views. For similar materials see Foundations of Biology in Biology at University of Minnesota.


Reviews for Exam 2 Study Guide

Star Star Star Star



Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 11/02/15
Study Guide for Exam 2: Concepts covered: gene structure and expression and regulation, mitosis, meiosis, Mendel’s principles, evolutionary processes, and genetic technology 1. Gene Structure, Expression, and Regulation  genes contain the instructions for making polypeptides of proteins  genes indirectly code for proteins through the process of transcription and translation and those processes are facilitated through mRNA (for eukaryotic organisms o group of three mRNA bases specifies a particular amino acid = codon  1 start codon (AUG), 3 potential stop codons (UAA, UAG, UGA) o genotype is determined by the sequence of DNA bases while phenotype is determined by the protein that the genotype produces mutation description types point single-base change during missence- cause change in the amino acid sequence mutation synthesis silent – does not cause change in the amino acid sequence frameshift – single addition/deletion mutation that throws the *either beneficial, neutral,sequence of codons of protein out and alters the meaning of or deleterious subsequent codons nonsense – codon that specifies an amino acid is changed to one that specifies a stop codon => early termination chromosome missing, extra, or irregularinversion – segments flipped or rejoined mutation portion of chromosomal translocation – segments become attached to a different DNA chromosome deletion – segment is lost duplication – additional copies of segment are present A. Gene Expression o most gene expression is triggered by specific signals from the environment and can be controlled in order to use resources efficiently control present in… description types transcriptional bacteria, avoid making RNAs for particular negative control – repressor binds to DNA eukaryotes enzymes (saves the most energy) and shuts down transcription positive control – activator binds to DNA *conserves the most resources and triggers transcription translational bacteria, prevents the mRNA from being eukaryotes translated into a protein post- bacteria, activation/deactivation of proteins activation – phosphorylation translational eukaryote by chemical modification deactivation – methylation *fastest response alternative splicing activation/deactivation by phosphorylation proteins marked by ubiquitin => destroyed chromatin eukaryotes condensed chromatin – no condensed – methylation remodeling expression decondensed chromatin – decondensed - acetylation expression *chromatin = DNA complex wrapped around histones to form nucleosomes packed into 30 nm fibers RNA eukaryotes primary RNA transcript -> mRNA microRNA binding results in destruction of processing mRNA/blockage of translation mRNA life eukaryotes mRNAs that remain in the cell span longer are translated more B. Regulatory Sequences and Proteins components description types effect on transcription promoter site in DNA where RNA depends on the polymerase binds to presence of initiate transcription activator or (sigma factor recruits repressor polymerase) promoter-proximal elements regulatory sequences near CAP binding site the promoter -25 and -10 boxes TATA box transcription factors regulatory proteins activators bind to enhancerincreases (CAP) sequences *production/activation repressors bind to silencerinhibits results in differential gensequences expression basal transcription factors (TATA-binding protein) DNA: CACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCC->CGGA RNA: CACCAUCGAAUGGCGCAAAACCUUUCGCGGUAUGGCAUGAUAGCGCCCGGA +2: T I E W R K T F R G M A * * R P E DNA: AGAGAGTCAATTCAGGGTGGTGAATATGAAACCAGTAACGTTATACGATGT RNA: AGAGAGUCAAUUCAGGGUGGUGAAUAUGAAACCAGUAACGUUAUACGAUGU +2: E S Q F R V V N M K P V T L Y D V DNA: GGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTA RNA: GGCACGACAGGUUUCCCGACUGGAAAGCGGGCAGUGAGCGCAACGCAAUUA +2: A R Q V S R L E S G Q * A Q R N * DNA: ATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTC RNA: AUGUGAGUUAGCUCACUCAUUAGGCACCCCAGGC<-UUUACACUUUAUGCUUC +2: C E L A H S L G T P G F T L Y A S DNA: CGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAA RNA: CGGCUCGUAUGUUGUGUGGAAUUGUGAGCGGAUAACAAUUUCACACAGGAA +2: G S Y V V W N C E R I T I S H R K DNA: ACAGCTATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGT RNA: ACAGCUAUGACCAUGAUUACGGAUUCACUGGCCGUCGUUUUACAACGUCGU +3: S Y D H D Y G F T G R R F T T S * +2: Q L * P * L R I H W P S F Y N V V +1: T A M T M I T D S L A V V L Q R R -25 and -10 boxes (attracts sigma to begin transcription) of the bacterial promotor -> start of transcription symbol on the DNA strand just before the first base in the transcript that the promoter will direct to be made. potential termination sequence at the end of the transcript (proteins terminate by hairpin folding) Strike out the RNA that will not be part of the transcript (e.g. AUCG) and the amino acids that will not be part of the protein Promoter region, 5’ UTR (5’ untranslated region between promoter region and the coding sequence that is transcribed but is not translated/doesn’t code for any amino acids), CDS (coding sequence)/ ORF (open reading frame), and 3’ UTR( 3’ untranslated region that is transcribed but is not translated/doesn’t code for any amino acids). DNA: GGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTA +3: H D R F P D W K A G S E R N A I N +2: A R Q V S R L E S G Q * A Q R N * +1: G T T G F P T G K R A V S A T Q L DNA: ATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTC +3: V S * L T H * A P Q A L H F M L P +2: C E L A H S L G T P G F T L Y A S +1: M * V S S L I R H P R L Y T L C F DNA: CGGCTCGTATGTTGTGTGG AATTGTGAGCGGATAACAATTTCACACAGGAA | +3: A R M L C G I V S G * Q F H T G N +2: G S Y V V W N C E R I T I S H R K +1: R L V C C V E L * A D N N F T Q E DNA: ACAGCTATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGT +3: S Y D H D Y G F T G R R F T T S * +2: Q L * P * L R I H W P S F Y N V V +1: T A M T M I T D S L A V V L Q R R C-terminus of the repressor protein encoded by lacI …LMQLARQVSRLESGQ N-terminus of beta-galactosidase encoded by lacZ MTMIDSLAVVLQRRDWEN… GTGAGNNNNCTCAC the CAP binding site GGCTTTACAC the -35 sequence of promoter TATGTTGT the -10 sequence of promoter (the TATA box) AATTGTNANCNGNTNACAATT = lac repressor binding site Start of transcription for( )ZYA | +1 Start of translation for lacZ (put a box around it) The 5’ UTR for the transcript of the lac operon 2. Mitosis  nuclear division that leads to the production of offspring genetically identical to the parent cell phase description G 1 checkpoint (will continue if cell size is adequate, nutrients are sufficient, social interphase signals are present, DNA is undamaged), provides cell with time to grow large enough to divide into two cells that will be normal in size and function S phase replication of DNA to prepare for cell division G 2 checkpoint (will continue if chromosomes have replicated successfully, DNA is undamaged, activated MPF is present), provides cell with time to grow large enough to divide into two cells that will be normal in size and function M phase M prophase chromosomes condense into two sister chromatids and spindle apparatus forms prometaphase nuclear envelope breaks down and microtubules contact chromosomes at kinetochores metaphase chromosomes migrate to the metaphase plate (the middle of the cell) anaphase sister chromatids are separated into daughter chromosomes and pulled apart to opposite sides of the cell by shortening microtubules telophase nuclear envelope re-forms, chromosomes decondense, cytokinesis begins  cancer occurs when cell-cycle checkpoints have failed o defects that make proteins required for cell growth active when they shouldn’t be o defects that prevent tumor suppressor genes from shutting down the cell cycle  loss of social control 3. Meiosis  nuclear division that leads to the halving of chromosome number (46 -> 23) and the production of gametes/haploid cells (sex cells that have one type of each chromosome) phase description additional info. early prophase I chromosomes condense, spindle apparatus homologous chromosomes are forms, nuclear envelope begins to break the same size and shape, carry down, pairing of homologs => bivalents the same genes, but may carry different alleles late prophase I chiasmata can be seen, crossing over chiasmata: crossover points occurs crossing over: chromosome meiosis I: exchange between two reduction chromatids division metaphase I migration of bivalents to metaphase plate metaphase plate: imaginary line in middle of the cell anaphase I homologs separate and begin moving to opposite poles of the spindle apparatus spindle apparatus attaches to the kinetochores located at the centromere of each chromosome telophase I and chromosomes move to opposite poles of results in 2 cells with 46 cytokinesis the spindle apparatus and the cytoplasm chromosomes divides prophase II spindle apparatus forms metaphase II chromosomes line up at the metaphase meiosis II plate anaphase II sister chromatids separate and begin moving to opposite poles of the spindle apparatus telophase II and chromosomes move to opposite poles of results in 4 cells with 23 cytokinesis the spindle apparatus and the cytoplasm chromosomes divides  advantages of meiosis/sexual reproduction o provides genetic diversity over asexual reproduction  separation/distribution of homologous chromosomes  crossing over (results in genetic recombination = appearance of new alleles)  independent assortment o genetically varied offspring => greater chance that some offspring will have advantageous combinations of alleles => better fitness o sexual reproduction are more likely to have offspring that lack deleterious alleles present in a parent  natural selection acts against deleterious alleles 4. Mendel’s Principles  types of hereditary inheritance (transmission of traits/characteristics from parent to offspring) o blended inheritance: parental traits blend together to form intermediate trait found in offspring o inheritance of acquired traits: traits present in parents are modified through use and passed on to their offspring in the modified form  types of crossing pure lines that differ in one trait o monohybrid cross: a mating between parents that each carry two different genetic determinants for the same trait  recessive traits are alleles that produce its phenotype only in the homozygous form  i.e. aa  dominant traits are alleles that produce its phenotype in heterozygous or homozygous form  i.e. Aa or AA o reciprocal cross: a mating where the mother’s phenotype in the initial cross is the father’s phenotype in the subsequent cross and vice versa  Mendel’s principles principle description so this means… explained by… particulate hereditary determinants maintain no blending occurs inheritance their integrity from generation to alleles are discrete entities generation principle of two members of each gene pair must each gamete contains one physical separation of segregation separate into different gamete cells allele of each gene alleles during anaphase of during the formation of haploid cells meiosis I independent the allele for one trait and the allele if the alleles for different assortment for the other trait originally present genes are located on in each parent would separate from different chromosomes, each other and be transmitted they assort independently independently of each other at meiosis I linkage tendency of particular alleles of sex-linked inheritance => different genes to be inherited do not assort together independently and are inherited together unless crossing over occurs between them multiple the existence of more than two the more alleles, the more allelism alleles of the same gene possible phenotypes dominance complete – dominant or recessive codominance – simultaneous expression of the phenotype associated with each allele in a heterozygote incomplete – heterozygotes that have phenotype that is between two different homozygous parents 5. Evolutionary Processes process description effect on fitness characteristics/types natural increases the frequency increases fitness directional – reduces variation selection of alleles that contribute stabilizing – reduces variation to reproductive success disruptive – increases variation in an environment balancing – maintains variation sexual – intrasexual vs. intersexual genetic drift causes allele can either increase or founder effect – establishment of new frequencies to change decrease fitness population randomly bottleneck – sudden reduction of population *most profound in small populations *can lead to loss/fixation of alleles gene flow individuals leave one can either increase or immigration – individuals coming into a population to join decrease fitness population another and breed emigration – individuals leaving a population *equalization of allele frequencies between source and recipient populations mutation modifies allele can either increase or point mutations – single base pair frequencies by decrease fitness chromosome-level – gene duplication introducing new alleles lacteral gene transfer – transfer between species *increases genetic diversity Hardy-Weinberg Model:  all of the alleles from all the gametes produced in each generation go into a single group called the gene pool and then combine at random to form offspring o if freq. of alleles A1 and A2 in a population are given by p and q, then the frequencies of genotypes A1A1, A1A2, and A2A2 are given by p , pq, and q respectively  allele frequencies: p + q = 1 2 2  genotype frequencies: p + pq + q = 1  assumptions o random mating  enforced by random picking of gametes from the gene pool  no inbreeding (increases homozygosity => inbreeding depression) o no natural selection  all members of parental generation survived and contributed equal numbers of gametes no matter their genotype o no genetic drift/random allele frequency changes o no gene flow  no new alleles were added or lost through immigration/emigration o no mutation 6. Genetic Technology technique description procedure basic recombinant insert functional copies of 1. reverse transcriptase to produce cDNA DNA tech. genes into bacteria through 2. use plasmids in cDNA cloning the use of a plasmid/vector => 3. use resctirction endonucleases and DNA ligase to increased production of cut/paste DNA targeted protein 4. transformation = cell takes up DNA from the environment into their genomes DNA library collection of DNA sequences probe = single stranded fragment that will bind to a which is inserted into a vector particular single-stranded complementary sequence in a mixture of DNA PCR replicates a specific sequence 1. solution contains template DNA, primers, Taq of DNA repeatedly polymerase, dNTPs 2. denaturing separates strands 3. primer annealing binds primers to template DNA 4. extension occurs when Taq polymerase uses dNTPs to synthesize complementary DNA strand starting at primers 5. cycle is repeated dideoxy ddNTPs, one for each 1. incubation of reaction mixture (contains dNTPs, few sequencing complementary base, ddNTPs, template DNA, primer for target sequence, DNA terminate DNA sequence and polymerase) length of DNA fragments 2. DNA synthesis occurs: each strand ends with a labeled determine sequence ddNTP (corresponding to a base on the template strand) 3. collect DNA strands that are produced 4. separate fragments via electrophoresis (shorter fragments travel faster) 5. read output on automated sequencing machine gene mapping location of genetic marker that almost always occurs in one form in the affected individual but only rarely in unaffected people gene therapy replacement/augmentation of 1. the sequence of the allele associated with the healthy defective copies of the gene phenotype must be known with normal alleles 2. a method must be available for introducing this allele into affected individuals and having it expressed in the correct tissues, in the correct amount, at the correct time 3. gene can be introduced by packing into viruses for transport


Buy Material

Are you sure you want to buy this material for

50 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Jim McGreen Ohio University

"Knowing I can count on the Elite Notetaker in my class allows me to focus on what the professor is saying instead of just scribbling notes the whole time and falling behind."

Kyle Maynard Purdue

"When you're taking detailed notes and trying to help everyone else out in the class, it really helps you learn and understand the I made $280 on my first study guide!"

Bentley McCaw University of Florida

"I was shooting for a perfect 4.0 GPA this semester. Having StudySoup as a study aid was critical to helping me achieve my goal...and I nailed it!"

Parker Thompson 500 Startups

"It's a great way for students to improve their educational experience and it seemed like a product that everybody wants, so all the people participating are winning."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.