New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

chapter 7 outline

by: Caitrín Hall

chapter 7 outline BIOL 1110

Caitrín Hall
GPA 3.9
Introduction to Botany
Bernard Goffinet

Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

These notes describe the points emphasized in class about chapter 7.
Introduction to Botany
Bernard Goffinet
Class Notes
Biology, botany, outline
25 ?




Popular in Introduction to Botany

Popular in Biology

This 4 page Class Notes was uploaded by Caitrín Hall on Tuesday January 26, 2016. The Class Notes belongs to BIOL 1110 at University of Connecticut taught by Bernard Goffinet in Summer 2015. Since its upload, it has received 15 views. For similar materials see Introduction to Botany in Biology at University of Connecticut.


Reviews for chapter 7 outline


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 01/26/16
DNA and RNA 71 DNA contains two nucleotide strands that wind about each other in a double helix All info that determines characteristics of cell is contained in genome made of DNA Differentiationspecialization rely on process whereby part of genome is expressed in speci c cells lnner and outer environment determine expression DNA is in chromosomes and histones proteins Chromosomes carry genes units of genetic info used for protein synthesis Nucleotides 5carbon sugar deoxyribose phosphate group one of four nitrogenous bases adenine guanine cytosine thymine o Adenine and guanine purines o Thymine and cytosine pyrimidines o Assembled into chain through covalent bonds between phosphate group of one nucleotide and sugar of the next Double helix two strands run in opposite directions one has deoxyribose base while other has phosphate group base held together by hydrogen bonds A amp T form 2 bonds while C amp G form 3 bonds 0 Strands are complementary 72 DNA replicates by separating its two strands and synthesizing two new complementary strands Each single strand can be used as template for another 1 DNA unwinds separate at speci c origins of replication done by helicases 2 Replication forks and bubbles appear because 0 Nucleotides added to 3 end of sequence 0 Each strand is copied in opposite direction 3 Enzyme DNA polymerase reads one strand and assembles complementary Semiconservative half of DNA is original molecule conserved other half is new Proofreading repairs errors in newly formed strand 0 Excision of damaged region by DNA repair nucleases 0 New portion is made by DNA polymerase using other strand as template 0 DNA ligase complete process by sealing remaining break in damaged strand Mutation error is not corrected change in DNA strand is transmitted to next generation can be random mistake damaged DNA before replication evolutionary 73 Genetic information is coded in DNA as groups of three nucleotides o 20 amino acids requires groups of three nucleotides triplets 0 Every triplet is a codon 74 Protein synthesis involves three forms of RNA in the cytoplasm 0 Proteins sequence of amino acids Protein synthesis 0 Step 1 transcription info is copied from DNA to mRNA using the same code of sequences of nucleotides 0 One strand is copied 0 Product mRNA messenger assembly requires enzyme RNA polymerase 0 RNA molecule has determined length and complementary sequence 0 A gene is a sequence of triplets that can be read and translated into AA amino acid sequence 0 lntrons short sequences that do not code for protein must be cut out by process of maturation o Exons code for proteins 0 mRNA formed in nucleus detaches from DNA and moves to cytoplasm to join with ribosomes contain rRNA proteins 0 Step 2 translation tRNA molecules bring amino acids to ribosomes where protein is actually synthesized 0 mRNA molecules read AA brought to ribosomes in correct order AA assembled into protein 0 tRNA transfer transfer amino acids read mRNA Anticodon complement of codon in mRNA that binds to codon Assembled by enzyme aminoacyItRN synthetase 20 amino acids l 60 nucleotide codons l 60 tRNA anticodons 0 Stage 1 initiation tRNA anticodon attaches to start codon of mRNA 0 Stage 2 elongation tRNAs carrying AAs temporarily attach to ribosomes polypeptide chain grows as ribosome moves along mRNA molecule 0 Stage 3 termination Release factors recognize stop codon on mRNA molecule Liberate new synthesized polypeptide and other components in translational system 76 Differences in DNA account for differences among organisms and even among individuals Polymerase Chain Reaction PCR 0 DNA unzips when heated o Read speci c region of genome 2540 times to obtain and align sequences 0 Generates many copies of DNA fragments to be loaded on a gel and separated by electrophoresis to produce a band pattern o Allows DNA contained in small samples to be ampli ed Chapter Wrapup Examine and Discuss SelfTest 1 Translation of an mRNA molecule into a polypeptide begins at the start codon on the mRNA An aminoacyltRNA bearing the amino acid methionine binds to the start codon because it carries the anticodon a TAC and ATG b AUG and TAC c AUG and UAC d UAA and AUU Which of the following molecules is produced by a structural gene a tRNA b mRNA c rRNA d miRNA Given the mRNA sequence GGAUGCUUGGGAGGAGAUGA use the genetic code in Figure 76 to translate the sequence into a short polypeptide Remember that translation begins at start codons and ends at stop codons Consider a fragment of a DNA molecule containing a very short gene genes are usually much longer than this fragment The nucleotide base sequence of this fragment is 39ITI39ACAAAC CAGTCGCTCCCATCCAA Give the resulting nucleotide base or amino acid sequence of the products after the following operations have occurred a replication b transcription into mRNA c Translation into a short polypeptide chain beginning at a start codon Which of the following is considered the most common level of gene regulation in bacteria and archaea a posttranslational b translationalc RNA processing d transcriptional In eukaryotes a premRNA molecule may give rise to multiple types of mRNAs due to the operation of which can remove introns and exons in different patterns a miRNAs b alternative splicingc chromatin remodelingd RNAinduced silencing complex RISC 7 Which of the following best describes the function of a small interfering RNA siRNA in a plant cell a bringing amino acids to a ribosome for assembly into a polypeptide b attacking invasive viral RNAs c inhibiting translation of a complementary plant mRNA d combining with an mRNA molecule to form a ribosome 8 Which of the following groups of organisms would you predict to have the smallest genome size a plants b bacteria c fungi d archaea e both b and d 9 Which of the following DNA ngerprint techniques uses 4 to 6 nucleotide long recognition sequences to cut genomic DNA into fragments for gel electrophoresis a RAPDsb AFLPsc RFLPsd SSRs or microsatellite DNA Applying Concepts Imagine an extraterrestrial lifeform whose DNA uses the same four nitrogenous bases as terrestrial life but must encode for some number of amino acids other than 20 What would be the minimum codon size in bases if a only 14 amino acids must be coded b If 50 amino acids had to be coded c What if 70 amino acids had to be encoded a b c


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."

Allison Fischer University of Alabama

"I signed up to be an Elite Notetaker with 2 of my sorority sisters this semester. We just posted our notes weekly and were each making over $600 per month. I LOVE StudySoup!"

Jim McGreen Ohio University

"Knowing I can count on the Elite Notetaker in my class allows me to focus on what the professor is saying instead of just scribbling notes the whole time and falling behind."

Parker Thompson 500 Startups

"It's a great way for students to improve their educational experience and it seemed like a product that everybody wants, so all the people participating are winning."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.