New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here


by: Ezequiel Orn


Ezequiel Orn
GPA 3.89


Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

Class Notes
25 ?




Popular in Course

Popular in Biology

This 159 page Class Notes was uploaded by Ezequiel Orn on Sunday September 6, 2015. The Class Notes belongs to BIO 366 at University of Texas at Austin taught by Staff in Fall. Since its upload, it has received 12 views. For similar materials see /class/181730/bio-366-university-of-texas-at-austin in Biology at University of Texas at Austin.




Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 09/06/15
Conjugation Figure 51 Na S46 BamHl HpaIB EcoRl BgIII6 traB pKM101 354 kb orlT tral WH Conjugation Ti plasmid on39Ttra Replicationwithin Agrobacterum dQJA uo B Cut out a piece of the leaf Float in plate containin an Agrobacterlum strain with engineered Ti plasmid Incubate on plate Regenerating containing plant plants regeneration Excise germinating Kanamydn39 shoots and transplant FeSiST nt Shoots to plates containing kanam cin Conjugation Box 51 cont Pilus VirBZ Outer membrane Inner membrane Cytoplasm Relaxase VirDZ Figure 52 MPF Slllllctuleir Cnulrling pluleln a Coupling protein signals to relaxaxe Singlextrand nick at mi and Strand displacement 3390H prime DNA Pol Strand transfer closing of cirde by relaxaxe replication in recipient Transconiuganl Conjugation Covalent bond between relaxase and DNA Donor cell Relaxase VK T P Recipient cell K Conjugation Outer membrane Inner membrane Figure 54 Variable length depending on pilus type Subunit LepB peptidase assembly C P gt p gt 5 39 g T f Pilin complex Leader peptide Propilin Conjugation A Genetic organization of tra region rnRNA a 7 l on39T l traill l raj l traY traX nO 7 Antisense RNA Pm B Immediately after entry into cell A ACtlvateS PW I ill and imnsfel fum lions l 7 7 7 7 7 7 7 7 l on39T l traill l raj l traY ax no C After plasmid establishment I P FinP blocks translation no TraJ l traX l Fin Iquot a K FinO stabilizes FinP Conjugation Figure 56 oriV Conjugation Table 51 Some Fplasmid genes and sites Symbol Function cchB Inhibition of host cell division incBCE Incompatibility oriT Site of initiation of conjugal DNA transfer oriV Origin of bidirectional replication parABCL Partitioning traABCEFGHKLQUVW Pilus biosynthesisassembly traGN Matingpair stabilization tral Relaxase traY Accessory for nickase traj finOP Regulation of transfer traST Entry exclusion F Conjugation Figure 57 W W W gt Clone pieces randomly into 0117 a nonmobilizable on T cloning vector Transform into cells containing a selfitransmissible plasmid Hp Ca m OUT V 39W39 Mate with recipient only on39Ticontaining plasmids are mobilized Ca m Select Amp transconjugants i pr w on39T Conjugation Figure 58 nctlons that Selfrtransmissible plasmid encodes tra fu 39 allow cell contact Coupling protein signals to relaxase Nick made at oriTof mobilizable plasmid Mobilizable plasmid is replicated in the recipient Conjugation f trimsmissible x MObilizable plasmid 539quot plasmid Conjugation Figure 510 gtltHomoogous recombination Chromosome m 1 M ISZ i I 1 If 1 i i u kma I ISZ F ISZ Conjugation Figure 51 1 The F plasmid encodes Ira functions including pili A nick at orT initiates transfer Replication occurs in the donor as one strand is transferred The transferred fragment undergoes recombination in the recipient Figure 512 Formation of mating pair DNA transfer from Hfr donor to F recipient ecombination between homologous regions of incoming and recipient DNA Hfr Ff Recombinant Arg Tr p Conjugation Table 52 TABLE 52 Typical results of an Hfr cross Selected Percent recombinant for unselected markers marker hisG trpA argH rif hisG 1 7 6 trpA 3 3 2 9 3 1 argH 28 12 89 Conjugation Figure 51 3 Recipient Donor 3 07 A A 3 a O N His Arg Trp Rifquot Plate Arginine plus tryptophan His Tryptophan plus histidine Arg Arginine plus histidine Trp Conjugation 30w Vlnu Conjugation Frequency of recombinant types 100 10 1 I I I I 39 I I I 40 50 6O 7O 8O 90 100 O 3 hisG argH trpA rif8 Min on genetic map Figure 515 Conjugation Figure 516 E collchromosome E collchromosome IST ISZ F ISZ IST quot2 x E N F factor carrying chromosomal genes Deletion in chromosome I ISI Conjugation F39 V F39 Prot apparent recombinant Conjugation 7 f 64h 7amp C7 11 Q F quot F Hist apparent recombinant paltial diploid Conjugation Conjugation 2H Donor i Chromoxome Reapwent 2H Plasmids m CHAP TOC Figure 46 I MAM myquot q m S mzs PM RNA S T a RNA Kuwi mph 5 W N V RNADNA hybnd aHuwx quotNAquot pmzusxmg 23 PM RNA 1wa u duplex Ci Nu m IVDNA hybnd PM gt I 3 0H n1 um u pnmes v Nn nNA u pmtamng DNA Why I v Rephmllon Na mphmliun Plas m Figure 47 A Numkl mm nmnnllnlinn pm cmmummmta m n z r A mu up my um v M m mmm a mum mun allquot pram nnlcn Us RepHmhnmlunduwu 9 W WM m m mRNA Q Plasmids m Figure 48 mi hp 200 400 600 800 1000 1200 I I I I I par inc repA I l DnaA A v IR39I IR2 repA 735 710 gt mRNA Q Plasmids mm Figure 49 6 0w nanMr 1 n u m hum n rahm Juan 3 Vilma mum 3 WWW 9 8 10 6106 Q Plasmids EEEI Figure 41 I J V v x mm i 00 Mmlumm m CHAP 10c Q Plasmids Figure 412 Q Plasmids mm Figure 41 3 Q a 1 0 NW N a 4 gtA Transposition and SiteSpecific Recombination Transposon f JE Donor DNA Ifvv i Target recipient DNA Transposition Donor DNA Recipient t gt DNA 4 z I Transposon Q17 Transposition and SiteSpecific Recombination S3 lt ORFA ORFB Target DNA TGATGAC ATT AACCTATAA ACTACTG TAA TTGGATATT Transposition l ATT 39 ATT TAA TAA gt gt IR 40bp inverted repeat ORFAB Transposase ATT TAA 3bp target Site Transposition and SiteSpecific Recombination Figure 93 39550 Kanr Bler Strr 39550 Tn5 5700 bpl I I I I 1500 bp IS Camr IS Tn9 2638 bpl gt I I 768 bp ISIO Tetr ISIO Tn10 9300 bpl gt lt I 1400 bp Q17 Transposition and SiteSpecific Recombination A IS element FTransposase IR ltlllllnlllllllgt l Target DNA B Composite 2 IS gene A Transposase IR IR A IR IR ltllllll IIIIII IIIIIII KIIIIIIIllllgt Transposition and SiteSpecific Recombination Figure 96 Doubleestrand breaks at inside ends i and ii of transposon Tn10 Staggered break I and II in target DNA Tet gene is destroyed Deletion Ends I and i and ends II and ii arejoined Ends and ii and ends II and i are joined Inversion A Transposition and SiteSpecific Recombination Figure 98 Tns lt3 w i i Egt IR A re R Ampr IR mm 4 i w i i EEgt A R res Merr merR IFIZ m T 27 A I I I ll l I l I u l l I It n V l Il I ll V A R res Sulr Strr Merr merR 75 6 9 A re R Terminal inverted repeats Tra nsposase Resolvase and repressor of A and R transcription Recombination site Regulator of Merr and transposase Mercury resistance Ampicillin resistance Inverted repeat Figure 99 lTnIO may hop onto F 439 Tn70 O 3 7 Tetquot Str39 Tetquot Strquot Ampicilliniresistant colonies No ampicilliniresistant colonies Transposition and SiteSpecific Recombination l39 Cointeg rate VM C i i ixry hp 0 Donor 1 Recipient o No transposition Figure 91 1 Donor Recipient in transconjugant l 5 Aquot W131 i 39 Cointegrate i3 quoto r 777 0 Transconiugant Figure 912 Ampicillinrresistant colonies N0 ampicillinrrejistant colonies Figure 91 3 D Staggered cum 5 bp apart in target DNA Singlerstrand cum at K outsIde ends of Tn3 T Ligation of Tn3 ends to tar et ends 7 7 7 7 7 7 7 7 7 7 H g l l 3 OH 1 3 OH 3 i l l t 4 7 7 7Dietaiilofiendis 3 ends prime replication through Tn3 Cointegrate Recombination at res El resolves cointegra e W Srbp duplicated sequence anking Tn3 insertion into target DNA Figure 914 Doublestrand breaks at ends of transposon 39393939393939 a 39393939393939 Ligation of transposon ends and target DNA gt gt G Repair replication of gaps in target DNA generating duplication Donor DNA destroyed A Prepare AzzTn10 lac lacZ i lDenatu re lac Qg EI lacZ NI lacZ Anneal lac lac IUCZ lacZ lac laCZ Package in vitro 1 Transposition and SiteSpecific Recombination B Infect at low MOI a RP lzzTnlU Nam Pam ll g A lacZ 5up E coll 7 cannot integrate or replicate Transposition Tnm L 7 l l laclac lacZlacZ lacZ lac C Plate Medium with tetracycline and XiGal Tet39 colonies 16 sectored colonies Figure 915 Transposition and SiteSpecific Recombination Transposition Tn 0 Tet39 a t 2 D 21Tn 7 0 39 quotCut and paste lacZ acZ 7 Target ch romosome Replicative replication and resolution Figure 916 Colony Tet39 lacZ U ml 395 CD Whiteblue kzzTnIO N quot l lt Tetr A Loss l l ad 2 of phage Il ll l l l 1 White OR kzzTnIO Te Iacz l Loss 2 of phage ll 7 ll gt My Tetr lacZ is Blue e q tra genes RP4 J X chromosome plasmid 3i a 00 o O tra genes RP4 Kan tra nsformant Pstl 5Q 2913 kb lt pAT153 36 kb E z z E z E E E 3 E f E I I I I I I I 115kb 33kb 115kb l l l l l 06 kb I I 108 kb I I 092 kb I I 24 kb I I 06 kb I I I I I I I I I I 26 kb I I 3 kb I Kan I I Tn andlll fragments Pstl fragments Sall fragments 1 Transposition and SiteSpecific Recombination Transposition Box 91 G recombination DNA modification 6 Her A B lys SU gin mom I I I Early genes I I Head genes Tail genes Ilt gt attL I U S attR lmmunlty LySlS Tail fiber genes regulation E Host DNA in virion I Attachment sites lt gt Invertible region G segment Genes expressed in lysogen 2176 1766 1230 1033 653 C n a c I Ii SJS J 2W 114 umougt1 u n IIIPUIH UMOU IUH SJS J 2W 23137 9416 6557 4361 Size kb 1b 5 wmboxm mwomoo w w A m OlXO 1 Figure 919 Distance moved cm Figure 920 A Tn916 owe on 22 m on 7 on 6 mm 077 73 on M arm on 76 on 77 on 790n 20 on 27 on Zi Staggered utsm Excmon Hromosoma DNA 4 WWW Pa TA c x caccmr a a w Haerodup ex mpremse wmon ouphng A from donor DNA sequeme ccAccA TCAATC Reso ved NKkatonT Q Tramfer 13 Smg enrand transferto rempwent a Repkauon m rempwent Recipient cell 9 mm ouphng Sequeme ntegrauon Crossover mto Hromosome VIA Chromosome Figure 921 EcoRI EcoRI i I Ampr ori i Transposon lCut EcoRl ligate fransposd 3 ad Amp r Figure 923 yv iml rs 1 Vb W I W 9039 Transposition and SiteSpecific Recombination CH Am p39 ori Amp39 ori Figure 924 967 Transposition and SiteSpecific Recombination n0 In3 InZ In Tn27 in mi 7 dhfr aadA PP2 Figure 925 int orf4 suI orf5 ltI I II Hgt IR PP2 IR gt int dhfr orf4 suI orf5 Q I VI III IP IR PP2 IR gt int aadA orf4 suI orf5 Q I I ISI326 I ISI353 I I E IR PP2 IR gt Phagelike integrase Sulfonamide resistance Trimethoprim resistance Streptomycin and spectinomycin resistance GTT 59bp element Strong promoter Figure 926 A I39EIM VI Salmonella Him 12 H2fagelin Repressor gt Hl P H1fagelin P1 Q I WINE E14 PinH B ll D lt hln N H2 gt rhl gt P H1 flagellin gt Box 103 qu lumlnlWMx ny mmmkdanguudemme n mwm k MW m mmquot new WWW a mm W a i m E munquot lama Figure 229 Unfolded Folded protein protein I G EL mulrgmers ADP mm Figure 231 0 Macromolecular Sy Inner membrane c FEY NF 3 WV Expuned pmlem J SH SH Peviplaxm 4H 2be Ouler mEmbmno l Exchangemnzbon VIE membrane L Expnncd z A protein Pariplaxm n S H N4 FnyicwyiLeurCyP kc mm cum mombmnc Macromolecular Synthesis m CHAP T c Figure 230 Wt 0 Macromolecular S Type I Type II Type III Figure 234 A TranKriplionaX lusion Fusionlmnt Promoterand l TIR Ian gene 2 Pam air Him 2 1 Protein LacZ 339 mRNA l v LacZ protein Translauuna gt lusion Fusmn 10ml Promoter an transcription Tm m gen d m me mlquot gene a N WC DrfA r LacZ iusian protein lama Molecular Basis of Recombination Figure 101 i Resolution Resolution A B a B A la Patch Exchange of flanking markers c 3 3 A T 1 U1 i a Molecular Basis of Recombination Figure 103 H k Figure 104 3 gt lt 3 G 339 C Molecular Basis of Recombination Table 101 TABLE 101 Some genes encoding recombination functions in E coli Gene Mutant phenotype Enzymatic activity Probable role in recombination rem Recombination deficient Enhanced pairing of homologous DNAs Synapse formation reCBC Reduced recombination Exonuclease ATPase helicase Initiates recombination byseparating chiespecific endonuclease strands cutting DNA at the Chlsite reCD Rec x independent Exonuclease Degrades 3 ends reCF Reduced plasmid recombination Binds ATP and singleestranded DNA Substitutes for RecBCD at gaps rec Reduced recombination in RecBCD Singleestranded exonuclease Substitutes for RecBCD at gaps reCN Reduced recombination in RecBCD ATP binding Substitutes for RecBCD at gaps reCO Reduced recombination in RecBCD DNA binding and renaturation Substitutes for RecBCD at gaps reCQ Reduced recombination in RecBCD DNA helicase Substitutes for RecBCD at gaps reCR Reduced recombination in RecBCD Binds doubleestranded DNA Substitutes for RecBCD at gaps recG Reduced Rec in RuvAiBiCi Branchespecific helicase Migration of Hollidayjunctions ruvA Reduced recombination in RecGi Binds to Hollidayjunctions Migration of Hollidayjunctions ruvB Reduced recombination in RecGi Hollidayjunctionespecific helicase Migration of Hollidayjunctions rqu Reduced recombination in RecGi Hollidayjunctionespecific nuclease Resolution of Hollidayjunctions pn A pn39B pn C dnaT Reduced recombination Helicase Reload replication forks Figure 106 Figure 107 Molecular Basis of Recombination Table 102 Analogy between phage and host recombination functions Phage function Analogous E coli function T4 UvsX RecA T4 gene 49 Rqu T7 gene 3 Rqu T4 genes 46 and 47 RecBCD 9 ORF in nin region RecO RecR RecF Rac recE gene Rec RecQ 9 gam Inhibits RecBCD 9 exo RecBCD Rec 9 bet RecA rusA DLPl 2 prophage Rqu Molecular Basis of Recombination Figure 108 3 5 9 T 9 9 9 9 T 9 9 T 9 9 9 9 9 T T 9 A T 5 ACAGCCTACG GCATCGCGAT 3 3 T G T C G G A T G C C G T A G C G C T A 5 U u gt o n o o c c gt O a gt c n o n n gt gt c n Box 103 A E coli Acl857 Acrorbio Chromosome B Replacement with double C Replacement with singlerstranded oligonucleotide stranded DNA fragment gfge f ggzewk 0 Destred de euon Destred nudeoude change 1 E39 o w met Synthestze theme ohgonudeoude ohgonudeoude PCR L O Hectr orate mduce pL W t V 3 Chrom 030m e x I Eet Target p asrmd ChromosomeV Chromosome Target p asrmd 4 De euon mutant Pomtmutant Chromosom Figure 109 Molecular Basis of Recombination Figure 1010 3 CAGTC TGATG 3 GTCAG ACTAC 5 3 GTTAG ACCAC 5 5 CA TC TooTo 3 5 CA 3TC TGATG 3 3 GTCAG ACCACX 5 3 GTTAG ACTAC 5 5 CAATC TGGTG 3 i A 3 GTTAG ACTAC 5 5 CAATC TGATG 3 Wildtype recombinant Figure 101 1 G A G C T C A G A T C T Crossover G A G G A C T C A A C T T C l Replication G G G C C C Wildtype recombinant Macromolecula EN Figure 132 Mman l Cu py resmtnon endonudeagc u endonutlease Macromolecular Synthesis Figure 133 Macromolecula lama Figure 134 TAC ATC 3 1 7 r ATG TAG C TMTT 3 TAC ATC ATG I11 Table 21 Third position 5 3 end Cy u Cys c Smp A Trp G Arg U mg C Arg A Arg 6 A lle Thr Asn Ser U lle Thr Asn Ser C lle Thr Lys Arg A Mel Thr Ly Arg 6 G Val Ala Asp Gly U Val Ala Asp Gly C Val Ala Glu Cly A Val Ala Glu Gly C 0 Macromolecula S thesis Elm Figure 21 A B NM NM NN N I L NANN N u H N Wm WM Mm N Nll I lta v H mm mm Figure 23 Amino acid arm 0 Macro olecular Sy he mm Figure 24 Active site Secondary channel I I RNA Pa cove Pramumr Dmpizx zlongmn complex with RNA Pm nnmznzyme E Figure 25 C III A I A T C G T 3 339 339 339 3 3 end OH P P P P P 5 end 539 539 539 539 539 Template 3 5 539 3 m Figure 26 olecular Synthes 513 SKI A r v Transcribed Space Spacer region Promoter region r 3 mm TTGACA N TATAAT N AG sequences 7 quot9 C 735 710 1 539 T DNA3I I NNNNNV gt Vvr x H HWWN 39 V N mm Figure 28 0 Macromolecula Sy thess m Figure 29 gt D A 539 anrTchcrzzccTAccAcccTTTYCACT N 339car Acesaccccnccrcccmmcmn 1 Run nl n mmaauun at mutant RNA RNA m am x39 mm s mm Figure 210 I pm I m n w m mum mum mmme m mm Figure 211 1 65 tRNA 235 55 53922 339 Spacers Nuclease processing 3 3 I IJ 3 3 I 4 339 165 tRNA 235 SS mm v a m Cum 6 cm y mm a mm m 5 1 Mn mu m u unmumuemymu mm mums CW u m run a mac mm mm w W M m a m r mm A c m mu m Figure 1112 NA Rep Genes involved in the UvrABC e d I31 Table 111 and Mutagene n onuclease repair pathway polA Iig Gene Function of gene product uvrA DNAbinding protein uvrB Loaded by UvrA m form a DNA complex nicks DNA 3 of lesion uvrC Binds to UvrBeDNA complex nick DNA 5 of lesion uVrD Helicase ll helps remove damagecontaining oligonucleoti e Pol 1 fills in singlestrand gap ngase seals single strand nick I00 TIJurw39w 71 0 Mrquot cell 39 Tt uv I hcr39 cells uvl 39 UV dose TI 1196 cell Huh39va Iow VIA 6 n C hcr uv DNA Repair and Mutagenesis m Figure 1113 AIVIsIWwx quoti IIVIVl 39 Nick Nick lIIlO H IlI lM V IOlIO lII I Il NA Repair and Mutagenesis m Figure 1114 d M agenesis UVMEC Lg lntErSVI faEd mzmmmnauun repawr l Nudmlidu mum repair Figure 1115 DNA Repair and M agenesis m Figure 1116 Mr AIquot 9 W34 Eco Ac gt nan1Jch GO IJV Mac A Uemac PEKWVATMM all fled 30 turn r or 9 I N39fetrion feeefn39laf39e UVdA Jerie flu hanZVu eel5 do mm Figure 1117 cckx A nukoumiem meu lama Repair and Mutagenesis Figure 1118 a J 36 DC a s s m mmmn mama 39 d W V DNA Repair and MutageneSIs m Table I I 2 Genekk pathways our damage repair Repairmechanlxm census latl Funniun Memymrwea mrsmnlch repair dam um mu muwm mm M smak remgnmun mum Endnnudlnic mm mm m May de ma mmL warms wllh MmS Ind MmH WrD mum Helium my mm mm rcpaw dun DNA zyluxlml molllylam vxr Endunurknxe mu m u 5 gm olT m minnalr 39ao39 gnaw axldizminns mulM Clywiyhu mu nu on n csymwm mu volume A m kcu quotmm mm EOxodCIP phmphnlam AW Wu Alkymamiumz m lnmcnpliunal mmquot m Ghnxylmc or nlkylpminu Nudmhde ua an UWA nmpnnrm n v c Wu umponnnl m mm AMC umpunnnl a mm mm H mm Bait examquot mm Aquot ndonuduuxr HU mdanudmm I hmumauwnnun pw vacuum qumhmauun spit m 5mm Lxzhinuc mBCD Hel raxeun mum aduublesland mm mm ammnmm lunuxon m SmglMUmdml DNAhuman pm my system m Cnpmun m Hepwun umth mumquot mum Pan mun MulagLnk WWW M m Table 1 13 Bacteriophage T4 repair enzymes Repair enzyme Host analog DenV UV endunuclease of M luteus UVsX RecA UvsV RecOR UvsW ecC gp4647 exonuclease gp49 resolvase 9P59 RecBCD recumbination repair RuvABC recombination repair PriA Regulation of Gene Expression Box 121 Helix 2 recognition Helix 1 B Amino acids Helix 1 Turn Helix2 12345 678 91011121314151617181920 Regulation of Gene Expression Merodiploid Phenotype 1 Lac 2 LaC Figure 121 Interpretation Complementation m7 and m2 are in different genes No complementation m7 and m2 are in the same gene Regulation of Gene Expression Merodiploid Phenotype I 71m Lace w A vi 1 3 0 2 Y A 4 Inc Figure 122 Interpretation No complementation the cisacting Iacp mutation prevents expression of IacZ IacY and IacA Regulation of Gene Expression A Merodiploid Phenotype lad p Lac IndUCIble 0 Z 3quot y 1 i J A I i i i r lact p 0 Z Y A i A B Lac constitutive i lact pO Zt Yt At Figure 123 Interpretation Iacl is recessive IacOc is dominant and CI acting Regulation of Gene Expression Table 121 Genetic behavior of lac mutations Mutation Inducibility Complementation behavior lacZ Noninducible Recessive transacting lacl Constitutive Recessive transacting laclS Noninducible Dominant transacting lacrOI Constitutive Dominant transacting laclq Inducible Dominant transacting lacOC Constitutive Dominant cisacting lacP Noninducible Recessive cisacting Tighter on off control Regulation of Gene Expression Figure 124 b f lacl lacp lacO lacZ lacY lacA IA sence O I I I I I I I actose I 39 lacl lacp lacO lacZ lacY MA I 7 Allolactose Presence of lactose Regulation of Gene Expression Figure 125 A lacp 1 r 10 03 O1 02 82 11 401 B 35 TI39TAT Figure 126 RNA LIvmel axrv Internmon legion CAPrbinding site Reprexxorrbinding site GAAATACGAAGGCCGAG h rimv CAOACCTTAACACTCGCCTATTGTTAAAGTGTGTCCTTTGTCCATACTGGTAC 1 ACTCGCGTTCCGTTAATTACACTCAATCGAGTCAGTAATCCGTGGGGTCC smp m w fMetThr Met mllNA slim sur 4gt ac Md 01 1 w r w 1 v 1 w 1 1 1 1 Reprexxor coding region 80 770 0 750 r40 r30 720 710 1 10 rGalactoxidaxe rmmip operator coding region Regulation of Gene Expression Figure 127 Repressor gaR Pcz Pm gaE gaT gaK II I lIII I I I I I I OE 0 w Regulation of Gene Expression Figure 128 Galactose ATP W galactose1PO4 a 3alactose1PO4 UDPglucose W UDPgalactose glucose a UDPgalactoseTgt UDPglucose a UTP glucose1PO4W UDPglucose a Regulation of Gene Expression i 399 viii l 0 0 l 6 a 6 1 quotlg Repressor gal 4439 Repressor gal J Repressor gal o Multicopy 6 Multicopy plasmid plasmid with 0E with 0E and 0 z Figure 1210 A Multiple of 10 bp l l 0 PM z VO lI 10quot vO lI V O l l VOVl OE 0 Repressors bound to same side of helix B Multiple of 15 bp PJ I 0 wsOw cs j I moVw OE Regulation of Gene Expression y FFIMHED Figure 1211 A p2 r pl OE r gaE 039 I W 60 1 50 Regulation of Gene Expression Figure 1212 Pm trpL trpE trpD I trpC trpB trpA ter I trpR III I I I I I I E l mRNA I Leader polypeptide Anthranilate Indole Tryptophan synthetase glycerolphosphate synthetase synthetase 39 I I I I I I I I I I I I I l I I V V Chorismic gt anthranilic gt PRA gtCDRP gt InGP gttryptophan acid acid Regulation of Gene Expression A In the absence of tryptophan Pup rquot O L trpE D C B A I I trpR I I mRNAW dNp t Repressor B In the presence of tryptophan phi A O L E D C B A I I R 39 l l I t 0 A Aporepressor dimer Helix 1 Helixrtumrhelix domain Aporepressor HTH D E rTI pgv m vplezsm I x r H IKJH 39CHiU39K39t V Rvpl ESSOI I39ITH E T F Figure 121 5 m CAP site 1 Plt UBAD J araB araA araD VIIIA nlWl Il araOZ araO1 aral L M L Ribulose L Arabinose L Ribulose 5 kinase isomerase epimerase JI39 J I I V V V L Arablnose gt L rlbulose gt L rIbquse S gt D xylulose S phosphate phosphate P1 A P2 Arabinose Antiactivator Actlva tor Arabi nose Regulation of Gene Expression Figure 1216 A Absence of arabinose 2 P1 form binds to operators of both operons preventing araBAD expression 2 P2 form andor the AraCC P2 form H binds to linduction sites of both operons activating araBAD transcription Regulation of Gene Expression A Absence of L arabinose B RNA Pol m araBAD mRNA Regulation of Gene Expression Figure 1218 Maltotriose M W malQ malP malT malG malF malE malK lamB malM 75 min 91 min m Regulation Maltose uptake y Maltose uptake W Amylomaltose phosphorylase IV V mall malX malY malS 36 min 80 min xAmylase v U m Figure 1219 Outer membrane Periplasmic space MaIG 3 g MaIK f v C to Iasmic W H r Maltose Maltodextrins myemrijrane 1 GIucose6phosphate Y H Regulation of Gene Expression Figure 1220 pu pl pR xyICMABN xleYZLTEGFQKH xylS xle Upper pathway Lower pathway Ps CH3 COOH COOH TCA cycle Toluene Benzoate Benzoate Regulation of Gene Expression tryptophan n E 1903D Met 21 EAUAAGC mwu CCA U 5 190 SD Box 123 Regulation of Gene Expression Figure 1221 Antiterminator struc tu re Readth rough conformation 1TTUGA AUG Pause Alternative RNA Sthture Terminator secondary structures of GA hairpin structure the leader transcript U Pause hairpin Leader peptide Termination coding region conformation RNA AUG uuuuuuu Transcription First DNA Sta structural 1 2 3 4 ene Promoter ATG TT TGA Leader peptide Attenuator coding region Pause Site Figure 1222 A RNA Pol pauses at 12 pause site Ribosome initiates C A G E 6 9 90 B Ribosome UC WM releases c gov paused U i RNA Pol GA A A c Attenuation in presence of Trp RNA Poi Strudura W Mo genes Tm Trp Arg W RNA Poi A Met tys Aia HePhe Vai Len tysGiy C c U A terminates D Transcription elongation in absence of Trp Strudura M l W RNA Poi H0 gem e GccuuuUUquot 4 Laltk ot trptRNA auses nposome to staii Regions 2 and z a lt 1 base p ir Tm Tm 3 r gpreventing H w A H z and 4 fr formiriga K G y terminator Lys ni in Leu Vai Phe iie Aia Met Ly 54 73948 Plasmids Table 41 TABLE 41 Some naturally occurring plasmids and the traits they carry Plasmid Trait Original source ColEi Bacteriocin which kills E coli E coli Tol Degradation of toluene and benzoic acid Pseudomonas putida Ti Tumor initiation in plants Agrobacterium tumefaciens p P4 24D dichlorophenoxyacetic acid degradation Alcaligenes eutrophus pSym Nodulation on roots of legume plants Rhizobium meliloti SCPi Antibiotic methylenomycin biosynthesis Streptomyces coelicolor RKZ Resistance to ampicillin tetracycline and kanamycin Klebsiella aerogenes v V angA 4 A rvgvArrvgvgrvgrrrrvgv14v144v 2 mm 7L4V angA 444444 A A rvgrv V4D4i4V4i4V4i4i4V4i4V L JBAB 4 A A A 4 JV4JV4J4V4J4V4i4i4i4i4v4v4i4v4i J 3 5 L umng 444444 444444 44444444 4V iVDiVViVVVVVViiVJ dsmlauog 4 4 4 4 4 V4L4 94039 4L4J4V 4J4L4J4L4J4L4 V4V 4J4VJV a V I V4J4V4V 4L4V4J4L4 J4V4J4J4L4V4D 4L4V4 4 4 4 4 4 4 4 4 J4V4 4L4V4V4L4 V4V4V4V4V4V4i4i4V4iVl ixVi4V4i4i4V4i4V4V4V 4J4V4V4V4i434V 4L4 4 4 4 4 4 4 4 4 4 V4L4 D4V4J4J4V 4L4L4J4J4L4J4 V4V 4J4VJV V 239 X09 spgwsmd Plasmids Figure 41 Supercoiled covalently closed circular DNA F543 Plasmids Figure 42 Chemical structure of ethidium bromide Covalently closed circular Negatively 39 Positively supercoiled Relaxed supercoiled can bind 0 Low Higher Higher yet concentration 2 ugml EtBr EtBr EtBr Em Up to Linear DNA EtBr Etgr 1 EtBr t r EtBr HBF 2 bases EtBr EtBr HBF 6137 Plasmids Figure 43 Protein and membrane 1 Linear and nicked circular DNA Covalently closed 6 O circular DNA 0 v RNA Before After centrifugation centrifugation Q3 Plasmids A onv onv onv ccc DNA 33 DNA ccc DNA 73948 Plasmids 54 Table 42 Copy numbers of some plasmids Plasmid Approximate copy number F 1 Pl prophage l RK2 4 7 in E coll pBR322 l6 pUCl 8 30 50 lel 01 40 300 74g Plasmids 3 Figure 45 z4 1 Plasmids Figure 46 Rop dimer RNA T pRNA Origin pm r r r l I I 5 l l I I j l l l l I I pRNAll RNA 3 RNA 5 RNA l KIssmg complex 5 RNA H v RNase H RNADNA hybrid allows RNA processing 3 5 3 5 RNA lRNA duplex RNA 5 II No RNA IIDNA hybrid Pol 3 OH Of RNA H Primes No RNA processing DNA synthesis Replication No replication 43 Plasmids Figure 47 A Plasmid genetic organization Promoter Gene products expressed pm RepA and CopB law View paw CopA antisense RNA B Replication occurs after plasmid enters cells C Replication shutdown C RN 9 III I CopB represses as c eavage A mpA RNA Y 7 repA m RNA repA codons Translational coupling quotIe Lewzlel peplh 74g Plasmids 3 Figure 48 ori bp 200 400 600 800 1000 1200 I I I I I I I I I par z inc repA XDnaA R1 R2 R3 R1 R2 repA 35 0 mRNA F431 Plasmids 5 Figure 49 Low I High concentration concentr39atlon of plasmi of p asml 39 I Plasmids coupled 74g Plasmids 3 Figure 410 74g Plasmids 3 Figure 41 1 Dimer Monomers 00 Figure 412 2 3 3 F43 Plasmids Figure 41 3 Plasmids 1 U 9 Unequal dixtribuli ofA and fquot i 06 or B Unequal distribution of two plasmid type 1quot07 O Unequal dixln39bulion of A and B Cured of type B Figure 414 z4g Plasmids 5 Figure 415 Inoculate Dilute Incubate U Medium without chloramphenicol Spread onto Replicate Incubate pate without and chloramphenicol incubate Four on plate With Several chloram henicol colonies p hundred colonies zf l asn ds 54 Table 43 Replication origins of several E coli plasmid vectors Plasmid ori Copy number pBR322 pMBi 15 20 pUC vectors pMBi mutant 100 pET vectors pMBi mutant 100 pBluescript pMBi mutant 100 pACYC184 p15A 10 12 psc101 psc101 5 J Plasmids Am r P Ligate Ampr Ampr Ampr gt 3 39q ori Transform and select Ampr colonies This Ampr colony contains the ori clone Medium with ampicillin 74g Plasmids 3 pBR322 436 kb as Plasmids Figure 418 EcoR quot 3me pm BumH g Amp Tet BumH BumH ngext p axrmd and forewgn DNAwwth 3me 3me 3me 3me 3me 3me 3me 3me 3me I Mxxand hgate 74g Plasmids Figure 419 Drall 2674 BsmAl 2531 Aatll 2617 Esp3 51 anl 2294 Hindlll 399 MUltiPIE cloning EcoRl 450 site Bch 2215 Soul 2177 Pix Ampr Pvul 2066 Avall 2059 pucm 2000 2686 bp Afilll 806 Bgll 1813 Cfr10 1779 AIWN1217 pUC1X multiple cloning site and primer binding regions 364480 400 450 M13pUC forward equenang primer 52 887 i Wm equenong primer SLOT AAAACCACCC CCAcmrrrr lt3L CCACTAT CCACAAeS39 s39ecccAcTc ACCACCTTCT AAAACCACC CCACTCCCAA ccwccmcc CTCCACCTCC ACTCTACACC ATCCCCCCCT ACCCACCTCC AATTCCTAAT CATCCTCATA ccrcriiccm39 5LCCCACTC ACCACCTTCT AAAACCJ r 7quot 4 Mi WUC forward mime sequemng primer Hindiii 5pm Pm 551 xmi iamHi Kpni Sm grow wpepiide start Arri Xmui innii Hmrii 5mm 3mm 74g Plasmids 3 Figure 420 LEUZ 2pm origin Tetr Ofl L54 9 I 39 739 f 13 H F 2 re 2 39 7 I J A 39x z 51 139719quot 6ng RQ7hlti 1 5M 21 Junk kcyaM RSthMe Syn regulth ug zh S RyAB can39t3515 R A 70 Id fluff loom n AI39ICJ iron1M when mmuse in 045 comma Pram lulu lion 1 lini rwq Fur a OR reaSar for fru R Lls39hd SeneJ39 At no ironre5u 1ed 3equot expand canah nJrvekl 6 He can Loin ex ruse Ex In fur rive r 511 39ou 1 3 I 5 V Fi 7w Auks cynfkais If Rye mealn9 J39IIuI R04 Sul 4955 5 Au approx 6390 A l Rylt B Figure I 31 5 Figure 1 316 I r mil KrpoB rpoC IIIRNA f Global Regulatory Mechanisms Figure 1319


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."

Anthony Lee UC Santa Barbara

"I bought an awesome study guide, which helped me get an A in my Math 34B class this quarter!"

Bentley McCaw University of Florida

"I was shooting for a perfect 4.0 GPA this semester. Having StudySoup as a study aid was critical to helping me achieve my goal...and I nailed it!"

Parker Thompson 500 Startups

"It's a great way for students to improve their educational experience and it seemed like a product that everybody wants, so all the people participating are winning."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.