New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here


by: Ezequiel Orn


Ezequiel Orn
GPA 3.89


Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

Class Notes
25 ?




Popular in Course

Popular in Biology

This 121 page Class Notes was uploaded by Ezequiel Orn on Sunday September 6, 2015. The Class Notes belongs to BIO 226N at University of Texas at Austin taught by Staff in Fall. Since its upload, it has received 59 views. For similar materials see /class/181732/bio-226n-university-of-texas-at-austin in Biology at University of Texas at Austin.




Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 09/06/15
Anabolism synthesis of complex molecules and cellular structures turnover continual degradation and resynthesis of cellular constituents rate of biosynthesis approximately balanced by rate of catabolism requires much energy Level or urgarliza nn Cells organelles Supramolecular systems Macromolecules Monomers or building blocks lnmgenie mglecules Figure 101 Examples aacxeria Algae Fun I Proxczca Nuclei Mitochondria lbusumes Flagella Membranes Enzyme complexes Nuclelc nclds Plntems Pnlysaccharides Llpids Nuclemmes Amino acids sugars Fatty am 00 NHy Hp Po Table 101 Biosynthesis in Escherichia cali Cell mmimem DNA RNA Pulymcchnridm mm s Pmlclm lim 301 u 151110an mummy 0 00083 1 5 I 2500 0 I mm In Scrum nu Synllu yzis 60mm 5000 55m MM 1mm l39n mm m mu Inn mm mm wmam muhwk umm quotraw gwwnu mm Principles Governing Biosynthesis macromolecules are synthesized from limited number of simple structural units monomers saves genetic storage capacity biosynthetic raw material and energy many enzymes used for both catabolism and anabolism saves materials and energy More principles catabolic and anabolic pathways are not identical despite sharing many enzymes permits independent regulation Figure 102 Amphiholic In k 1 L A m V o lt Jquot39I A W ovo 1 More principles breakdown of ATP coupled to certain reactions in biosynthetic pathways drives the biosynthetic reaction to completion in eucaryotes anabolic and catabolic reactions located in separate compartments allows pathways to operate simultaneously but independen y More principles catabolic and anabolic pathways use different cofactors catabolism produces NADH NADPH used as electron donor for anabolism large assemblies eg ribosomes form spontaneously from macromolecules by selfassembly Calvin cycle in eucaryotes occurs in stroma of chloroplast in cyanobacteria some nitrifying bacteria and thiobacilli may occur in carboxysomes inclusion bodies that contain ribulose15 bisphosphate carboxylase rubisco consists of 3 phases The Carboxylation Phase rubisco catalyzes addition of 002 to WmmmmWWWWMWWWo ch cup J rlpulose15 o W ooco Hp H 05quot blsphosphate quotT0quot 39 ecoH H C OH H C OH RuBP forming 2 Meg an 329 3 R bulnse l r arphnsnhnglycerala bisphospha e PGA phosphoglycerate quot5 Figure 103 The Reduction Phase 3phospho glycerate reduced to glyceraldehyde 3phosphate Figure 104 The Regeneration Phase RuBP regenerated carbohydrates eg fructose and glucose are produced Figure 104 Summary 6002 18ATP 12NADPH 12H 12H20 i glucose 18ADP 18Pi 12NADP 11 Synthesis of Sugars and Polysaccharides gluconeogenesis used to synthesize glucose and fructose from noncarbohydrate precursors sugar nucleoside diphosphates important in synthesis of other sugars polysaccharides and bacterial cell walls 12 Gluconeogenesis generates glucose and fructose most other sugars made from them functional reversal of glycolysis 7 enzymes shared 4 enzymes are unique to gluconeogenesis 13 Figure 391 05 Anaplerotic CO2 fixation phosphoenol pyruvate PEP carboxylase PEP CO2 gt oxaloacetate Figure 1017 pyruvate carboxylase pyruvate CO2 gt oxaloacetate Name Discussion Unique No Last First Discussion Questions 4 Sep 26m 2006 Please answer any two of the questions PRINT it out and turn it in either on your discussion sections or on next Monday39s class no later than 1200PM Email attachments and late delivery are not acceptable 1 What is transpeptidation with reference to PG synthesis and where does it take place in the cell Name an antibiotic that inhibits transpeptidation Name an antibiotic that inhibits transglycosysylation as well as transpeptidation 2 What are bacterial capsules and how they protect the cell Qlou only need to list two of them 3 What are the different components of the bacterial flagellum What are their functions 4 What is the energy to drive the bacterial flagellum What are the different movements with respect to flagellar rotation that a bacterium is capable o 5 Describe in brief the ultrastructure of endospore What makes the endospore so resistant What triggers endospore formation What triggers the endospore germination Please read PRESCOTT page 93 98 and 102 107 Check the course website and go through Endospore section in your download le Please preview the lecture outline Microbial Growth amp Control Lectures 7 amp 8 You need to know all the terms de nitions etc listed there Name Last First Discussion Questions Set 4 Sepmtember 27 2005 Please turn in a printedwritten copy of the questions with answers to two questions for the next discussion session Capsules Flagella PiliFimbriae and Endospores l Briefly state chemical makeup and two possible functions capsules 2Describe the basic structure of a bacterial flagellum and state function 3 What are the different ways of flagellar arrangement 4 Briefly compare the function of adhesion pili and sex pili 5 Briefly state the function of endospores gram positive pathogenic bacteria that can produce endospores 6 Describe the structure of an endospore 7 What makes endospores highly resistant to stress 8 What are the advantages of producing spores Under what circumstances do spores form 9 What triggers germination of spores Discussion Unique No the of and name two genera of Penicillin inhibition of wall synthesis Incubation Transfer to Swelling due in medium with sucrose dilute medium to H20 influx Lysis gt gt Protoplast H O 2 Figure 326 Protoplast Formation Protoplast formation induced by incubation with penicillin in an isotonic medium Transfer to dilute medium will result in lysis cw Igu uasmm mm a mm mm ammonium va Chapter 6 Microbial Growth cw Igu uasmm mm a mm mm ammonium va Growth 0 increase in cellular constituents that may resu t in 7 increase in cell number eg when microorganisms reproduce by budding or binary ssion 7 increase in cell size eg coenocyu39c microorganisms have nuclear divisions that are not accompanied by cell 0 microbiologists usually study population growth rather than growth of individual cells cwguuummwlcm amp momva The Growth C we 0 observed when microorganisms are cultivated in batch culture 7 culture incubated in a closed vessel with a single batch of medium 0 usually plotted as logarithm of cell number versus time 0 usually has four distinct phases population ngLh ceases T mmwma if Eanenllaltlwl g hm maximal rate ufdivismn 51mg 5 and population ngLh pupalan g e smmmm m7 Figure 6 1 Lag Phase I cell synthesizing new componenm r eg to replenish spent m aterials r eg to adapt to new medium or other conditions I varies in length rin some cases can be Very short or even sent Exponen alPhase I also called log phase I rate of growth is constant I population is most uniform in terms of chemical and physical properties during this phase Table 61 An Example of quot In mm mquot x 2quot r x n 2 4n 4 rm 5 2m m mu 1 m m 391 lmulmwllulhwm nhxxmcllmwwlluuuu cells are mmalng and duublmgm number atregulznntervals each mdlvldual cell dlvldes at a sllghdy dlfferent ume curvenses smuuthlyrather than as dlscrete steps Flgme 3 Balanced growth I during log phase cells exhibit balanced growth 7 cellular cons tuenm manufactured at constant rates relative to each other Unbalanced growth I rates of synthesis of cell componenm vary relative to each other I occurs under a variety of conditions 7 change in nutrient levels shiftrup poor medium to rich medium shiftrdown rich medium to poor medium 7 change in environmental conditions Effect of nutrient concentration on growth E a 5 tom WWW Nmnl ammo Figure 5 2 Stationary Phase I total number ofviable cells remains constant rmay occur because metabolically active cells stop reproducing rmay occur because reproductive rate is balanced by death rate cw Igu uasmm mm in mm mm ammonium th Possible reasons for entry into stationary phase 0 nutrient limitation 0 limited oxygen availability 0 toxic waste accumulation 0 critical population density reached cw Igu uasmm mm in mm mm ammonium th Starvation responses 0 morphological changes 7 eg endospore formation 0 decrease in size protoplast shrinkage and nucleoid condensation 0 production of starvation proteins 0 long term survival 0 increased virulence cw Igu uasmm mm in mm mm ammonium th Death Phase 0 cells dying usually at exponential rate 0 death 7 irreversible loss of ability to reproduce 0 in some cases death rate slows due to accumulation of resistant cells The Mathematics of Growth I generation doubling time Aime required or the population to double in size I mean growth rate constant inumber of generations per unit time rusually expressed as generations per hour Measurement of Microbial Growth can measure changes in number of cells in a population I can measure changes in mass of population Measurement of Cell Numbers Direct cell counts 7 counting chambers 7 electronic counters r on membrane lters Viable cell counts rplau39ng methods 7 membrane ltration methods Counting chambers easy inexpensive and a quick a l counung both eucaryoles and procaryotes 39 cannot distinguish living from dead cells mm s Electronic counters microbial suspension forced through small ori ce movement of microbe through ori ce impacts electric current that ows through ori ce 0 instances of disruption of current are counted cw Igu uasmm mm in mm mm ammonium va Electronic counters 0 cannot distinguish living from dead cells 0 quick and easy to use 0 useful for large microorganisms and blood cells but not procaryotes cw gnum w Direct counts on membrane filters 0 cells ltered through special membrane that provides dark background for observing cells 0 cells are stained with uorescent dyes useful for counting bacteria 0 with certain dyes can distinguish living from dead cells Plating methods measure plate dilutions of number of population on suitable viable cells solid medium 129 IS count numb er of expressed as colon39 colony mmg quot ts calculate number of CFU cells in population Plating methods I simple and sensitive I widely used for viable counts of microorganisms in food water and I inaccurate results obtained if cells clump together Membrane filtration methods F 6 3 especlally useful for analyzlng aquatlc samples Measurement of Cell Mass dry weight 7 time consuming and not very sensitive quantity oi a particular cell constituent r eg protein DNA ATP or chlorophyll constant 7 quick easy and sensitive l j I more cells murellght scattered A lessllght detected Figure 5 a mum The Continuous Culture of Microorganisms I growth in an open system 7 continual provision oi nutrients r continual removal of wastes I maintains cells in log phase a a constant biomass concentration for extended periods I achieved using a continuous culture s stem The Chemostat rate ofincoming Figure 5 9 Dilution rate and microbial g rowth dilutmn rate 7 rate at which medium Clqu thmugh vessel relativetu vessel S23 3 me eeu density maintained atwide gs emiuuen rates and emustat uperates best at F 76 1n airsuvau luw dilunun rate 3 The Turbidostat I regulates the flow rate of media through vessel to maintain a predetermined turbidity or cell density I dilution rate varies I no limiting nutrient I turbidostat operates best at high dilution rates Importance of continuous culture methods 0 constant supply of cells in exponential phase growing at a known ra e study of microbial growth at very low nutrient concentrations close to those present in natural environment study of interactions of microbes under conditions resembling those in aquatic environments 0 food and industrial microbiology 12W Igu uasmm Icm ma ammonium va The Influence of Environmental Factors on Growth 0 most organisms grow in fairly moderate environmental conditions 0 extremophiles 7 grow under harsh conditions that would kill most other organisms 12W Igu uasmm mm in mm mm ammonium va Solutes and Water Activity 0 water activity aw 7 amount of water available to organisms 7 reduced by interaction with solute molecules osmotic effect higher solute 2 lower aw 7 reduced by adsorption to surfaces matric effect 1 mi a Osmotolerant organisms grow over wide ranges orwater activity many use compatible solutes to increase their internal osmotic concentration 7 solutes that are compatible with metabolism and growth some have proteins and membranes that require high solute concentrations for stabi ity and activity Effects of NaCl on microbial g rowth W quotquotquotquot quot halophiles i grow optimally at gt01 M extremenalopniles 7 require gt2 M Figure 5 11 e hydrogen ion concentration Figure ll pH acidophiles neutrophiles r owth optimum between pH 55 and pH 7 alkalophiles owth optimum between piixs and pH 115 p H internal pH near neutrality some synthesize proteins that provide protection 7 eg acidrshnckprnteins many microorganisms change pH of their habitat by producing acidic or basic waste products 7 me n edia cunmin hufferstn prevent growth inhibition Temperature organisms Wmmm ex lblt gro temperatures mm mm 7 i J maximal thure 6 13 r optimal nypmnemumes Thwmupmlu mamas Psycnmlmvns rryemrnes x t u o Gmmh raie m 2n cw do so so 7o an an Inn ttnt Figure 6 14 Yemvzialum c o Adaptations of thermoph iles protein structure stabilized by a Variety of m eans r eg more H bonds 7 eg more proline r eg chaperones histon Hike proteins stabilize DNA membrane sta ilized by Variety oi means r eg more saturated more branched and 39gher mol 39ght 1i ids r eg ether linkages archaeal membranes Oxygen Concentration need mfg ignure uxygen 5 lt z 7 1m uxygen uxygm uxygen mm uxygen one mum Amine srnn Mlcrnauwmiu me meme meme mm Figure 5 15 Basis of different oxygen sensitivities oxygen easily reduced to toxic products aerobes produce protective enzymes 7 superoxide disnnmse son 7 catalase Dhligitl Faculiaiwa mnunnr smn Mnmmm umhl mmne meme mm Enxyml EDMEM esuo snn sou eseu son one Cauiasu e Causing e cnnm 7 Camius new iomls Figure 514 Pressure I barotolerant organisms r adversely affected by increased pressure but not as severely as nontolerant organisms I barophilic organisms frequire or grow more rapidly in the presence ol increased pressur Rad iati o n W M n anw Figure 5 18 Radiation damage ionizing radiation 7 disrupts hemical structure ol many molecules including DNA damage may be repaired by DNA repair mechanisms cw Igu uasmm mm a lumth minim mammaryst Radiation damage 0 ultraviolet UV radiation 7 mutations death 7 causes formation of thymine dimers in DNA 7 DNA damage can be repaired by two mechanisms photoreactjva 39on 7 dimers split in presence or li ht dark reactivation 7 dimers excised and replaced in absence oflight cw Igu uasmm mm a lumth minim mammaryst Radiation damage 0 visible light 7 at high intensities generates singlet oxygen 102 I powerful oxidizing agent 7 carotenoid pigments I protect many lightexposed microorganisms from photooxidation cw Igu uasmm mm a lumth minim mammaryst Microbial Growth in Natural Environments microbial environments are complex constantly changing and may expose a microorganism to overlapping gradients of nutrients and environmental factors 12W Igu uasmm quotqu Growth Limitation by Environmental Factors 0 Leibig s law 0fthe minimum am ammonium va itotal biomass of organism determined by nutrient present at lowest concentration 0 Shelford s law oftolerance 7 above or below certain environmental limits a microorganism will not grow regardless of the nutrient supply Responses to low nutrient levels 0 oligotrophic environments 0 morphological changes to increase surface area and ability to absorb nutrients mechanisms to sequester certain nutrients Counting Viable but Nonculturable Vegetative P rocaryotes stressed microorganisms can temporarily lose ability to grow using normal cultivation methods 0 microscopic and isotopic methods for counting viable but nonculturable cells have been developed Quorum Sensing and Microbial Populations quorum sensing A Cquot chemical signals I K m Figure 5 2n Processes sensitive to quorum sensing gram negative bacteria bioluminescence Vibrio sch eri synthesis and release of virulence factors Pseudomonas aerugin 05a conjugation Agrobacterium mmefaciens antibiotic production Erwinia carotov om Pseudomonas aureofaciens bio lm production P aeruginosa Quorum sensing gram posItIve bacteria often mediated by oligopepu39de pheromone processes impacted by quorum ensing 7 mating Emmcaacusmzmli 7 transformation competence smmmccus pneumoniaz 7 5p m39ulatzion Emillu subtilix 7 production nr virulence factorsSm11hyL7 aacux mu 7 development at aerial myselia Strepmmycex grixeux 7 antibiotic production s griizux Chapter 11 Genes Structure Replication and Mutation Terms and concepts clone population of cells that are genetically identical genome all genes present in a cell or virus haploid one set of genes diploid two sets of genes genotype specific set of genes an organism possesses phenotype set of observable characteristics DNA as Genetic Material established by several critical experiments Fred Griffith 1928 Oswald T Avery C M MacLeod and M J McCarty 1944 Alfred D Hershey and Martha Chase 1952 sum a cow 1 thkului 5 mm quot c Figure 111 Transforming principle R cells purified 8 cell polysaccharide gt R colonies R cells purified S cell protein gt R colonies R cells purified S cell RNA gt R colonies R cells purified S cell DNA gt S colonies S cell extract protease R cells gt S colonies S cell extract RNase R cells gt S colonies Figure 112 158 protein in coat DNA L f C at protein P DNA Hgt b Figure 113 Blender treatment 3 E Blender p J treatment g amp The Central Dogma O Replication DNA Transcription RNA 1 Translation Figure 114 Protein Nucleic Acid Structure Ribose or Purine and pyrimidine bases deoxyribose Nucleoside or deoxynucleoside Phosphoric acid Nucleotide or deoxynucleotide Figure 115 Nucleic acid RNA DNA Examples of nucleosides nucleoside X N 5 nitrogenous base pentose sugar Figure 115b NH2 N 0 HOCHZ 4 139 2 0H 2 deoxycytidine DNA Structure nitrogenous bases A T G C pentose sugar deoxyribose chain of nucleotides linked by phosphodiester bonds usually a double helix composed of two complementary strands base pairing rules A with T G with C 10 Bases 3 end 0 G o oquot 0 I c 0 P o 0 P 0 0 o 0 NIHmm P ll 0 0 0 o o A Deoxyrlbose o G 0 sugar OP 0 Phosphodiester O bond H 0 c o o P o o I Hydrogen bond 339 end 5 end O H o 0 Q C in phosphateester chain 0 C and N in bases 0 P Majur groove Minor groove Figure 11721 H7 2C nm 4H l Base pairs L Ribbon II two polynucleotide Ribbon l chams are anu 0 parallel Figure 117b RNA Structure nitrogenous bases A G C U instead of T pentose sugar ribose usually consists of single strand of nucleotides linked by phosphodiester bonds can coil back on itself forms hairpinshaped structures with complementary base pairing and helical organization base pairing rules A with U G with C 14 Types of RNA three types ribosomal RNA rRNA transfer RNA tRNA messenger RNA mRNA differ from each other in function site of synthesis in eucaryotic cells and structure 15 The Organization of DNA in Cells organization differs in two cell types 16 Procaryotic DNA supercoiled DNA O usually exists as closed circular supercoiled molecule associated with basic proteins Figure 119 Eucaryotic DNA linear molecules associated with histones coiled into repeating uni called nucleosomes DNA Replication complex process involving numerous enzymes and proteins in general process is similar in all organisms 19 Patterns of DNA Synthesis semiconsenative H V each parental is strand is conserved two parental strands separate and serve as templates for send synthesis of new strands Henllcalmn mm nepllcas Parental Figure 1111 Patterns of DNA synthesis 39 in procaryotes N bidirectional from a anyquot single origin of l replication k V k Replicatiunlurks portion ofth 1 genome t l contains an origin and is replicated fk mka move as a unit 1n opposne 39 directions CG J Flgurc 1112 Patterns of DNA synthesis in eucaryotes bidirectional 10 10mm multiple origins of A gt A gt replication vf Kv i Replication forks Figure 1114 Patterns of DNA synthesis some small S3 circular Q genomes eg viruses and T plasmids 7 replicated by rollingcircle Jim mechanism Figure 1113 Mechanism of DNA Replication 339 DNA polymerase III synthesizes DNA in bacteria Leading strand synthesized by primase RNA Okazaki P39imar fragment 5 e x igngngLs 939 39 DNA gyrase helicases unwind strands and relieve tension caused by unwinding Lagging strand 5 Figure 1116 DNA polymerase III uses each strand as template and synthesizes complementary strands Figure 1115 MA willquot mm mm ultrllm lwl quotum quotlam unmacmarm W mum DNAxemmnu 5N I 5 cu l o a o t I uPin o 7 o t I o o v I cu o o s 39 n u OFl 0 aU Pn CH v VI c quot 0 ca 0 an synthesized continuously by DNA polymerase III Fork movement a quot agging stran DNA gyrase helicases 5 synthesized discontinuously Figure 1116 DNA polymerase I removes DNA ligase joins fragments primers and lls gaps to form complete strands of DNA DNA Hgase reac on Figure 1118 0 aquot cH Wm 1 o oPo o CH wag 2 0H DNA Base gt NAD or ATP Leading strand ssa Hellcase DNAGVrese 3 533332333332 Lagging shand l 5 a 3 5 anusome making primer R NA primer DNA Po ymerase m l Lead ng strand lemp als Figure 1117 DNA Polymerase I Leading smand template DNA polymerase I replacTng FINA primal Figure 1117 Some amazing facts 2 30 proteins required to replicate E coli chromosome occurs with great fidelity error frequency 109 or 103910 per base pair replicated due to proofreading activity of DNA polymerases Ill and l occurs very rapidly 750 to 1000 base pairssecond in procaryotes 50100 base pairssecond in eucaryotes 30 The Genetic Code the manner in which genetic instructions for polypeptide synthesis are stored within genome colinearity sequence of base pairs in DNA corresponds to the amino acid sequence of polypeptide encoded 31 Establishment of Genetic Code codon genetic code word specifies an amino acid codon meanings deciphered by Marshall Nirenberg et al in 1960s 32 Organization of the Code code degeneracy up to six different codons can code for a single amino acid sense codons the 61 codons that specify amino acids stop nonsense codons the three codons used as translation termination signals do not encode amino acids 33 Table 111 T he Genetic Code 3mm rumquot u c A a ucu UAU UGU U pm T r c nur urr mm nm a U 5w u m um UAA um 51 UP A Lcu STOP UUG UCG UAG UGG Tip 0 CW ccu CAU U Hm C n r CC mr c 1 Lm m M E cm CAA A S um 5 LCU mu i AUU ACU AAU u A Asn Scr E AUC llc ACC c c c Thu E AHA AC AAA A Lys Avg AUU Mcl AL U AAG a U u u mu 1 lt Asp GUC GAC c vm Am Gly mm mm A m um um a Annmm Wm m m m a w mum 1m mum Tum Miliuu 3 39EM Wobble loose base pairing 3rd position of codon less important than 1st or 2nd eliminates need for unique tRNA for each codon a Base puian cl mil glycine mu wdh mrcc a due in wubhlc J on cc mRNA L esu 3 i as Gen 7 m Glycine Hanan and muqu iwnrlcn m 0quot 539 A s dnnnhun Glycine mRNA Goduns cauv Gee cam 55 Glycine max Mlleodanst Icc cm Figure 1119 Gene Structure gene linear sequence of nucleotides with a fixed start point and end point encodes a polypeptide a tRNA or an rRNA cistron gene that encodes a polypeptide reading frame organization of codons such that they can be read to give rise to a gene product 36 Importance of reading frame Reading Reading start Start lr Hr Hr Hr H lr H DNA TACGGTATGACCT l r Mr Jr Jr r r r Hr mRNAAUGCCAUACUGGU UGCCAUACUGGU l 1 Tyr r H TACGGTATGACCT Peptide Mex Figure 1120 Pro Trp Cys His Thr Gly 37 Organization of genes on chromosomes mi for most 1121 WEI h H a pm 7 quot7 F D E l M 4w A organisms g 3 my 1 5 reading frames 7 K 1 5 am c 7 W do not overlap 7 3 723 75 mm m 25 JFM we Mn 195 CyE lt metE 3 m IrA snm Winy rmhwx S alg MA Eamc MG 539 g 9quot t amF MM A H quot 5 We F Flgure 112121 5 m 392 some bacteria and some Viruses have overlapping genes Figure 1121b Procaryotic versus eucaryotic genes procaryotes and viruses coding information is usually continuous eucaryotes most genes have coding sequences interrupted by noncoding sequences exons coding sequences introns noncoding sequences 40 Genes That Code for Proteins t nd that contains coding information and directs RNA synthesis RNA pulylnanul vacugmhun snu Nanxemplau strand quotW RNA poiymerasa blndmg am In bux 45 an 1 DNA 539 a i 1 Coding region Dmuon o ransc puon Transoripnon sum serves as recognition and binding site for RNA polymerase Figure 1122 Bacterial promoters 55 region 10 region T GA AT FINA polymerase recognmon RNA polymerase binding site site GTTGTGTGGAAT 539 CCCCAGGCTTTACACTTTATGCTTCCGGCTCGTAT 339 GGGGTCCGAAATGTGAAATACGAAGGCCGAGCATA CAACACACCTTA 1 Region unwound by Template strand also called Figure 1123 Pribnow box Consensus sequences TGTGAGC 339 ACACTCG 539 Beginning Df RNA chain region that specifies sequence of amino acids in a polypeptide RNA polymnms magnum sue Nanxemalam strand RNA paiymarasa bmmng sna Pnbww box Template 5mm gt35 710 39 1 3 mm 1 l 5 a i 1 i i y 4 Promoter Anhleader Carling regmn Amnme Terminator Ulrezllon a tvansc pnon Transcnptlan sun direction of movement of RNA polymerase Figure 1122 FINA polymmsu vacugm un m Nomzmplaiz smug RNA poiymmse mndmg sns an box Tamplala strand 5 10 1 5 r r y r t t t 3 r l l Coding raglan Anlvlvailar Terminator 9quot l transcription Promoter Anmeansr 6 sequence A W harm recognition site for ribosome nmanan sedan sequence that is not translated Figure 1122 RNA pnlymnvast recogmhun m RNA voiymemse bmdmg slls Pnan box signal for termination of transcription Nomzmplaw sum Template wand 45 4a 1 5 l i 1 I i 1 DNA a i 1 i i i i Promoter Anl ender Coding regiun Dlwcllan o ransc ptlon Transc phan sum Figure 1122 transcribed but 1nRNA sequence is not translated Genes That Code for tRNA and rRNA tRNA genes have 0 u oH n gtoogtnno U promoter mm E leader a Antiman quot n coding EA J spacer and H u I quot quot 5 f 59 trailer regions tRNA U precursor 0 Figure 1 12421 tRNA Ssr Spacer lHNA Thr leader spacer and trailer removed during maturation process 46 rRNA genes have promoter leader coding spacer and trailer regions I I Vail La C4 aml L7 1ur2 0 2 l l 1 l t i if 55 7 Spacer RNA Trailer RNA Figure 1224b spacer and trailer regions may encode tRNA molecules Mutations and Their Chemical Basis mutations stable heritable change in nucleotide sequence may or may not have an effect on the phenotype of an organism 48 Mutations and Mutagenesis mutations can be classified in terms of their effect on phenotype morphological mutations change colonial or cellular morphology lethal mutations kill the organism conditional mutations expressed only under certain conditions eg high temperature 49 Other types of mutations biochemical mutations changes in metabolic capabilities auxotrophs have mutations in biosynthetic pathways cannot synthesize product of pathway require product of pathway as nutrient in minimal growth media prototrophs grow in minimal media without supplements resistance mutations resistance to pathogen chemical or antibiotic 50 How mutations arise spontaneously develop in absence of any added agent usually thought to arise randomly directed adaptive mutation mutations that may resultfrom hypermutation followed by selection induced develop after exposure to a mutagen 51 Spontaneous Mutations result of errors in DNA replication damage to DNA insertion of transposons 52 Replication errors tautomeric shifts keto form gt imino 0r enol form alters hydrogen bonding characteristics of base Figure 112521 2 o H Hare enol form 0 thymine rm H Guanine CH 0 N N Y MN o Tnymine NA H Rare enul arm or guanine 5 53 Outcome of tautomeric shift Hare and temporary enol Wild Iype taulumenc vorm 0i guanme T V v W f A c e T c T c 1 A a DNA Mmanl C G T C mpllcatlun gt DNA rephcauon Parental DNA rm m wud type c c 39 lllKL ersIgenerallon Wquot Wquot progeny llllLgt Secondygan ela on progeny Figure 1125b Replication errors frameshifts deletion or addition of base pairs alters reading frame Figure 1126 S y a GcAAAAAcGTAm slippage leading in an adnilion gt CGTTTT GCAAAAACGYAW slippage in new strand GT C TTT GcAAAAAcGTAm l C TTTTTGCATG slippage leading to a deletion v 539 c e T T T 339 GCAAAAACGTACH slippage in parental strand 539 c a T T T 3 GCAAACGTAC AA 5 CGTTTGCATG 3 GCAAACGTAQ AA Induced Mutations caused by chemical or physical agents that damage or alter the chemistry of DNA or that interfere with DNA repair mechanisms 56 Base analogs similar to nitrogenous bases incorporated into DNA during replication have different basepairing characteristics Srhmmouracil I ks Adamquot quotmar amino stale name to slam Figure 112721 67 Mutagenesis by the base analog 5bromouracil Bu Figure 112713 Specific mispairings occurwhen quot ccscH mutagen AMquot hi CN changes base s structure and pairing oN7N H characteristics EN No e 39 g 39 1 al atl ng NrmanyirN39mitrerNrnitrawguanidme agents CH 0 N c c Q c H I 39 N C N o mathylguanlne Sumelimes I air I N with Figure 1128 quotWquot 393939 quot quot N Intercalating agents planar molecules become inserted between stacked bases of helix distorting DNA cause single base pair additions and deletions eg proflavin and acridine orange 60 DNAdamaging agents severely damage DNA so that it C 0 can t serve as template for replication repair mechanisms allow survival but also cause mutations thymine H dlmer Figure 1129 The Expression of Mutations wild type most prevalent form of gene forward mutations wild type gt mutant form reverse mutations mutant phenotype gt wild type phenotype 62 Forward mutations l arwlzrd Mulalimu Table 112 Summary of Some Molecular Changes from Gene Mum ons 1 pa nmmmmn sinan Nurlualide mummn Suhs mvinns A DNA mu mminn Tmmwhinn Al Fnucin Levrl sum y 4 Numrz mummm Mimm mumwn Nousum luulminn lmmgenic Addmnn ur Deletion M Smeml w Many Nucleuude Pairs Result and Lampli uim nlpl1ivcnrp c wunid c u l unm anaccnl by n nynnmnnc 139 CGV A inc n11ch by A autumn or nynluidm rcl39hwd by a nunnc mm Hula mmmmmm luul GC 7 C mm cmlc mm Tnpm mac hvnlllh39mnl mu Imam IHyrqu 39nlmmmnlud39 AAfLywy mam mic or dimmu um AGA m g 39um acid mlm codcs formava mrmmauon cm mm um mun Immmin in lending um DNA segmunls um uodc rm proluins Reverse mutations Table 112 Slnnmmy of Some Molecular Changes from Gene Mutations 1 a Mma nu mava Mulnlimu Rm a E quotI 39I39mekev MAme WW mmum Mmmx WW mm MW alcchmninn ucm u 7 quot N HGCK yn 39W mm 1 WW quotmum www CGCMrg mm 1 1quot ram nunmu 4 35 mum mm MN m mum rv mhr mm m smv Jlululium Inmlmm 39uppmhwrMIIan H lullchu w ummm Wm mmmwr m H cmlmlInXL39Alnlluucdl mum m hum10m dummy m n 1 haw um um nml g mm mm m lt r autumn SnPnn ssor Mumlons Ntmwmu wpprmm mm lesmlogml suppressors mr mm mm umkrgmm muuuun mum m m L mu m tumble n m Nuxgmn m m u wllh d H ex A ims39n m uminu am uynmm mu pm mmnl mmwnn Mum mump ulinn m m gt39 Iun Adciccl m on L39Ivsuucnl mmway u umulmcmcn hy mum mummniivr wmm uanhnowmur unwrclvum ummwywuw wwodwhur m n valv wumm Vllmuud nmducm mm l mumle mm m lhn39 ungum mvlaln Other mutations regulatory mutations changes in regulatory sequences alter control of gene expression rRNA and tRNA mutations can disrupt protein synthesis some tRNA mutations are suppressor mutations 65 Detection and Isolation of Mutants mutations are generally rare one per 107 to 1011 cells finding mutants requires sensitive detection methods andor methods to increase frequency of mutations 66 Mutant Detection observation of changes in phenotype replica plating technique used to detect auxotrophic mutants 67 Replica plating Tmnlmunl VIE can call mmumlauen suclxas scammm n Ham Valve 5mm Incubauun evilmedj mum mm momm mm mm Mzsler plale um mummy y Iximnn Lys Y mm am All mm gm wmmuw madmm Figure 1131 Mutant Selection use of environmental condition in which only desired mutant will grow eg selection for revertants from auxotrophy to prototrophy Treatment of lysine auxatmphs Lys39 with a mutagsn such as ninusoguanldine or uv ladlauan to amuse mvenanls Plate om mixluve on minimal medium which lacks iyame nly lemmphs able in Syntheslze w w Figure 1132 gt 39 69 Carcinogenicity Testing based on observation that most carcinogens are also mutagens tests for mutagenicity are used as screen for carcinogenic potential eg Ames test 70 reversion rate in presence of suspected carcinogen gt reversion rate in absence of suspected carcinogen then agent is a mutagen and may be carcinogen Figure 1133 Ames Test Cumplele medium plus a all sm amount 0 hislidine Culture n1 Slalm Amqu onela histidine auxmmphs Medium with test mutagen and amount 0 hislidine a small Spontaneous revenams Fievenams in by me mutag duced en DNA Repair proofreading correction of errors in base pairing made during replication errors corrected by DNA polymerase other repair mechanisms repair incorrect pairings and DNA damage 72 Excision Repair corrects damage that causes distortions in double helix eg thymine dimers eg apurinic and apyrimidinic sites eg damaged bases 73 Repair enzyme bound 0 DNA Shand E nucleotides 0 5 side of the dime and a nr 5 nucleotides in 3 side Damaged segment dl uses away DNA polymerase 1 cm gap and DNA ligase seaxs remaining nick Figure 1134 Removal of Lesions photoreactivation used to directly repair thymine dimers thymines separated by photochemical reaction catalyzed by photolyase direct repair of alkylated bases catalyzed by alkyltransferase or methylguanine methyltransferase 75 Postreplication Repair type of excision repair eg mismatch repair system in E coli mismatch correction enzyme scans newly synthesized DNA for mismatched pairs mismatched pairs removed and replaced by DNA polymerase and DNA ligase 76 DNA methylation used by E coli postreplication repair system to distinguish old DNA strands from new DNA strands old DNA methylated new DNA not methylated catalyzed by DNA methyltransferases 77 Recombination Repair repairs DNA with damage in both strands involves recombination with an undamaged molecule in rapidly dividing cells another copy of chromosome is often available recA protein catalyzes recombination events 78 SOS repair inducible repair system used to repair excessive damage that halts replication leaving many gaps recA protein initiates recombination repair recA protein also acts as protease destroying a repressor protein and thereby increasing production of excision repair enzymes 79 3905 Gluconeogenesis The glucon 39 es of the fou DnaK 39ATP 0 DnaJ g Ribcsome cent polypeptide Native protein Am Name Last First Discussion Section Unique Number Discussion Question Set 6 Answer any two questions from the list given below and bring a written printed copy of your answers with you to the discussion sessions this week Mar 1 amp 2 How does ATP influence the reaction catalyzed by phosphofructokinase PFK Why aren t anabolic and catabolic pathways identical ie what is the importance of having a few separate enzymes What are the three major steps in the photosynthetic xation of 002 What is the role of ribulose 15 bisphosphate carboxylase in 002 fixation Summarize the formation of glucose from 002 in an equation Which process is responsible for glucose formation from noncarbohydrate substances Name one reaction in which UDPglucose plays a critical role What is the distribution ofthe following macromolecules in E coli lipids nucleic acids proteins polysaccharides 9 Which macromolecular class predominates in E coli 10Bn39e y describe 0hargaffs rules 11What is meant by semiconservative replication 12 What is the role ofthe following in DNA replication 0ri0 DnaB DnaA ATP 13 In which direction is DNA synthesized How does this relate to nucleotide structure 14Which polymerases acts in E coli participate in chromosomal DNA replication and what is their role 15What are some characteristics unique to oriC 16 How does DNA polymerase overcome the problem of not being able to synthesize primers upon which to build new DNA strands 17What are the roles of the following subunits in DNA replication 6 complex 1 oc NA P F iPF 0 8 18Which factor acts to prime DNA at on39C 19Which activity of DNAPoll allows it to remove RNA primers 20What are two major functions of DNAPol III in DNA replication 21 Why is DNA Pol l necessary for leading strand synthesis 22What is meant by the following the two strands of the DNA double helix are antiparallel 23 Circle the correct answers DNAPol lll adds nucleotides to the 5 l3 end of the leading strand and to the 5 l3 end ofthe lagging strand 24After helicase unwinds the DNA at the origin what prevents the unwound strands from reforming a double helix 25What is the DnaA box Name one characteristic 26Where does chromosome replication in E coli terminate 27What is the role of topoisomerase in initiation ln termination 28 How does the ter sequence work 29 How does Tus affect termination 30What is the role of gyrase in replication termination


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."

Allison Fischer University of Alabama

"I signed up to be an Elite Notetaker with 2 of my sorority sisters this semester. We just posted our notes weekly and were each making over $600 per month. I LOVE StudySoup!"

Bentley McCaw University of Florida

"I was shooting for a perfect 4.0 GPA this semester. Having StudySoup as a study aid was critical to helping me achieve my goal...and I nailed it!"

Parker Thompson 500 Startups

"It's a great way for students to improve their educational experience and it seemed like a product that everybody wants, so all the people participating are winning."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.