New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here


by: Renee Lehner


Marketplace > University of Washington > Biology > BIOL 355 > FNDATION MOL CEL BIO
Renee Lehner
GPA 3.73

Rose Cattolico

Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

Rose Cattolico
Class Notes
25 ?




Popular in Course

Popular in Biology

This 9 page Class Notes was uploaded by Renee Lehner on Wednesday September 9, 2015. The Class Notes belongs to BIOL 355 at University of Washington taught by Rose Cattolico in Fall. Since its upload, it has received 59 views. For similar materials see /class/192306/biol-355-university-of-washington in Biology at University of Washington.




Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 09/09/15
The Endosymbiont Hypothesis 1 The ancestors of chloroplasts and mitochondria were prokaryotic organisms 2 These prokaryotes were sequestered by primitive nucleated cells 3 The symbiotic relationship among these organelles nucleus chloroplasts and mitochondria became obligate FROTOEU KARYOTE Mitochondrion l5 billion years ago Timed with large amonts of O2 entering Aernblc h h purple mb bacteria t e atmosp ere OXVGEN 20 LEVELS IN start of apld 02 TMOWHERE accumulation F52 l 10 ln oceans used upl Pnorusymneiic T39ME mmosls cyanahacreria gi39b g 46 36 25 16 6 I l l l i resent i T w firsi first watersplitting D i ormalion living photosynthesis rst D of the Earth Cells releases aerobic venebrales n m rcmumplas respirailon first multicellular g becomes plants WK 1 M ommm 5 ph gjfsymhe m widespread and animals formation of origin of eucaryotic oceans and photosynthetic cells Wu Psalsnn rlcmncumnn A llghlsmsnmu continents Historical late 1800 R Altman developed a stain that was speci c for bioblasts C Benda rst used the term mitochondria mito thread chondos granule L Michnelis applied the Vital dye Janus Green B dye is colored when oxidized proposed that organelles are the site of oxidationreduction in the cell Size about the same as a bacterium 05 to 10 um wide and 3 um long Location often where energy requirements are the highest contractile apparallls mitochondria i K Vquot Hagellar core 7 39 myoflbrll 1A B mum 1412 Essemlal Cell amlugv 2e a 2mm Banana 5mm CARDIAC MUSCLE CELL SPERM TAIL Number varies widely from few to thousands 1 in Chlamydomonas 100 plus in spinach leaf cell Figure 1443 Molecular Biology orme Cell 4m Edition Number can vary over life time of cell 45Lde 0 m Plasticity Spin and contort through endless shapes pm mm mm A W 11th m enmmm z mum Rerpmuua mum demand m mm mm gunman Cm alde 7 hmzlhl mzmhxamx an mauver asked mum Tuhnhl m Sameumzxmdzn xamznmexnm Sammsz gun nuculamd 1 e mum hnmx numb a m Function transfer to a medium of high osmolarity causes shrinkage densitygradient centrifugation separates the outer membrane from the dense matrix and its surrounding inner membrane disruption and centrifugation separate inner membrane from matrix components NNE MATRIX OUTER MEMBRANE MEMBRANE Figure 14 7 pan 2 of iv y 1 l intern EmDrane I my mamwa e 39 space i V 39 I l Creatrne kmase Adenylate maze JAOHcy tocnrome r xvscwd r aae New i 39i nsensrtu Cytochrome b Acylvcoenzyme A synthetase Monoamme cxl ase Kynuremne hydrnxyiase Inner membrane l Cytochrome b c C1laq i Succmale dehydrogenase NADH dehydrogenases l rotencnesensrtwe Pyruvate oxidase Carmtrne acyltransierase i nydroxyautyrate and Bhydroxyorooronate 39 dehyorogenases ATPsynthesmng enzymes Matrix Citrate synthelase conitase lsocitrate dehydrogenase umarase Malate dehydrogenase Glutamate dehydrogenase Aspartate aminotransferase Pyruvate dehydrogenase complex Enzymes of protein and nucleic acid synthesis Enzymes of fatty acid oxidation Tra nsport protein Figure 54 Cell and Molecular Biology le E 1005 John Wiley amp Sons Outer membrane Plasma membrane 1 Regulation of cellular ionic composition Very low calcium concentration in the cytoplasm need a translocase accumulate calcium phosphate get dense granules of calcium phosphate in the mitochondrial matrix storage function needed for bone formation egg shells scale construction inner membrane i Gute membrane 1 my Ana Mitochondrian is a semieautonomous organelle Complex I Complex m Complex II Complex IV mun cymluomebe sumnau cyuomromu nahymgenm dehydvogvmase Oxidasr susuNws Mammalian mom 7 1 n 3 NA 35 m 4 m TOTAL 5 u 4 13 MalKnlnrmass Dal woomon 24uooo 425090 autumn anquot m unuamummmm Hummmmllymm DNA Multiple copiesorganelle 2 to 6 Frequently circular Can be concatenated linked together 1pm Figure 1452 Molecular Biology of the Cell 4N1 Edition Sma laaps math or are parts of ZSkb m Fxg 1 EM shawmg a segment Ufa puri ed c fmclculnm hnemplast DNA momk mxmcucles and lung sums threading througm the momk 32 kb m axxcucles EM by D me P e xeeraxgn A a c u 50 gt Marchantia Rickettsfa a Schizosaccharomyces pombe Tetrahymena O Heclinarnonas a Human O Acanthamoeba Plasmodiurn Chlamydomonas Arabidopsfs Figure 14 55 Molecular Biology of the Cell 41h Edition Plants FISSION mitochondn al H W xTr TA Bl E l gf l l cyx r lt4 EM lg ng lAl FUSION R 04 um mum umwmmwm mmmm 7 mm Figure 1475 Molecular Biology of the Cell Mh Eamon Brassica campesttis 218 kb Tnicum cestiVum 430 Cucurbitacea 2700 al a a c u r u c a a I a a a a 6 arm o r a l l l l l c Au quot a a l c l n l l a z w 1 I a 91 l e v a en a a in a a b i 39 Q E h a l Q2 2 D al 5 H l Unusual Features 1 Genetic code mitochondria do not follow code used in the nucleus Mitochondrial Genetic Codes 1 Universal Genetic Cad Lu39ld Tm Table 94 Differences BLIWLL Codon lian Yeast Mitochondrial Code Mitochondrial Code Universal Code Tm Tm M 21 Me Leu m STOP Arg STOP He Leu Arg llalic type indicates mm the code differs from the universal code 2 Split genes genes may be present in dispersed pieces scrambled not in a linear array must be assembled after transcription 1 subunits 01 1 ATP svnmase I cytochrome oxidase subunits NADH NACH dehydrogenase dehydrogenase m proteinrcoding regionsHG total suhumts subunits tHNA gene122 tutal i total length of genome 161569 base nairs S rRNA origin of replication Fxgum 1458Mulauu14r Biulugy or he Cell411lEdiiuu 3 Editing Alters information of a gene Occurs postitranscripu39onally Effects amino acid sequence of the protein creates initiation and termination signals Types of editing a Change a nucleotide number of adiiing sites u uc Gene silent n0nsilenl and 7 Z 40 7 29 w y 23 r r 25 v 2 2 22 g 1 21 A A 4 13 1 3 12 21 r 3 17 23 1 6 17 20 1 13 14 4 10 3 1 Z 3 l 7 2 3 9 1 8 S 3 S 9 r 2 5 4K 7 14 33 46 6 39 16 A 3 13 55mm JarrRNA39 Z SrRNA39 l 1 b Inserting a nucleotide mm mm mmM PruLu39a DNA meA M s x L 1 5 ATGACCTTTAAAGAAGATTTTGTAAATTCTATCTTAACTTCT ATGAC YTTAAACAAGATTTTGTAAATTCTATTTAACTTCT i 1 i a L GGTAAAAGTATCGGTGCTGGTTTAGCAACAATCGGATTAGCA GGYAAAACITAT CGTGCTGGTTTAGCAACAATGGATTAGCA 139 F G s L v GGTGCTGGTACCGGTGTTGGTATTGTTTTTGGTTCTCTAGTT A GGTGCTGGTAC GGTGTTGGTATTETTTTTGGTTCTf TAGTT F F TTTGGTTTAAGCCGTAATCCGGCAGAAGAACAACGCTTATI T TTTGGTTTAAGCCGTAATC GGCAGAAGAACAACGCTTATTT 1 K A M L G F A AAGTATGCCATGCTTGGGTTYGCTGTAACTGAAGCTGTCGCG TATGCTATEETYGGGTTYGCTGTAACTGAAGCTGTfGCG i A F L CYTTTGGCTTTGATGATGGCTTTTTTGATTCTTTTTGGATAA TYTGGCTTTGATGATGGCTTTTTTGATTCTTTTTGCATAA B Male 0 Female Gold Inc catc39 natal11d lineage Organ System Possible Problems Brain Deyeiopmentai deiays mentai retardation dementia seizures neuror psycniatric disturbances atypicai cerebrai palsy migraines strokes n Hr nzthi main ah ntr gastrointestinal probiern gastroesopnogeai re ux deiayed gast in i constipation pseudorobstruction fainting absent or Sweating resuiting in temperature regulation probierns Nerves ric eXCeSSWe o 3 u Muscles Weakness hypotoma cramping muscie pain Kidneys Proximal renai tubuiar Wasting resuiting in ioss of protein magnesium phosphorousi caiciurn and otnereiectroiytes Heart Cardiac conduction defects neart biocksi cardiomyopatny Liver Hypogiycemia iow biood sugar iiyer taiiure Eyes visuai ioss and biindness Ears Hearing ioss and deafness PancreasDiabetes and exocrine pancreatic failure inabiiity to make digeSWe How would you determine the number of mitochondria in a plant cell Hint check out text for staining and microscopic methods


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Bentley McCaw University of Florida

"I was shooting for a perfect 4.0 GPA this semester. Having StudySoup as a study aid was critical to helping me achieve my goal...and I nailed it!"

Anthony Lee UC Santa Barbara

"I bought an awesome study guide, which helped me get an A in my Math 34B class this quarter!"

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."

Parker Thompson 500 Startups

"It's a great way for students to improve their educational experience and it seemed like a product that everybody wants, so all the people participating are winning."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.