New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

Plant Geography

by: Etha Kassulke

Plant Geography BOTANY 422

Etha Kassulke
GPA 3.83


Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

Class Notes
25 ?




Popular in Course

Popular in Botany

This 4 page Class Notes was uploaded by Etha Kassulke on Thursday September 17, 2015. The Class Notes belongs to BOTANY 422 at University of Wisconsin - Madison taught by Staff in Fall. Since its upload, it has received 53 views. For similar materials see /class/205331/botany-422-university-of-wisconsin-madison in Botany at University of Wisconsin - Madison.


Reviews for Plant Geography


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 09/17/15
Cryptic invasion by a nonnative genotype of the common reed Phragmites australis into North America Kristin Saltonstall Department of Ecology and Evolutionary Biology Yale University P O Box 208106 New Haven CT 0652078106 Edited by Barbara A Schaal Washington University St Louis MO and approved December 6 2001 received for review September 10 2001 Cryptic invasions are a largely unrecognized type of biological invasion that lead to underestimation of the total numbers and impacts of invaders because ofthe difficulty in detecting them The distribution and abundance of Phragmitesaustralis in North Amer ica has increased dramatically overthe past 1 50 years This research tests the hypothesis that a nonnative strain of Phragmites is responsible for the observed spread Two noncoding chloroplast DNA regions were sequenced for samples collected worldwide throughout the range of Phragmites Modern North American populations were compared with historical ones from herbarium collections Results indicate that an introduction has occurred and L i rLJri J W ii r44 to regions previously not known to have Phragmites Native types apparently have disappeared from New England and while still present may be threatened in other parts of North America iological invasions threaten species and ecosystems world wide An estimated 50000 exotic species have been introduced to the United States ofwhich 5000 are plant species that have escaped and now exist in natural environments Both the actual number of invaders and the impacts of these species may be underestimated because of the presence of cryptic invaders or species that cannot be easily classified as such invasions in marine ecosystems 476 and demonstrated both genetic and physiological differences be tween invading and native populations Given that cryptic invaders typically are unreco 39 d or are mistaken for native species knowledge of historical trends in geographic distribution and population genetic structure in cases of suspected introduc tions are of particular interest when trying to reconstruct the invasion history of a species In such cases museum or herbarium specimens are an invaluable resource for reconstructing popu lation history reed Phragmites australis Cav Trin ex Steudel hereafter referred to as Phragmites has a cosmopolitan dis tribution an is a undant in marsh communities and along the borders of lakes ponds and rivers It is a perennial grass that reproduces primarily through vegetative growth although dis persal by seeds may occur at low frequencies In North America the fossil record indicates that it has been present in the southwestern United States for at least 40000 years Paleo ecological investigations have shown it to have been present along both the Atlantic and Pacific coasts for several thousand years 8710 However over the last 150 years its distribution and relative abundance has increased dramatically particularly along the Atlantic coast Botanical records from the 1800s typically describe Phragmites as being rare or not common 11714 and a historical gap in its distribution was found in the southeastern states 15 By the early 1900s the species was considered more common and spreading 16 17 Today it exists in all of the mainland United States as well as throughout southem Canada and is considered an indicator of wetland disturbance It is also expanding into undisturbed sites particularly in inland areas To vwvw pnas orgcgidoi101073pnas 032477999 explain the spread of Phragmites it has been suggested that the rapid expansion could be the result of human activities causing habitat disturbances or stresses such as pollution changes in hydrologic regimes and increased soil salinity 18 Alterna tively nonnative genotypes of the species may have been introduced to North America sometime during the past 200 years 19721 although to date no studies have adequately supported this hypothesis This research asks the question of whether or not nonnative strains ofP australis exist in North America by using sequenc ing of two chloroplast DNA markers Although the rate of evolution of the chloroplast genome is relatively conservative variation has been found in chloroplast DNA at the intraspe cific level 22 It is maternally inherited in angiosperms and has been shown to be geographically structured in a diverse array of plant species 23 24 and therefore is an effective marker for use in the study of intraspecific phylogeography In this study modern samples ofPhrtzgmites collected across the continent were compared with historical specimens collected before 1910 to examine changes in the genetic structure ofthe North American population over the past 150 years Modern samples were also obtained worldwide for comparison and to determine the source of the introduction Materials and Methods Leaf tissues were collected from green Phragmites plants during the growing seasons of 199772001 by the author and collabora tors worldwide with a particular emphasis on obtaining samples from the presentday range of Phragmites in North America and Europe When available herbarium specimens also were ob tained to increase the number of samples from locations outside of North America Fresh specimens were dried by using silica gel and frozen on receipt in the laboratory Total DNA was ex tracted from 2 cm2 of fresh or dry leaf tissues using a 2 cetyltrimethylammonium bromide extraction protocol 25 Herbarium specimens were pretreated by scrubbing with 10 bleach to remove mounting glue placed under an UV light for 5 min to remove surface contaminants and extracted by using the same protocol All herbarium samples used in historical comparisons were collected before 1910 which is before the time period when references to expansion of Phragmites populations began to appear in the literature 16 Where possible modern samples also were collected at sites from which herbarium samples were obtained Sample collection locations herbarium accession numbers and haplotype designations for each sample are available on request This paper was supmmed directly Track II to the PNAS office Data deposition database acceSlon nus AY0163Z47AY016323 AY0163327AY016335 and AE4573827 AE457402 quotEsmail krislin sallonslall yale edu Th ph hls 39 H Jinparlbypg h a p This article must therefore be hereby marked quotadvertisementquot In accordance Wllh 18 u s c 1734 solely to Indlcale this fact PNAS l February 19 2002 l vol 99 l no 4 l 2445 2449 Q S n o n BIOLOGV networks were obtained with the software T05 29 using h algorithms of Templeton et 22 30 Haplotype diversity meae sures 31 analysis of molecular variance 32 and an exact test for population differentiation 33 were calculated by using ARLEQUIN z 000 34 All analyses were performed on the com bined data set Neumenearuapinygss haplotypes with fewer copies of the indel 2s Parsimony t e t samples er a igne the most likely h l as b on the available sequence and i in The are 26 variable characters of hi h 15 are indels four type Ia which are mononucleotide repeas Fig 1 Parslmony network ofPhragmltexmloroplasthaplotype diversity and nine type Ib which are deletions or duplications of 39 type 1 which are all other types substitutionsEleven aplotypes unique to North America haplotypes AaH s z and AA and are considered to be native to the continent These 11 are distinguished from all other haplotypes by five shared indels two type I o e two lotype represent one mutational dll fereme rolloWing odlng or lndel a of indels 35 and 11 are base lngle harader Unlabeled node lndKale lnferred step not round n the sampled populatlon Loop in the network are the result or homoplasle in the number or repeat in some lndel rne awestral haplotype orroot ortne ri a rllt u l land v Europe Leo and AwayAustralia l J L M o P Q UV and x have a Widesplead diSlllbullo 0quot multiple Co ll e ls half Aera K M R andv lotypes I and M with haplotype M being the most common type in North America Europe and Asia today Table 1 This type is most closely related to other haplotypes found in Twe quotOHCPdi g chloroplast regions were PCRramplified by Europe Asia and Africa Fig 1 It is also the predicted usmg the prlmer pans tmTUGU aquotacrnLUAA5 b 26 ancestral haplotype based on coalescent theory 36 and rbcLepscr 27 with annealing temperatures of 56 C With n orth America the exact test of population differena and 54 C respectively Smaller fragmerm were amplified in tiation indicates significant changes in aplotype frequencies the herbarium samples by using the primer pairs tmTUGU between the historical and modern samples P lt 0001 33 Fig aquotmTaR5 aTAGATTATTI TCCCAFCN I rUAA 2Thep L 39 L a widespread distribution b39ltranR 5CGGAGAAGATAGAATCATAGC VEELZF of the 11 native haplotypes across North America from New 5 aCGCAGCTTGTGAAATATGG45 L2R S LCGTATTTL England west to the Pacific coast Fig 2a Haplotype 1 which GATTCCATTATCGT and psuIZF S39VTGTCATAGAATV also is found in South America and Asia Fig 1 was distributed AGGTGTCTCepsuI2R 5 aGATTAGAAGGATAGAAe along the Gulf Coast Haplotype M was found at foursites of the AGGC whichwere designed around the variable regions found 62 sampled New Haven CT Madison CT Camden NJ in the larger fragmens Doubleastranded PCR amplifications Chesapeake Beach g 20 In comparison whereas the were sequenced directly in both directions on an Applied native haplotypes and haplotype 1 remain throughout much of t e L two internal primers in t e chme region rpL23F 5t ofexpansion in the range of haplotypeMFig2c and d This GTAGTAGCTGTGAATAGC and rpL23R S VAGTCGATe pe has replaced native s in New England and expanded to GGCTATTCACAGC In total about 2000 bp were sequenced the southeast where thgmltes historically did not grow It is ri for each modern sample an 400 bp for herba um samples presently expanding to the west and becoming prevalent in the Because of the high incidence of large insertiondeletio Midwestern states mutations indels sequean were aligned by e e with SE7 Measures of h plotype diversity show a decline in diversity QUENCHER 1 Two mononucleotide repeat regions in the tmL between the historical population and the pr t 080 004 region which showed intrahaplotype ength variation were not vs 0 58 0 04 Further analysis of molecular variance shows used when 39 ishing hapl distingu otypes Before analysis all indels that amongrpopulation variation accouns for a larger proporr were coded as single characters to treat indels 39 L M 39 L L 39 39 L 39 39 39 L rather than multiple independent evens Where indels were the modern population 79 when compared with worldwide compose o several copies of a multipleasite insertion each populations P lt 0001 indicating that today the genetic copy was treated as a single unit and gaps were inserted in m L Am ri an 39 39 Table 1 Frequencies of Phragmifes haplotypes worldwide Totalno of quot0 Regional Geograpl39m region sample haplotype quot0 Haplotype l quot0 Haplotype M North Amerla after l96o l9s 3l 3 7 2 6l 5 North Amerla before l9lo 62 33 9 9 7 6 4 South Amerla ll 27 2 72 7 0 Europe Al 39 o 0 6l 0 AxleAustralla 27 55 6 ii i 33 3 Aera 9 33 9 0 ii i l lll 2446 l vvvvarlasorggldollol073pn35032477999 Saltonstall and on several islands in the southern Pacific The distribution of this type in North America appears to be the same as the Gulf Coast phenotype identified by Pellegrin and Hauber 20 based on isozyme hese data support their suggestion that the presence ofthis type in a wide variety ofhabitats across southern North America may be the result of the establishment of a single genetic lineage with broad ecological tolerances that has spread throughout the region However because of its prevalence in other parts of the world it is not possible to assign haplotype I to a category of native or introduced to North America although its distribution remained the same between the historic and modern samples Fig 2 a and 0 Given that its mostly closely related haplotype is found only in Asia Fig 1 it is possible that haplotype I originated there but it is not known when it arrived in North America The 11 native North American types show little change in their distribution between the historic and modem samples from the Midwest to the Pacific Coast Fig 2 a and 0 However the three native haplotypes that were found in the historical sample from southern and central New England were not detected in the modern sample despite resampling of all of the sites from which 19thcentury herbarium specimens were available Fig 3 Fur ther haplotype AA was restricted to this region in the historical samples and is not found in any of the modern samples Thus in addition to local changes in haplotype frequencies extinction of Phragmites lineages may have occurred over the past century Native haplotypes were found in only two sites along the Atlantic coast Allen MD and Chance VA in the modern sample in contrast to their widespread distribution throughout eastern North America in the historic sample Fig 2 a and c The lack of persistence of native types is surprising given the clonal nature of this species and suggests that haplotype M is highly compet itive and aggressive This is further evidenced by the rapid replacement of native lineages by the invasive one seen in marshes of Connecticut and Massachusetts by 1940 Fig 3 The rapid proliferation of haplotype M throughout the At lantic Coast could result from either an introduction of this type from elsewhere or a range expansion of an existing native type Because this haplotype was present in historical samples it is possible that humaninduced changes in the landscape or other unidentified causes gave it an advantage that allowed it to expand rapidly It is more likely that an introduction of Phrag mites has occurred because haplotype M shares none of the mutations that link the 11 native North American haplotypes it it is most closely related to EurAsian types Fig 1 and iii population structuring has declined significantly between the pre1910 and modem samples from North America This intro duction probably occurred sometime during the early part of the 19th century most likely at one or more coastal ports along the 1 Mack R N Simberloff D Lonsdale W M Evans H Clout M amp Bazzaz F A 2000 E4472 AppZ 10 6897710 Pimentel D Lach L Zuniga R amp Morrison D 2000 BiaSeienee 50 53765 Carlton J T 1996 Ee47247gy 77 165371655 Geller J B Walton E D Gorsholz E D amp Ruiz G M 1997 M472 E5472 6 9017906 Bastrop R Jurss K amp Strumbauer C 1998 M472 Bi472 Ev472 15 977103 6 McIvor L Maggs C A ProVan J amp Stanhope M J 2001 M472 E5472 10 9117919 Hansen R M 1978 Pa2e475i47247gy 4 3027319 Niering W A Warren R S amp Weymouth C G 1977 C47nneetiei4t Arhmetum 31122 22 2712 F SNN 5quot pad 9 Orson R 1999 BiaZ Inv 1 1497158 10 oman M amp Wells L 2000 Quat Res 54 2067217 11 Torrey J 1843 f2477a 47ftne State 47fNew Y477k Carroll and Cook Albany 12 Willis 0 R 1874 Cata247 i4e 47fP2ants G747wing Witn47i4t CuZtivati47n m the State 47f New Jersey J W Schermerhorn New York 13 MaCain J 1883 Cata247gi4e 47f Canadian P2ants Part 1 P472ypeta28 Dawson Brothers Montreal 2448 i vwvw pnas orgcgidoI101073pnas 032477999 Atlantic coast In the 1800s Phragmites was documented growing in places where ships ballast was dumped or used to fill marsh lands being converted to railroad and shipping hubs 38 Because Phragmites already grew in coastal marshes as a native component of the plant community and the introduced variety showed little or no morphological differences with native types the establishment of nonnative populations was not recognized After several decades of persisting in low densities rapid ex pansion of the type began and was probably facilitated by human dispersal by means of the widespread construction of railroads and major roadways across North America in the late 19th and early 20th centuries Given the aggressive patterns of spread seen over the past century it is likely that this expansion will continue to occur into western and northern parts of the continent The presence of native Phragmites lineages throughout these areas will only complicate efforts to control this spread It has been difficult for scientists to predict whether or not a species will become invasive upon entering a new habitat Detection of cryptic invasions is critical for quantifying both the numbers of invaders and their impacts For species with wide spread native distributions genetic diversity may play an impor tant role in their behavior when establishing at new sites Differences in physiological tolerance and behavior may give nonnative genotypes unforeseen advantages allowing them to proliferate and changing the genetic structure of the species This study presents compelling evidence of a cryptic invasion in a terrestrial plant species This invasion is on a scale comparable to if not greater than other known wetland invaders such as purple loosestrife Lythrum salictzritz and salt cedar Tamarix sp but appears to still be in a phase of expansion into new areas It is important to recognize that the structure and function of native terrestrial communities may be influenced by both cryptic and easily recognized invaders Thanks to J R Powell G Caccone D Skelly M Donoghue J Gleason J S Hall and two anonymous reviewers for comments and discussions J R Powell kindly provided the laboratory space and facilities for this work I thank the US National Herbarium Harvard University Her baria New England Botanical Society George Safford Torrey Herbar ium at the University of Connecticut Connecticut Botanical Society and Yale University Herbarium for providing herbarium samples This research was funded by an Environmental Protection Agency Science to Achieve Results graduate fellowship The Nature Conservancy Connect icut chapter The Long Island Sound Fund administered by the Con necticut Department of Environmental Protection through the sale of Long Island Sound license plates and contributions the New Jersey Public Service Electric and Gas Company and the US Fish and Wildlife Service through the Biological Control of Nonindigenous Plant Species Program at Cornell University and the National Oceanic and Atmospheric Administration Office of Sea Grant and Extramural Pro grams US Department of Commerce under Grant MERPSG 99721 14 Dame L L amp Collins F s 1888 F2477a anddZesex C47i4nty MA Middlesex Institute Malden MA 15 Hitchcock A S 1935 ManuaZ 47f the Grasses 47f the United States US Goverment Printing Office Washington DC Misc publication no 200 16 Graves C B Eames E H Bis C H Andrews L Harger E B amp Weatherby C A 1910 Bu22etin 47ftne C47nneetiei4t Ge47247giea2 and NaturaZ Histary Survey N47 14 Case Lockwood Brainard Hartford CT 17 Stone w 1911 1910 AnnuaZ Rep477t 47ftne New Jersey State Museum New Jersey State Museum Trenton 18 Marks M Lapin B amp Randall J 1994 NaturaZ Area I 142857294 5474 15176 20 Pellegrin D amp Hau 63 2417 9 21 Chambers R M Meyerson L A amp Saltonstall K 1999 Aquatic B47t 64 2617273 22 Soltis D E Soltis P s amp Milligan B 25 Doyle J J amp Dickson E E 1987 Tam 36 7157722 32 Excoffier L Smouse P amp Quattro J 1992 Genetics 131 4797491 26 Taberlet P Gielly L Pautou G amp Bouveg J 1991 P201722 M472 31472 17 33 Raymond M amp Rousseg F 1995 Ev472utz47n 49 128071283 110571109 34 Schneider 5 Roessli D amp Excoffier L 2000 ARLEQUIN A S47 wme f477 27 Saltonstall K 2001 M472 E5472 N472es 1 76778 P47pu2ati47n Genetics Data AmZysxs Genetics and Biometry Laboratory Univ 28 cGuireG DenhamM C ampBalding D J 2001 M472 Bx472Ev472 184817490 of Geneva Geneva version 20 29 Clement M Posada D amp Crandall K A 2000 M472 E5472 9 165771660 35 Golenberg E M Clegg M T Durbin M L Doebley J amp Ma D P 1993 30 Templeton A R Crandall K A amp Sing C F 1992 Genetics 132 M472 Phy247genet Ev472 2 52764 6197633 36 Castelloe J amp Templeton A R 1994 M472 Phy247genet EM 3 1027113 31 Nei M 1987 M472eeu2m Ev472utx47mry Genetics Columbia Univ Press New 3 Bahrman N amp Gorenflot R 1983 Rev GeneraZ B472 90 177 84 York 38 Burk I 1877 P7475 Aead Na22 Sex PhiZadethm 29 1057109 Saltonstall PNAS l February19 2002 1 vol 99 l no4 l 2449 POPU LATION BIOLOGV


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Bentley McCaw University of Florida

"I was shooting for a perfect 4.0 GPA this semester. Having StudySoup as a study aid was critical to helping me achieve my goal...and I nailed it!"

Amaris Trozzo George Washington University

"I made $350 in just two days after posting my first study guide."

Jim McGreen Ohio University

"Knowing I can count on the Elite Notetaker in my class allows me to focus on what the professor is saying instead of just scribbling notes the whole time and falling behind."

Parker Thompson 500 Startups

"It's a great way for students to improve their educational experience and it seemed like a product that everybody wants, so all the people participating are winning."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.