New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

Week Three Notes

by: kylie1993

Week Three Notes ZOO370

GPA 3.0
Cell Biology
Dr. Lisa Montplaisir

Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

Compiled is week three of notes-- Contains information on hypertonic solutes, proteins/enzymes, how cells communicate
Cell Biology
Dr. Lisa Montplaisir
Class Notes
cells, Proteins, Enzymes, hypertonic, solutes, concentration gradients, communication
25 ?




Popular in Cell Biology

Popular in Science

This 8 page Class Notes was uploaded by kylie1993 on Thursday September 17, 2015. The Class Notes belongs to ZOO370 at North Dakota State University taught by Dr. Lisa Montplaisir in Fall 2015. Since its upload, it has received 22 views. For similar materials see Cell Biology in Science at North Dakota State University.

Similar to ZOO370 at NDSU


Reviews for Week Three Notes


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 09/17/15
200 370 Cell Biology Notes Tuesday September 8 2015 FRAMING QUESTIONS 1 What is referred to as the central dogma of molecular biology 2 What processes are involved 3 What macromolecules are involved Draw two amino acids sidebyside rgroup l Ca rboxyl Group I H Amine Group The amine end joins to the carboxyl group to make dehydration reaction What structural form is DNA in the nucleus Chromatidschromosome Structural DNARNA differences Uracil is in RNA RNA is single stranded while DNA is double stranded Steps for DNA to become RNA 1 Denaturationbreak hydrogen bonds with a proteinenzyme helicase 2 enzyme involved in copyingcomplimentary to one strand DNA double helix 9RNA single strand A T C G G C FORMS COMPLIMENT U A G C C G Amino acids are then put into the chain from RNA AUGCUACUCMETLEULEU How big is each genetic word 3 letters long How is there redundancy in the dictionary How do the changes in spelling of the world impact the action of the process Can get same product from different wordscodons Each different letter changes the type of molecule amino acid The first and second ones are the most important and the third is the least important There are 2 start codons 3 stop codons and 64 words in the dictionary FIGURE 316 Telomerase enzyme that aids in making telomeres at ends of chromosomes they shorten as we grow older start to shorten to coding sequences Figure 312 Similarities in single stranded molecules Move from sugar to phosphate sugar to phosphate The nucleotide nitrogen base attaches to the sugar with phosphodiester bonds between Importance of how specific nucleotides bind together the way they do Nature allows complete uniformity of nucleotides Guanine2 ring structure that bonds with adenine1 ring structure Directionality matters and creates uniformity 5 end 3 end 5 end 5 end If they are the same direction they do not make the correct shape Nucleotides in the middle are hydrogen bonded together FIGURE 319 Each glucose is a high energy storage molecule When linked together they form starches E potatoes and corn Carbohydrates are easier to break down faster Animals store glucose molecules in the form of glycogen muscle cells liver cells and quick for energy use Starches are produced in photosynthesis and at night move to regions in a plant that can be stored can form structures cell walls etc Ruminants each cow stomach produces different enzymes to digest celluloseglucose plant molecules FIGURE 327 Common types of fats If you don t take in fats the body will automatically make them Visceral fats protect around organs and minimize friction FIGURE 330HormonesSteroids are types of fats Thursday September 102015 FRAMING QUESTIONS 1 How is quotgenetic language used in living organisms 2 What are possible outcomes of life by changing that genetic language 3 How do cells communicate Peptide chainsbonds are formed Dehydration reaction and Translation NOTE New amino acids are always added to the carboxyl side CTerminus end Yet the order that they are added in depends on the DNA Collagen long stringy fibrous found in skin and surrounding muscles 0 If you change the structure then you are changing it s function Sickle Cell Anemia Example Changing a single amino acid changes entire structure of tertiary structure this makes them want to come together and makes them crystallized and long more likely to clump together We don t want them long and stringy we want them round and pliable M mar 39039s a Cell Things leave between cells or diffusing across the cells cells easily get caught between these capillary beds How does an amino acid change A mutation at some point Central Dogma DNAinfo storage gt mRNA info carrier gt proteins active cell machinery Transcription Translation DNA ATGCGTTTTACAGATCCATCA Transcription to MRNA always Uracil instead of Thymine UACGCAAAAUGUCUAGGUAGU Translation to protein code for with 3 letter codons TYR ALA LYS CYS LE U G LYSER PRACTICE IN REVERSE ASNLYSPROTHRLEUTYRMET Translation to mRNA AAuAAgCCgACcCUgUAuAUG Transcription to DNA TTA l39l39CGGCTGGGACATATAC Many factors impact permeability 1 Number of double bonds between the carbons in the phospholipids hydrophobic base 2 length of tail 3 number of cholesterol molecules in the membrane 4 temperature ProteinsWhat are they Multiple polypeptide chainsamino acids in a unique shapeunique sequence doing a unique function How are they involved in reactions Nothing happens without proteins Enzyme catalyzingenzyme speeds up reaction and lowers activation energy The presence shortens transition state nothing used from enzyme provides a space in which reactions happen September 15 2015 FRAMING QUESTIONS 1 How do cells communicate 2 What types of variables affect cellular communication Enzymes there are unique features for each enzyme that responds to different ratestemperaturesPH levels Can have such different PH levels in different organisms look at stomach PH levels places that are warmermore active have different enzymes than say small intestine lower PH colder mtonarmehaul 613C quot 6503935 CR 12 and W pew m5 5 4er cu form newton What types of communication may have to happen in cells positive and negative feedback Cells communicating Within Itself 1 Central dogmacell talking to itself and translatingtranscribing into protein 2 Organelle packagingin golgi apparatus 3 Cell respirationphotosynthesisgt produces glucose 4 Endoexocytosis Within a distant cell 1 Needs reaction mechanismreceptorchannelrecognition componentconcentration gradient Within a neighboring cell 1 Has to have bilayer on product and be able to pass through cell membranes 2 Golgi packages and sends out of cell to enter another 3 Sodiumpotassium channel Thursday September 172015 FIGURE 71A and 71B don t need transport proteins through some cells attached to eachother plasmodesmata They are joined together so that information and things move freely Cells and cellular components are able to accumulate a variety of substances in concentrations that are very different from those of surroundings How are three protein channels similar or different Different amino acid sequences and different recognition sites on each of these w Uniport one direction Symport coupled Antiport moving opposite Directions 02 cl COZ cl C02H20gtH HC03 02 C02 C02H20gtH HC03 Cell anbrane to regulate a gradient tells us that regulate concentration gradient concentrations are different Can tell there is a reversible reaction of some type here Passive transportno protein visible no ATP shown no information here to tell us this Where would find high concentration of C02 and high 02 inside Capillary beds then opposite environment suit In the body tissues they are already loaded with 02 in the cell It will leave the body tissues to red blood cells and move to lungs n metabolic tissues in body avioli region of lungs the C02 on inside and 02 on outside 02 is low where there has been active cells In the antiport not changing chemical gradient but changes concentration gradient so that 02 and C02 can come into the cell Can add activatorsinhibitors to make sent in more C02 and 02 cue that regulation site could be gated because there are charges on the transport Glucose Transporter 2K 3NA Hypertonic if water is leavingsolute concentration outside is higher than the solute concentration inside of a cell


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Bentley McCaw University of Florida

"I was shooting for a perfect 4.0 GPA this semester. Having StudySoup as a study aid was critical to helping me achieve my goal...and I nailed it!"

Amaris Trozzo George Washington University

"I made $350 in just two days after posting my first study guide."

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."

Parker Thompson 500 Startups

"It's a great way for students to improve their educational experience and it seemed like a product that everybody wants, so all the people participating are winning."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.