New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here


by: Kavon Huel


Kavon Huel
GPA 3.59

Allison Robert Donald

Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

Allison Robert Donald
Class Notes
25 ?




Popular in Course

Popular in Biochemistry and Molecular Biology

This 29 page Class Notes was uploaded by Kavon Huel on Friday September 18, 2015. The Class Notes belongs to BCH 4024 at University of Florida taught by Allison Robert Donald in Fall. Since its upload, it has received 9 views. For similar materials see /class/206959/bch-4024-university-of-florida in Biochemistry and Molecular Biology at University of Florida.

Popular in Biochemistry and Molecular Biology




Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 09/18/15
Gene Regulation Mechanisms that cells use to control when a gene will be expressed amp at what level Reading Lehninger Principles of Biochemistry 43911 Edition aemaxm Chapter 28 Regulation of Gene Expression lt9 339 Prokaryotic Eukaryotic L735 BCHAWZAI 72508 E Dr Robertson o ice ARB R37226 Tel 39271810 Email keithrul ledu 1 mm 9 Gene expression is regulated at several levels 1 Transcriptiona the most common way of controlling levels of a transcript and erefore also the protein it encodes 2 Posttranscriptiona regulation of aspects of the RNA after it is transcribed for example alternative splicing polyadenylation capping transport out of the nucleus and halflife 3 Translational factors that affect the efficiency with which an mRNA is translated such as mRNA capping tRNA abundance and modification of initiation factors eIFZ phosphorylation for example 4 Posttranslational regulation at the protein level mechanisms include protein stability covalent modification of the protein by phosphorylation for example and protein localization Transcriptional regulation in prokaryotic systems Negative regulation bound repressor inhibits transcription 6 Operator DNA WW I Promoter Molecular signal causes dissociation of regulatory protein from DNA Signal 39 molecule 539w3 mRNA b 9 WW I Molecular signal causes binding of regulatory protein to DNA 539gt 339 mRNA Positive bound activator facilitates transcription 6 RNA polymerase M 7 gt mRNA Fig 284 page 1084 Transcriptional regulation in prokaryotic systems Constitutive enzymes synthesized at a constant rate regardless of metabolic state Inducible enzymes synthesized at variable rates depending upon the need Coordinate induction induction of multiple enzymes that are part of the same metabolic pathway Polycistronic RNA an RNA copy of all genes in the operon Operon a set of genes transcribed from a single promoter into one mRNA A representative eukaryotic operon Fig 285 page 1085 Repressor Activator binding site binding site operator DNA I I IPromoterW A I A I B I C I J Regulatory sequences Genes transcribed as a unit Transcriptional regulation in prokaryotic systems Two examples 1 The lactose operon page 1085 exempli es both negative amp positive regulation Emmy qsne bGalamsmisu 2 an own as am 2 The tryptophan operon 7 an example of proteins controlling their own synthesis page 1094 Aquot 1er WWW V Fleummmyveqmn 7H rSlmmma genesr 7 1 um i 5 FpL ms quotDC quotas m H x 55 IEZI 39 I550 ma use use am 00 I Con gurations of the lactose operon Based originally on the Jacob amp Monod 1961 operon model Negative regulation quotr I39I Repressor binding site is directly I over transcrlptlon start Slte of polycistronic lac operon genes therefore RNA pol is blocked FINA polymerase l Glucoserich media a Transcription blocked Repressor encoded by i gene 1 l Repressor mFINA binds very strongly to operator Jr Lactoserich media blTrmarip an darapmsssd 1 Rapressw mFINA 391 Maser RIM Lactose allolactose natural Repressor or IPTG synthetic binds bmaosidaee conformation of repressor is altered binding is lost Inmcaet Bacteria can now utilize lactose w lnac u atad repressor The lac repressor binding site Operator 539 TGTGTGGA39ATTGTGAGCGGATAACAATTTCACACA 3 339 ACACACCTTAACACTCGCCTATTGTTAAAGTGTGT 539 4 5 endoftranscript Protected by repressor gtl J V Repressor binding site in operator is symmetrical or palindromic This is a common feature of many transcriptional regulatory protein binding sites Each dimer of the tetrameric repressor contacts one half site The lac repressor is an allosteric protein its conformation changes upon binding to the inducer DNA Protein conformation changes upon IPTG binding Protein x helices are no longer in optimal conformation to contact DNA binding is drastically reduced Fig 287 page 1086 Another View Operators 2 Ac va on ofthe lac operon page 1093 Pnsmve regulzunn AW Cl AMP quot73 law Igmmse Alvn receptnr prntzin cm MP binds DNA and facilimtes ini z nn by RNA 1 nl I WIWWWW Transcriptinn can prncead if anrztnr x is nut nccupied by repressm39 U Reulessm CD WWS W lnducer The trp operon Fig 2819 page 1095 Utilizes both a repressor that is activated by binding of a smallmolecule ligand amp premature termination Mechanism 1 Trp Mechanism 2 repressor Trp Trp 1tself1s a co Attenuatlon repressor When trp levels transcrlptlon are high it binds to the stops here when trp is high repressor Which then becomes competent to bind DNA at the operator D site nuatnr WE my Regulated genes gt l l 1 l l l l Anthra late Anthranilate Tryptophan Tryptophan synth synthase synthase synthase componentl component quot Isubunll a subunlt mRNA low tryptophan levels Attenuated m RNA high tryptophan levels m 139 Trp repressor O 2 N539Phosphoribosyll Trypmphan Synthase anthranilate isomerase I A I a 5139 I 252 1 phosphate synthase quotquot 39 r quot 39 quot 39 f H 39 39 E 391 k Indole3 glyerol LTryptophan V V anthranilate phenylamino phosph te Glutamme Glutamate PRPP PPi 1deoxyribuIOSE C02 phosphate 1 Glyceraldehyde L39Serlne Pyruvate H20 3phosph t RNA base sequence of the trp leader region Fig 2821 page 1096 Leader peptide mRNA Met Lys Ala lle Phe Va pppAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACOG E 39I G Y30GAAAUGCGUACCACUUAUGUGACGGGCAAAGUCCUUCACGC GUGG a Q 2 stop Ser Thr Arg Trp Trp o 3 1 39 1 62 4DACGCAGCCGGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAACAAUGCAAACA gt 3 4 MetGInThr gt TrpE polypeptide Site of transcription End Of leader attenuation region trPL RNA base sequence 0fthe trp leader region Attenuation 7 early termination of trp operon transcription under conditions of trp abundance W m 39 r L i thp mnlt L39 39 quot 1723L4 alternatively 23 can form P P 5 o 5 u Resembles Uirich pfactor 1 independent terminator 6 7 2 mh anenuaxur 3 a 7 End o 71 quotWM quot web s Ms 7 m kwquot GcMuu v0 1 quot lquot 6AM Acne 4AA 0 CAAUGCAAACA Begin n39pL ranslation 399m up uenstanani 31 Mechanism of attenuation in the 17p operon Fig 2821 page 1096 Inhibited at Low trp causes ribosome to stall allows 2 3 pairing Incompl e low trp 3 4 terminator does not form leader peptide quotl 4 6 tipregulated genes When t gtoghan levels are lowI the ribosome pauses at the Trp codons in sequence 1 Formation of the paired structure between sequences 2 an prevents attenuation becau e se trp mRNA is made d 3 Is no onger available to form the attenuator structure with sequence 4 The 23 structure unlike the 3 attenuator does not prevent transcription Com leted leader peptide High trp allows mKAIFlQ Ribosome I39ibosome read thru allows 3 4 pairing polymerase 3 4 terminator forms Trp codons 39 I II 39L 39 trp mRNA is not made n 1 open reading frame encoding leader peptide and sequence 3 is transcribed Continued 39 39 hldcks sequence 2 before I J u b 1 fl u 3 and 4 Combination ofthe repressor amp attenuator allows for extremely regulated amp graded response to trp levels Attenuation is possible in prokaryotes because transcription amp translation are coupled no nucleus Attenuation is a common mechanism in prokaryotes AA sequence of leader peptide for other amino acid biosynthetic operons Met Lys Arg He Ser t r lle Th39ThrThr lie Thr Ila ThrThv threonine A 539 AUG AAA CGC AUU AGC Acc ACC Auu Acc ACC Acc AUC ACC AUU Acc ACA Mel Lys His le Fro h Phe Dhe Ala Phe Phe Phe ThrF39he ProSlop in B phenylala e 5 AUG AAA CAC AUA CCG UUU UUC UUC GCA UUC UUU UUU ACC UCC CCC UGA Met ThrAArg Val len Phe Lys His 7 Hrs Hus His His His 7 His Pro Asp 539 AUG ACA CGC GUU CAA UUU AAA CAC CAC CAU CAU CAC CAU CAU CCU GAC 3 Gene regulation in eukaryotes Increased complexity more genes more polymerases and chromatin to contend with Positive versus negative control Chromatin structural changes at sites of active transcription Transcription and translation are spatially separate Posttranscriptional regulation including alternative splicing mRNA stability and translation control Pol 11 must be recruited to a promoter by sequencespecific transcriptional regulators ie transcription factors The particular regulatory elements upstream of the gene in its promoter determine the complement of transcription factors that can bind and contribute to the gene s regulation There also exist DNA regulatory elements distant from the gene both upstream or downstream that affect expression of genes known as enhancers Enhancer a DNA sequence that stimulates transcription at a distance in a position amp orientationindependent manner Functional groups on DNA red available for speci c protein bindingrecognition Major groove Major groove Major groove H Nmeo CH3 CH3 0uH NH rquot W w 5 N N 1NH H N N HIHN N NJ 2 jg EN N N H Minor groove Minor groove Minor groove AdenineThymine GuanineECylosine ThymineAdenine Major groove H N H 10 N E N quot1H N N on N N V Fig 233 page 1037 Minor groove CyfosineEGuanine Z Examples of protein amino acidDNA contacts H R N C C R quotI39 I H CH R N C C R39 Arglnlne I 2 I CH2 H CH2 Glutamlne I CH2 or asparagine cHz I I l H C H 0 gtN H Tj5N H C 3 I H H H H 5 391 0 n ThymineAdenine CytosineEGuanine Fig 289 page 1088 Structures of three common types of DNAbinding motifs from eukaryotic transcription factors Zinc nger B sheet 0 helix Zipper region Zinc nger Hydrophobic interactions Helix turn helix Zinc ngers a very common motif in transcr39ption factors used to bind speci c DNA sequences A mxx 2 pm Zinc ngu sTFlHAin 1isczse insert into me main grime of DNA a make cnnmctswith me DNAhzses azuie mgrphosphatehzckhnne Structure of a single zinc finger l I in dinerem combinations m hind highly divergent sequences Another example The conserved DNAbinding domain in steroid hormone receptors Fig 2831 page 1109 G Y H N S Y A G 20 K R Y V D R I K D W N s 50 T S 10 a x vk A E 1N in I 60 A zquot l A quot A p r K 30 4o 70 so VlKETRY KAFFKRSIQGHNDYM RLRKCYEVGMMKGGIRKDRREQ n 39 H 3N COO Transcription DNA binding Hormone binding activation 66 68 residues variable sequence variable sequence highly and length and length conserved Also illustrates the veg important point that transcription factors are modular in nature DNA binding transcriptional activation hormone binding amp dimerization domains are separable and can function independently of the other domains Reggilation of Pol II 30 1 transcription is g quot A quotquotquot quotNA extreme com lex lTBPorTFIlD andorTFllA amp highly reggilated 1 lTFllF Pol ll lTFIlE F I In addition to the involvement of mm 1T I H x the TFIIs and TAFs many transcription factors are involved TWA Closed complex 316256 and Transcription factors bind to DNA unwinding to dephosphorylation promoters amp enhancers and lpmdu e 0P3 0quot P39EX RNA dictate the transcriptional O krm m on level of the gene r V 39 Open complex J 39 elongatlon There are thousands of Unwound DNA Elongation J phosphorylation of factors transcrlptlonal regulatory l Pol II initiation and promoter escape proteins encoded in eukaryotic TFIID TFIIH genomes Tm Tm E O TFIIE 7 TBPr r v o Eukaryotes also have transcriptional 9 repressors RNA Eukaryotic Promoters CAAT TATA Possible enhancer Possible enhancer Promoter region TABLE 28 4 Hormone Response Elements HREs Some important pol 11 control elemenm amp their corresponding transcription factors Bound by Steroiderpe Hormone Renewals Transcription Sequence Name name Comment Receptor Consensus sequence bound 5 51 m Pmm39 m Mfume m mm TM m 1 Androgen GGATACAN2TGTICT ax AAAA 5 e mosi common cor pmmmu c cmmt r x GGCCMTCT cm mm G ucooo m com GGTACANBTGWC Gc hux GCGG SP1 Ofien found in muses premolars Rem 30 somel AG GTCANsAGGTCA Octamer AmGCAT oni 012 mixinz tannin homeo domains i amin AG GTCANSAGGTCA so SM Pmmrmd manna Thyroid hormone AG GTCANSAGGTCA CNNGMNNTCCNNG Heat shock uor Involved in heatshockrtspunse RXT AGGTCANAGGTCANAGGTCANAGGTCA mi CAGGGACGTGACCGCA Thymid Rapier Protein binds thyroid hormones N mm W Mme Fums a mum wm IhE iclinmc amd reneumr m vitamn D raceway A schematic representation of how DNA looping perhaps mediated by nucleosomes or HMG DNA binding proteins can bring enhancerbound activator or repressor proteins into contact with TAFs associated with the core promoter complex Fig 2827 page 1105 HMG proteins Transcription f co ediato J 777 quot2quotquot Enhancers DNAbinding transactivators DNA is bent polymerase II complex DNA A similar mechanism is used to induce transcriptional repression in eukaryotes Fig 2827 page 1105 Enhancers Chromatin structure in eukaryotes has a profound in uence on gene expression DNA is Wrapped around nucleosomes and nucleosomes are packaged into complex higherorder structures DNA is bent and in many regions occluded by the nucleosome surface Therefore eukaryotic transcription factors have to workwithin and be able to modify the binding of the DNA to the nucleosome we basepalvs 01 DNA u d 4 be een nucleosom as an Baum lo Iuswne HI Beads an a snug cmomaun mun Histone tails Chromatin remodeling Globular domain Hmong mm domam Schematic representation onhe core hismne a main suuemre 1 e e e manna SGRG OGGKARAKAKSHSSRAGLOJZSA ZQ H2A 5 A 7 PEPAKsAPAPK GS KAVT TQK GDKKRKK44g1Ha m m x u GGVKKPH7L407135 H3 7 7 TGG APR GLAT AAFKS PT m m n For example they can be r m mew J nnr methylated rm le Example Histone acetylation Structure more open or accessible to transcription factors O s ne NH y 39 a 3 CHggCOA Ac HAT VA CoA c lysine sIH CH3 A c Nucleosome The bromo domain is an acetyllysine binding module found in many chromatinassociated proteins that activate transcription 6 PCAF HAT TAFnZEO HAT HAT Bromo Double bromo L K urn E E DNA methylation the 5th base SMethyl Cytosine C DNA methylation occurs at cytosine within the sequence CG occurs in mammals plants bacteria amp insects 1 of all cytosines are methylated in mammals DNA methylation patterns are precisely replicated with the DNA sequence DNA methylation is a marker for silent genes When unmethylated DNA becomes methylated any transcribed genes within that region are usually shut off Performed by DNA methyltransferase Posttranscriptional gene silencing by RNA interference also called RNAi in eukaryotes o mums n o x mm o m mum no M mu mleA r m m mm urn MI mm INA n my my mga quot07w x m m a n 3quotquot siRNA W mm mm mums mm m lugquot quotG W69 1 complex ofthe anusense snand r Nh RISC I chradliion nlmRNA 0quot a r r H mm degradation of the 39sense39stranl Blockage al lranslallon m R Her l v39 V in mm mum mm mumpkvmm MNA n n mm mum mu mm quotmm mph 0 p m Hydrogen hand mRNA degradation The Nobel Prize in Physiology or Medicine 2006 Andrew Z Fire and Craig C Mello Fig 2833 page 111


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Bentley McCaw University of Florida

"I was shooting for a perfect 4.0 GPA this semester. Having StudySoup as a study aid was critical to helping me achieve my goal...and I nailed it!"

Janice Dongeun University of Washington

"I used the money I made selling my notes & study guides to pay for spring break in Olympia, Washington...which was Sweet!"

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."


"Their 'Elite Notetakers' are making over $1,200/month in sales by creating high quality content that helps their classmates in a time of need."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.