New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

IS Biology Lab

by: Angelita Tillman

IS Biology Lab ISB 208L

Angelita Tillman
GPA 3.84


Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

Class Notes
25 ?




Popular in Course

Popular in Biological Sciences

This 21 page Class Notes was uploaded by Angelita Tillman on Saturday September 19, 2015. The Class Notes belongs to ISB 208L at Michigan State University taught by Staff in Fall. Since its upload, it has received 71 views. For similar materials see /class/207800/isb-208l-michigan-state-university in Biological Sciences at Michigan State University.

Similar to ISB 208L at MSU

Popular in Biological Sciences


Reviews for IS Biology Lab


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 09/19/15
Today Please turn in Pediqree sheet and GMO Paper Question Sheet now Quiz 3 today Next Week GMOBiotechnology Paper Rough Draft Due Remember to attach the grading rubric Please bring 3 copies to class You will peer review the papers of 3 classmates Quiz 4 next week Human Genetics DNA Investigations GMO Paper mm 0 Scenario 7 A classmate has been murdered l 7 DNA of possible assailant found at the crime scene 7 Last known sighting of Victim 0 At N Kedzie allegedly to talk to ISB faculty about changing sections and making up labs missed due to laziness Why are we telling you all this Poice forensic lab out of town at a conference It is up to SBZO8L students to solve the crime Suspects The Italian Suspect Tony Soprano aka James Gandolfini The French Suspect Amelie aka Audrey Tautou The Spanish Suspect Don Juan aka Johnny Depp yum smmw your life DNA and Restriction Enzymes DNA composed of 4 types of bases Adenine A Thymine T Cytosine C Guanine G DNA strands held together by base pairing AT AT GC George Clooney s GC Restriction enzymes recognize speci c DNA sequences and cut DNA at these sites creating fragments of DNA that can be resolved on a gel by electrophoresis Gel Electrophoresis A tool that allows scientists to identify differences between people or organisms at the molecular level 0 Can identify variability in DNA Applications of Electrophoresis Paternity Testing Medical Applications Evolution of HIV Ecological Investigations Species or not a species Industry Trade Gene therapy Forensics Who did it DN PROFILE OF YHE TECHNIIIIIRN PREPRRING THE UTOR Iquot DIOGRFIPH DDED RS NOTHER INTERN L REFERENCE 3mm PROFILE or In new mama 4mm PROFILE or ozrannnnn 5 mm PROFILE or nzrsnnam 2 Applied in Forensic u 2 DNR PROFILE OF FORENSIC SFIMPLE SEMEN1FIKEN FROM THE UIOTIM Loading and Running the Gel Remove DNA from tube with a micropipet Load DNA into the Wells and 11m electric current View DNA bands under UV light DNA Gel Electrophoresis DNA fragments of different sizes gt Tube contains DNA sample NOTE DNA is not blue The blue color is from a dye which is mixed with the DNA for Better Visualization Anchoring the DNA in the well 7 53 Will le Mi Mi l 3i 39 Proteins or DNA strands separate based on their size The smaller the strand the farther it travels Longest strand closest to well Shortest strand farthest away from well Sizie MarkersLadder acts DNA Fragments Restriction enzymes are like scissors that cut up DNA fragments at specific sites Restriction enzymes recognizes the sequence GC TCC Cut the DNA between the first T and C Individual 1 o T T T TT T CTCCTTAGGT CTCCTT TTCCA AGGAGATTAACCA GAGGAATCCA GAGGAA 5 14 10 6 Individual 2 CTCCTCTAATTGGTCACCTTAGGT CTCCTT TTCCA GAGGAGATTAACCAGTGGAATCCA GAGGAA 5 24 6 Disease Detection Individual 1 Normal A T T T TT T CTCCTTAGGT CTCCTT TTCCA AGGAGATTAACCA GAGGAATCCA GAGGAA 5 14 10 6 Ind ddual2 lAlnatkni CTCCTCTAATTGGTCACCTTAGGT CTCCTT TTCCA GAGGAGATTAACCAGTGGAATCQA GAGGAA 5 24 6 The samples above are from the hemoglobin gene Where a mutation results in sickle cell anemia Individual 1 Inleldual 2 14222 gtgt Sickle Cell Anemia Detected DNA Gel Electrophoresis in Forensic Science Assign lane numbers to samples Wll e S 2 3 4 5 6 7 Load samples into wells Larger DNA Fragments Apply current allowing fragments to migrate through the gel Determine which suspect Smaller DNA Fragments matches with the DNA found at the crime scene my Lane 1 DNA found at crime scene Lanes 27 DNA from suspects DNA Gel Loading Previous slide Viewed gel from its front surface This slide Views gel Gel 15 Immersed from the side llqu1d buffer SOlutIOn Apply Current DANGER HIGH VOLTAGE ON ELECTROPHORESIS APPARATUS Part 1 Making DNA Fingerprints Get DNA samples A B C D and gel from countertop Load samples have 8 wells so 2 of each Use different pipette for each sample Put gel into gel bOX wells at negativeblack end 4 gels per box Run for 20 min while you do Paper Electrophoresis Activity Look for a match between D crime scene sample and suspect samples Part 11 Making DNA Fingerprints Follow the directions for doing paper electrophoresis in your lab manual This lab is to help you to understand the concept used for gel electrophoresis which is Part II of this lab Cut at m of AT sequence


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Jim McGreen Ohio University

"Knowing I can count on the Elite Notetaker in my class allows me to focus on what the professor is saying instead of just scribbling notes the whole time and falling behind."

Allison Fischer University of Alabama

"I signed up to be an Elite Notetaker with 2 of my sorority sisters this semester. We just posted our notes weekly and were each making over $600 per month. I LOVE StudySoup!"

Bentley McCaw University of Florida

"I was shooting for a perfect 4.0 GPA this semester. Having StudySoup as a study aid was critical to helping me achieve my goal...and I nailed it!"


"Their 'Elite Notetakers' are making over $1,200/month in sales by creating high quality content that helps their classmates in a time of need."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.