New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

Week 5 Notes


Week 5 Notes BIOL

Intro to Molecular BIology
Dr. Laura Bartley

Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

Week 5 Notes over chapter 6-8 for Dr. Bartley's Molecular Biology course!
Intro to Molecular BIology
Dr. Laura Bartley
Class Notes
25 ?




Popular in Intro to Molecular BIology

Popular in Department

This 76 page Class Notes was uploaded by an elite notetaker on Friday September 25, 2015. The Class Notes belongs to BIOL at University of Oklahoma taught by Dr. Laura Bartley in Fall 2015. Since its upload, it has received 27 views.

Similar to BIOL at OU


Reviews for Week 5 Notes


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 09/25/15
Chapter 6 DNA and RNA structure By yourself or with a partner WRITE the de nition of genetic engineering and give 2 general examples of the use of this technology o Endprocessing creating l 339 overhangs Helicases and nucleases 3 a First strand invasion 1 Recombinase g 9 Second strand invasion Recombinase Branched Intermediate 339 5i f1 0 Strand extension DNA polymerase 3 5 i F1 5 I 3 I Figure 1 32 Molecular Biology Principles and Practice 2012 W H Freeman and Company III quotConventiona Genetic Engineering of Eukaryotes tends to be Imprecise Homologous Recombination May be the Key Red strand is broken and blue strand is used as a template to engineer a new gene where the product is shown below It s a new DNA sequence using the blue strand Scheme for promoting homologous recombination TIIIlllIIjijllI ZFNs TALENs or CRISPRCasQ targeted DSB Ill 1111 p In I I I I I I I 1 WT donor Transgene donor vDNA RNA IIIIEIIIIII lilillllili 33111331 Ramalingam et al Genome Biology 2013 142107 Which method is best to introduce dsbreaks a ZFNs ZFNR lt3 A37 G I c T c c L 70 Q 9T T TIAAICClCIATCFqu TGAA 3 ldl VGleNAAT GGGTGAGMCACWTT C Three Technologies used 1 ZFNs Zinc Finger Nucleases Alpha helix of the zinc finger is binding on the nucleotides of the DNA and there is a residue on the zinc finger that can bind to the DNA 3 3 ZFNL If we string several together then they can specify a break in the DNA b TALENs by introducing Fok1 that cleaves but only when there is a dimer TALENL Type II Nucleases used 539 GCTTCTGACACAACTGTGT39I CACTAGCAACCTCAAACAGACACCATGGTGCATCTG 339 339 CGAAGACTGTGTTGACACAAGTGATCGTTGGAGTTTGTCTGTGGTACCACGTAGAC 539 2 TALENSI Transcrlptlon Actlvator Ilke NUCIGUS Modify transcription of the post protein TALEN R Using same Fok1 Type II nucleases and fusing it to the specific proteins RVDI Nll HID N39K N39G where it can change the nucleotides in the sequence Base A C G T Two amino acids that correspond to one base 0 3 CRISPRCASQ Clustered Regularly lnterspersed Short Palindromic Sequences c CR39SPRCAS9 gg CA89 Protein and Guide RNA that has a specific structure that has homology 8 to the DNA sequence and will bind to the DNA and CA89 will be able to a s Zn introduce a double strand break 0 quoti 339 UUUU 8 a a 80 Eag CasQ E23 Guide 0 RNA 3 3 D O 5 CNNNNNNNNNNNNNNNNNNN AAGGCUAGUCCGUUAUCAA llllll CC N N 339 NNNNNNNNNNN quot739quot NNNNNNNNNNNNNNNN 539 IlII 02L lIIII 5 NNNNNNNNNN NNNNNNNNNNNNNNN 3 NN GGNN Chromosome PAM l 23 bp genomic arget sequence Ramalingam et al Genome Biology 2013 142107 Most of Biotechnology is Applied Molecular Biology Nucleic Acid Structure and Chemical Properties are critical to Biotechnology and Molecular Biology Ch 6 NA Structure and Chemical Properties Ch 7 Biotechnology Methods Ch 8 Genomics Ch 9 DNA Topology Ch 10 Structure of chromosomes IChapter 6 DNA and RNA structure What do we need to know about nucleotides How do these characteristics affect nucleic acid structure How do structures vary based on sequence What are some of the key chemical and thermodynamic characteristics of nucleic acids Figure 61 Molecular Biology Principles and Practice 2012 W H Freeman and Company Nucleotide nomenclature Adenosine nucleoside A Nucleoside monophosphate AMP l Nucleoside diphosphate ADP Nucleoside triphosphate ATP Figure 61 2 Molecular Biology Principles and Practice 2012 W H Freeman and Company I Nucleotides I Pneumonic of Purines Pure As Gold also Ag is gold DNA Purines Adenine NHz Guanine 0 Phosphate Purine or pyrimidine S39CHZ o B base 439 139 H H mm H 339 239 H Pyrimidines OH H Cytosine Thymine Uracil H CH3 RNA H H RNA Phosphate Purine or I O pyrimidine 0 o S39CHZ base Figure62a 4 I 1 I Molecular Biology Principles and Practice H H 3 H 2012 W H Freeman and Company OH OH Figure6 2b Molecular Biology Principles and Practice 2012 W H Freeman and Company I Phosphodiester bonds and DNA properties 539 Terminus Write 5 to 3 Phosphodiester bond 3 Phosphodiester bond H H H H 3 H Phosphodiester bond s C H H H H 3 I H H 3 Terminus Figure 66 Molecular Biology Principles and Practice 2012 W H Freeman and Company I ISugar puckering OH OH BDFuranose Figu re 63 Molecular Biology Principles and Practice 4 2012 W H Freeman and Company Know that these are non planar molecules where the 2 or 3 carbon will be sticking out of the plane 3 3 Anitparallel Strands 5 Figure 611 Molecular Biology Principles and Practice 3911 2012 W H Freeman and Company IThe DNA helix Major Groove Adenine H 111 N H 110 N 0 A MmorGroove Thymine CH3 NH N O O kl r GC are closer than AT but not the same Guanine 108 A Major Groove H o N Cytosme oH H Minor Groove Repeats the alter helical structure Slight differences and shortens Beta form Helix Sugar phosphate 5 backbone quotr g v I P c ya One helical turn 34A Q r 39 I t 105 base pairs Major groove Axis Minor groove Base plane 20112 nm Figure 614 Molecular Biology Principles and Practice 2012 W H Freeman and Company I Different Helical Structures I B39DNA Z39DNA BDNA A DNA Z DNA Helix sense Righthanded Righthanded Leftlganded Diameter 20 A 26 A 18 A Base pairs per helical turn 105 11 o 12 o Helix rise per base pair 34 A 26 A 37 A Base tilt in relation to the helix axis 6 20 7 Sugar pucker conformation C2 endo C339 endo C239 endo for pyrimidines Major C3 endo for purines groove Glycosyl bond conformation Anti Anti AM for pyrimidines major syn for purines groove g Figure 61 7b Molecular Biology Principles and Practice Minor 2012W H Freeman and Company Minor groove groove A forms has more angled bonds Left handed helix Figure 617a Molecular Biology Principles and Practice 2012 W H Freeman and Company IConformations of sugars and bases in helices Figure 63 Molecular Biology Principles and Practice 9 2012 W H Freeman and Company a b syn position of guanine Deoxyguanosine C339 endo sugar pucker Deoxythymidine C339 endo sugar pucker Figure 61 6 Molecular Biology Principles and Practice 2012 W H Freeman and Company anti position of guanine Deoxyguanosine C2 endo sugar pucker Deoxythymidine C2 endo sugar pucker Z OH Has Considerable In uence on 2 and 3 Structure Stabilizes A form of RNA a b Figure 625 Molecular Biology Principles and Practice 2012 W H Freeman and Company B A and ZHelices BForm Helix Typical native form of DNA Has a shallow major groove that can bind a protein alphahelix AForm Helix Typical native form of RNA ZForm Helix Occurs with sequences that are GC rich or with salt Which helical form does DNA typically adopt A Aform B Bform C Zform Which helical form does RNA typically adopt A Aform B Bform C Zform Which helical form has a shallow major groove that can bind a protein alphahelix A Aform B Bform C Zform INA Structures Palindromes cruciforms gt2 strands a SS Single Stranded TGCGATACTCATCGCA 5 l 3 gt5I b dS Double Stranded with complimentary y hGCGATMCTchTCGCA y 339 I ACGCTATGAGTAGCGT Palindrome Mirror repeat c MEIAGCZACWZAC3Af i 1 I A Figure 620 Molecular Biology Principles and Practice 2012 W H Freeman and Company Illll TGGTG n m n q gt I A k r 5 m I gtmmngt gt m igtmnmI Guanosine tetraplex Fig u re 621 Molecular Biology Principle and Practice 1012 Wu H hemva and ompany Telomeric structure ends of chromosomes Repeats are special in nucleic acid because they change the structure I RNA Structure I a 1 ug quot1 2 Figure 622 Molecular Biology Principles and Practice 7 2012 W H Freeman and Company a Hairpin Single A c strands Internal loop A A Bulge U 9 A c C A A U A c AcC UU IIC39UACC CGUU GAG Loops 0 AG Stems G quotP A 6 C u G G A G G G c A 0 0 G A o O A G o bl Figure623 Predicted structure of HIV and affects rate of translation Molecular Biology Principles and Practice 0 2012 W H Freeman and Company a Sequence secondary form of RNA because the duplexes are shown for tRNA b comes from a crystal structures of tRNA tertiary form 3D shape mRNA structure may alter translation and folding RNA NonWatsonCrick base pairing and unpaired nucleotides I Figure 624 Molecular Biology Principles and Practice 3999 2012 W H Freeman and Company When there is a single stranded structure different base pairs may form Noncanonical base pair structure Noncanonical deviating from the normal structure Stabling base pairs c 39 C AGCCUGAUGCAG GI CGL GG CGGG A UAAJ U R A 2 c a G c 22 C A39uA A G CG G I AG C c I GG CU A c ACACGGUC A A GA Am amp39 G Guc iCGGlJ CAGGAAGAAG A o o A GUCAAGGUC CGG UIGACA GUM uuuucuuc G GG A A G k9 A AUG Gu UG GU Cu D IEIIIII ngt gtomocnc QC onnngtmgtc CAGA GCU G U U G G A G G c c G G c A G GU Au CG UA AU ES cGGG ccucuuG AGGGGG AACUACUGGA U II II I A ucc GGGGAG chcA cGAlLJIGGCA G A u UAA 1 A A C C CG AU G Ac A II A d Nucleic acids C deamination Chemical Reaction Cytosine Uracil Fig u re 63 3 Molecular Biology Principles and Practice wzoizwiHFveemananwmvaw Occurs 100xday in the human genome Because it is so common organisms have evolved a repair system that will replace the base Favored Unfavored Base methylation in DNA 5Methyldeoxycytidine N6Methyldeoxyadenosine Used by bacteria to identify self versus non self NHZ NH 5 of human C s are methylated and observed on CpG that N occurs in promoters that helps and marks promoters 6 gt K CpG cytosme phosphate guanine N N N NzMethyldeoxyguanosine 5Hydroxymethyldeoxycytidine 0 MHz N CHZOH N H gt 5 k N H3C N N o N H Figure 634a Molecular Biology Principles and Practice C s 2012 W H Freeman and Company Promoter Inhibitor Me CDS Me CpG Enhancing Promotes Z form DNA I Nucleic Acid Denaturation Unfolding of secondary structure Breaks hydrogen bonds Doublehelical DNA Denaturation occurs normally by increasing temperature but could also occur by adding certain chemicals Denaturation Annealing Partially denatured DNA Separated strands Assoaatlon of afrallili n c oils separation Strands by base of strands pairing Figu re 627 Molecular Biology Principles and Practice 2012 W H Freeman and Company I Denaturation T Varies by Sequence I Sections that unfold have fewer hydrogen bonds that hold them together duplex is unstable AT rich Repeatable locations of denaturation with slow heating Tm temperature at which half of DNA is denatured Adding salt will stabilize the duplex and increase the Tm A higher Tm means more energy is required to denature the DNA Singlestranded A260 Doublestranded l 40 60 Tan 100 Temperature C gure 629 Figure 628 Molecular Biology Principles and Practice 33 201 2 w H F reeman a nd Com pan Molecular Biology Principles and Practice 5 2012 W H Freeman and Company a Nucleic acid sample Runagarosegel I Using Physical Properties of NAs electrophoresis C9 More compact shape migrate faster More base pairs migrate slower Agarose gel Transfer to nitrocellulose Nitrocellulose membrane Hybridize with labeled nucleic acid probe b Complementary sequence base pairs PECAM1 Autoradiogram reveals mRNA 39 which fragments annealed 39 with probe GAPDH mRNA Example of a Northern Blot mRNA Figure 632 Molecular Biology Principles and Practice Southern Blot is with DNA 2012 W H Freeman and Company DNA Synthesis The Basis of Synthetic Biology om 5339 BM 0 at 39posntion CH2 DNA can be chemically synthesized Cyanoethyl a protecting group H 37 H 5 W39tft ii NC CH 2 2 NC CH 2 2 4053 DMT O H 93 CH 32CH N CHCH32 4 H DMT Diisopropylamino activating group 0 Protecting Next nucleotide I group removed added 393 CH32CH N CHCH32 R H a A Diisopropylamine byproduct Oxidation to form triester Repeat steps 0 to 6 until all residues are added I K Nc CH 2 0 Remove protecting groups from bases i 9 Remove cyanoethyl groups from phosphates a Cleave chain from silica support Mme e e We e 539 3 Oligonucleotide chain Figure 635 Molecular Biology Principles and Practice 2012 W H Freeman and Company Discuss with your neighbor how current understanding of DNA explains Chargraff and colleagues observations made in the 19405 Base composition often varies from one species to another DNA specimens isolated from different tissues and from different developmental stages of the same species have the same base composition In all cellular DNAs the ratio of A to T and G to C is always the same What model related to DNA metabolism did these rules inform A B C Beadle and Tatum s concept that one gene corresponds to one enzyme Avery s conclusion that DNA was the material from a virulent strain that can transform an avirulent strain Watson and Crick s model of DNA forming an antiparallel double helix with A pairing with T Chapter 7 Studying Genes Fig u re 71 9b Molecular Biology Principles and Practice 0 2012 W H Freeman and Company Cloning PCR Recombinant proteins Understanding protein localization and interactions Scheme for promoting homologous recombination ie genome editing Random insertion in a 1 1 1 1 1 1 1 1 1 1 1 I 1 1 transcriptionally active locanon ZFNs TALENs or CRISPRCasQ targeted DSB llllll 111 IE WT donor vDNA HEIDIEDIE IIIIEIIIIII liiillllili Need to first be able to clone genes to even begin gene editing gt I l 1 1 1 l I 1 1 Transgene donor DNA Ramalingam et al Genome Biology 2013 142107 What is superior about genome editing relative to conventional genetic engineering A Genome editing is faster B Genome editing targets a speci c site in the genome C Genome editing is new and cool General Cloning Scheme DNA gt Isolate gt Introduce it gt amplify make many copies K Amplifyj Repeat steps to move to eukaryote DNA cloning 11000 copies 5100 kb 10quot6 gt 4Mbp p 0 Gene inserted into plasmid Bacterial Plasmid chromosome it gene of Recombinant 39merest DNA of DNA Plasmld chromosome 9 Plasmid put into bacterial cell Recombinant bacterium httpbiol151nicerwebcomLockedmediach202002aGeneConingPreviewLjpg DNA cloning 5 generalfsteps Traditional Selecting Need DNA to clone and a vector plasmid Cutting Restriction Endonuclease enzyme that performs cutting that cuts in the middle and not at the end Joining Ligate using ligase Moving Transformation in vitro test tube gt in vivo bacteria typically Identifying Selection with antibiotics m 39xi Cloning m Eukaryotlc xzelx Vector 393 chromosome plasmid quotquotV V a DNA fragment of interest 0 Cloning vector is obtained by cleaving is cleaved with chromosome with a restriction restriction endonuclease endonuclease m g j 3 e Fragments are ligated to the prepared cloning vector 1 DNA ligase Recombinant vector DNA is introduced into the host cell e Propagation cloning of transformed cell produces many copies of recombinant DNA Figure 71 Molecular Biology Principles and Practice 2012 W H Freeman and Company I Restriction endonucleases I Endonucleases bind to and cleave DNA at specific sites Makes a cut leaving a 5 phosphate and 3 is turned into a OH group Endo cleaves in the middle exo cleaves at the end Arrows show where nucleases make a cut in the strands Table 72 Recognition Sequences for Some Type II Restriction Endonucleases l l BamHl 539GGATCC339 Hindlll 539AAGCTT 339 CCTAGG TTCGAA 1 3 l Named for speCIfIc Clal 539ATCGAT339 Notl 539GCGGCCGC339 site and organisms TAGCTA CGCCGGCG as T T l x l EcoRI 539GAATTC339 Pstl 539CTGCAG339 CTTAAG GACGTC T l Jr Jr EcoRV 539GATATC339 Pvull 539CAGCTG 339 CTATAG GTCGAC 1 l W l Haelll 539GGCC339 Tth111l 539GACNNNGTC339 CCGG CTGNNNCAG T T Note Arrows denote phosphodiester bonds cleaved by each restriction endonuclease Asterisks mark bases that are methylated by the corresponding methyltransferase where known N denotes any base Each enzyme name consists of a threeletter abbreviation of the bacterial species from which it is derived sometimes followed by a strain designation and a Roman numeral to distinguish restriction endonucleases isolated from the same bacterial species or strain Thus BamHl is the rst I restriction endonuclease characterized from Bacillus amyloliquefaciens strain H Table 72 Molecular Biology Principles and Practice 2012 W H Freeman and Company Restriction endonucleases sticky vs blunt 5 Blunt ends 3 GGTG GC TAG CCACTTAA TCG ATCGACATCG L Staggered sticky ends Figure 72 part 1 Molecular Biology Principles and Practice 2012 W H Freeman and Company Restriction endonucleases sticky vs blunt Chromosomal DNA Cleavage Recognition Cleavage site sequences site GG39I39 quotGC TAGCTG39I39AGC EcoRl Pvull restriction restriction endonuclease endonuclease O O CCACTTAA O O O O O O Sticky ends Figure 72 part 1 Molecular Biology Principles and Practice 201 2 W H Freeman and Company Stick ends more efficient but require basepairing Cloning vectors plasmids Circular extrachromosomal DNA Small copy number 2 100 copiescell high copy number 220 kbp Antibiotic Resistance Genes Tetracycline resistance 4361 bp Origin of replication Pvull 39 74 Molecular Biology Principles and Practice 39iw 2012 W H Freeman and Company Cloning vectors arti cial chromosomes Like a plasmid but bigger 20200 kbp inserts Cloning sites I within IacZ Plasmld 0 ar genes Each daughter cell receives a copy Figure 76 part 1 Molecular Biology Principles and Practice 0 2012 W H Freeman and Company Cloning vectors polylinkers Multiple restriction sites olylinker EcoRl Pstl Hindlll BamHl Smal EcoRI stickyendl I I I H 39 stickyend 5 AATTCCTGCAGAAGCTTCCGGATCCCCGGG GGACGTCTTCGAAGGCCTAGGGGCCCTTAA Plasmid cloning vector orientation ligation cleaved with EcoRl a S Q g DNA to U ligase Figure 73 Molecular Biology Principles and Practice 2012 W H Freeman and Company I Cloning into vectors GGT CTGTAGC CCA GACATCG Stickyends BIuntends 1 Cot both plasmid and Insert a b 2 ngate Plasmid cloning vector cleaved with EcoRI and Pvull Figure 72 part2 Vector Insert to bacteria Molecular Biology Principles and Practice 2012 W H Freeman and Company I Moving the recombinant DNA into cells C Plasmids are the circles a DNA plasmid Bacterial chromosome Methods of ECoi vector uptake 2 l 1 Heat Shock 2 Electric Shock 3553mm W O lt0 O lt s Stable transformation Selecting for cells with the recombinant DNA EcoRl Codes for Beta Lactamase binds peptidoglycam Pstl Sall Ampicillin Tetracycline I resistance resistance AmpR TetR pBR322 4361 bp gt Protein synthesis inhibitor Origin of replication ori Pvull Figure 74 Molecular Biology Principles and Practice M 2012 W H Freeman and Company httpwwwccpberinorgimg72bacteria on an Agarplatejpg Cloning into vectors producing many copies Amplify in E Coli cells I 1 Which of the following is the correct order for traditional gene cloning Isolate DNA Ligate Restriction digest Transform Select Isolate DNA Restriction digest Transform Ligate Select Isolate DNA Select Transform Restriction Digest Ligate Ligate Selct Isolate DNA Transform Restriction Digest Isolate DNA Restriction digest Ligate Transform Select P190570 GeneraIRgloning Scheme Ligate Transform Select DNA gt I introduce I gt and manipulate sequences PCR PCR Targeted ampli cation of DNA segments Polymerase Chain Reaction Used to generate many copies of DNA of interest with DNA Polymerase Primer is short DNA synthesized chemically Template strand A 3 c T c DNA polymerase catalyzes reaction E that adds dNTP to DNA T c c A 3 9 q q jf 539 339 Primer strand Incoming nucleotide Fig 524 from Tropp Molecular Biology Genes to Proteins PCR The three stages DDNSA DENATURAUON JV 95 C Denaturing DNA is breaking hydrogen bonds 339mmmnmmmmmnmmrm539 ANNEALWG Si p2 so c Bind primers to template forming H bonds to base pairs l39l39l39l39l39l39l 439 Add polymerase that synthesizes DNA that is EXTENSION i complementary to the template elongate the chain lIIllllllllllllll 39 39 quot39 39 quot39 quot39 72 C IS optimal for DNA polymerase httpwww mnhu educowriesPCRgif PCR How does it work Region of target DNA to be ampli ed 339I I 539I I 0 Denature 9 Anneal One Cycle 339I I I 539 A Prlmers 6 Extend 339I I 539 I I 539 539 I Cycle Repeats 3 I B I I I I 539l I Figure 79a part 1 Molecular Biology Principles and Practice 2012 W H Freeman and Company I PCR How does it work 1 quot1 i quot1 HMIIIH WEE N N H U After 25 cycles the target sequence has been ampli ed about 105fold Figure 79a part 2 Molecular Biology Principles and Practice 2012 W H Freeman and Company Polymerases in PCR E coli DNA polymerase NH COO Domain 1 Domain 2 5 gt 3 3 gt5 Domain 3 exonuolease exonuolease Polymerase Klenow discovered this polymerase Figs 526 amp 527 From Tropp Molecular Biology Genes to Proteins Polymerases in PCR Extremophile Enzyme extreme conditions loving Thermophillio conditions Thermus Aquatious is the bacteria Taq optimal temp is 72 C Stable at 98 C How We Know 7 Figure 2 Molecular Biology Principles and Pratt o 2012 W H Freeman and Campany General Cloning Scheme DNA gt I introduce I gt To clone RNA reverse transcriptase is used to make into DNA and then PCR is sused to amplify the copies Cloning Expressing proteins in bacteria Take gene of interest coding sequence and put into polylinker site Inducible promoter off unless telling to be on chemicals or changes in environment to turn on because if E Coli is always expressing protein protein may be toxic to the cell Bacterial promoter P I and operator 0 sequences Gene encoding repressor that binds O and regulates P Polylinker Transcription termination sequence Ribosome binding site Selectable genetic marker eg antibiotic resistance 97000 039w O Y 66000 39 Cloning Expressing proteins in other organisms Adenovirus transfect animal cells Figure 71 6 Molxukn Biologyzhimnles Whom 101 w H llrvllun mu xulnpan httpstaticddmcdncomgifIightvirus1jpg Cloning Expressing proteins that are altered Mutaginize random or site directed mutagenesis changing single small number of base pairs v Mutations can be induced Gene for target protein ITagged proteins in protein puri cation Gene for GST v Protein that binds to glutathione Codons must be in frame K m j H Express fusion C proteinin cell 9 Prepare cell extract containing fusion protein as part of the cell protein mixture 0 l U39 Add protein mixture to column Transcription Independently folding domains Fusion proteins chimera fi iiaii l 39i Affinity Chromatography quot1032quot GSTtag V Other I 3397 proteins I 39 n m 7 new V v through 394 A t O 3939 column Elute fusion protein Figure 71 8b Molecular Biology Principles and Practice 0 2012 W H Freeman and Company Western Blot Run agarose gel electrophoresis Agarose gel 44 a 1quot 939 Antibodies proteins of animals immune membrane system that binds to other molecules quot Membrane its5 Wash with 39 39 l rst antibody Prlmary AntlbOdy 7 Second Antibody detectable by fluorescent tag or enzyme Wash with second antibody l Visualization Autoradiogram Western Blot Figure 722a Molecular Biology Principles and Practice 0 2012 W H Freeman and Company a Gal4p DNA Yeast 2 Hybrid 3mm pmm Assay omam J i M k I f bingiangrsite ProteinY di eree titgliz O 1 Recruits RNA polymerase Increased transcription proteins and see if they interact with each other Transcription of resistance gene b L hsthatlrzglginding Yeast strain 2 vvith Ask does protein domain fusions 3335335333quot X bind with protein Y Mate to produce diploid cells Plate on medium requiring interaction of the binding and activation domains for cell V survival Survivors form colonies Sequence fusion proteins to identify which proteins are interacting Figure 725 Molecular Biology Principles and Practice 2012 W H Freeman and Company Protein fusions vvuv vv39 v Transcription 2 Gene for fusion protein Protein fusions GFP Emit Absorb Fluorescent GFP labeled protein for subcellular locaHza on C H d T l ea al 4 me Also can used lmmunofluorescence at a lower scale with electron microscopy using light or gold particles immunogold in the antibody to see the protein of interest for subcellular localization Ventral Figure 719 Molecular Biology Principles and Practice c 2012 W H Freeman and Company The importance of recombinant DNA GMOs might not be all bad All organisms have genes Used for basic science to understand how genes work Insulin is the best example Chapter 8 A Brief Introduc on to Genomics Writing WarmUp A One thing that you would teach your roommate that you already know about genomics B One questions that you have about genomes DNA sequencing Sanger dideoxynucleotide method is 139l39ll39l39l39l39l39l39l39l39l39l39l39l39l39l39l39l39f copies of feuraepIate Present Method Primer 20 bp J I Add polymerase dNTPs and add dyes which are fluorescent Synthesis continues until dideoxynucleotide GAT or C is incorporated GACE GACGCI GACGCTGCG gACGCTE G I GACGCI GACGCTG CE ddNTPs gtgt ddNTPs DNA sequencing Sanger dideoxynucleotide method Primer L 3 Template of unknown sequence DNA polymerase four dNTPs four ddNTPs Text Figure 712 part 1 Molecular Biology Principles and Practice 2012 W H Freeman and Company pill We can analyze the different points at the sequence l Capillary Electrophoresis DNA 3 Applications migration Studying Genomes 7 Confirms targets of cloning Li lt3 w v i Laser beam v Detector 3 Laser l Fluorescent Signal r20 r 3930 I m l l A A 39 H MW Little bump indicates mistakes 39 t 39 M 39il I limb ll ll AATGTTTGCTGGTGGTTAAGCCCGG v l tware Reads Time Figure 712 part 2 Molecular Biology Principles and Practice 2012 W H Freeman and Company New Ways of DNA Sequencing Single molecule 1000000000 a 1000000004 Massively parallel E sequencing C 1 lVIasswely parallel g E sequencers 5 1 000000 quot a Pyrosequencmg C M 4 V 39 b g 1000000 I Capillary sequencrng pyrogg cm 39 39 5 10000 Seq uencmg by syntheSIs 3 Gebased systems 3 1 000 quot Secondgeneration 8 Amommed caprllary sequencer g 100 quot Manual Slab 9 Frrsbgeneraton X slab gel capillary 2 Single molecule 7 I I I I I I I 1980 1985 1990 1995 2000 2005 2010 Future sequencing Pyrosequencing a Pulse in dATP m8 geemew e 1 No ash of light dATP 3 degraded by apyrase Pulse in dGTP m quot gaaaa SI Base is incorporated pyrophosphate is released v Sulfurylase converts pyrophosphate V into ATP In the presence of ATP iferase reacts with Iuciferin Flash light Nucleotide sequence A 66 T C G TT C A A G T c A G T c A Nucleotide added Highlight 72 gure 1 Molecular Biology Principles and Practice 2012 W H Freeman and Company 1 Template Many copies 1 Location of chip or flow cell quotSequencingbySynthesis Adding in fluorescent labels on the nucleotides A Cluster Amplification C Sequencing 5 Moo 6 quotO W Mu O 8 3 M 39 5 W 39 w A m IDm 0 Flow Cell Sequencing Cycles Bridge Amplification PCR cydes I Digital Image Data is exported to an output fule 5quot2 53 Clustert gt Read 1 GAGT 139 T 3V3 i CIusterZgtRead2TTGA 39 39 Cluster 3 gt Read 3 CTAG Clusters Cluster 4 gt Read 4 ATAC Text File Manym9coptle Of 1FurrmBsil nts ketingdocumentsproductsiluminasequencingintroduct39ionpdf httpwwwilluminac o ent dami For more info watch this 5 video httpsyoutubeHMquthBSE Single Molecule Sequencing Nanopore technology Blockage in pore causes change in electrical signal across the membrane httpsnanoporetechcomsciencetechnologyhowitworks 2010 2009 2008 c 2007 2006 2005 2004 2003 2002 2001 2000 1999 1998 1997 1996 1995 1994 1993 1992 1991 1990 ll If 39 quot39 f C x X v l 1977 gt2000 completed bacterial genomes gt100 completed archaeal genomes Saqqaq Man 4000yearold human from Greenland Z mays corn H neanderthalensis Neanderthal draft 0 anatinus p antpus J Craig Vente 39 rst individual human I C familiaris ug M mulatta rhesus macaque 139 vaginalis protist S purpuratus sea urchin A mellifera honeybee P troglodytes chimpanzee R norvegicus rat H sapiens human completed M musculus mouse A gambiae mosquito O sativa L rice 5 pombe ssion yeast H sapiens human draft A thaliana plant D melanogaster fruit y C elegans nematode worm E coli bacterium M jannaschii rst archaeon S cerevisiae budding yeast M ni alium m I ma smallest genome H in uenzae bacterium History of Genome Sequencing Not sequencing little bits from different organisms but the entire parts for organisms so there s no mixing Sequencing started in the earliest 21st century Reference organisms single thing sequences Allowed hypothesis development to do comparing First organism to be sequences Genome sequencing begins X174 phage Figure 83 Molecular Biology Principles and Practice 0 2012 W H Freeman and Company How big are genomes Don t need to memorize but know the general size Organism Genome Size bp of Genes H Influenza 18610quot6 1760 E Coli 4510quot6 4300 D Melanogaster 180 Mbp 13600 H Sapiens 3810quot6 25000 A Thaliana 125 Mbp 25000 Z Mays corn 2910quot9 Mbp 70000 How do we sequence genomes 39 Clone Based Shotgun Sequencing Clone based sequencing Less sequencing Use arrangement of large clones Look at repeating sequences to put them into an order STS EST Contig l Jill 1 HI I Al quot1113 t1E1111131E111 11113311 1111 am DID 1131 EDIE Illlllll ElI quotms Ellll lllllllllllllllLlllLLlllll r111 lllZlIllllelElllIllll 1131mm Figure 82 Molecular Biology Principles and Practice 2012 W H Freeman and Company Shotgun Sequencing Plasmids GU 03 C Q Ine s 31 Genomic DNA Little random pieces Must sequences much more l Fragmentation Adapters Sequencing Library httpwwwilluminacomcontentdamillumina marketingdocumentsproducts iuminasequencingintroductionpdf


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."

Janice Dongeun University of Washington

"I used the money I made selling my notes & study guides to pay for spring break in Olympia, Washington...which was Sweet!"

Bentley McCaw University of Florida

"I was shooting for a perfect 4.0 GPA this semester. Having StudySoup as a study aid was critical to helping me achieve my goal...and I nailed it!"


"Their 'Elite Notetakers' are making over $1,200/month in sales by creating high quality content that helps their classmates in a time of need."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.