New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here


by: Mozelle Windler
Mozelle Windler
Cal State Fullerton
GPA 3.69


Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

Class Notes
25 ?




Popular in Course

Popular in Biological Sciences

This 5 page Class Notes was uploaded by Mozelle Windler on Wednesday September 30, 2015. The Class Notes belongs to BIOL 426 at California State University - Fullerton taught by Staff in Fall. Since its upload, it has received 35 views. For similar materials see /class/217034/biol-426-california-state-university-fullerton in Biological Sciences at California State University - Fullerton.

Similar to BIOL 426 at Cal State Fullerton

Popular in Biological Sciences


Reviews for Virology


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 09/30/15
An in vitro model of hepatitis C virion production Theo Heller Satoru Saito Jonathan Auerbach Tarice Williams Tzivia Rachel Momen Allison Jazwinski Brian Cruz Neha Jeurkar Ronda Sapp Guangxiang Luo and T Jake Liang Liver of Kentucky College of Medicine Lexington KY 40506 Kidneyni a Health Bethesda MD 20292 and 1university Communicated by Reed E Wicknel National institutes of Health Bethesda MD December 23 2004 received for review November 29 2004 The hepatitis C Virus HCV is a major cause of liver disease e viral life cyce h of HCV A second construct with a mutation in the active site of the 39IDMIIA A iaairi l 3 control The HCVribozyme expression construct was transfected into Huh7 cells Both HCV structural and nonstructural proteins culture medium r cv RN proteinsi atracti ith the ensi of115 gml the putative densi ofHCVvirions lectronmicroscopyshowd 39 d E of 50 nm in lameterTheeVe o HCVRNAlnth was as high as 10 million copies per milliliter The HCVribozyme fthe reason for this difficulty there is an urgent need to establish such a system if improved therapies are to be d v 17 rnfe therapies s In this study we describe an m yltm HCV replication system A fullrlength HCV construct CGlb ofgenotype lb known to be infectious 10 was placed between two riboz es designed to xact 539 and 339 endsof 39 d into the culture medium This system provides a que opportunity to further study the life cycle and biology of HCV and to test potential therapeutic targets Materials and Methods evidence or viral replication assembly and release This system supports the production and secretion of highlevel HCV virions and extends the repertoire of tools available forthe study of HCV biology assembly i tell culturel intection l nbozyme l Viral replication ans of three pairs of overlapping rinrers that were ased a described libozyme pair that was functional in hepatocytes ll inner ost set S VCGG TAc CCG GTA CCG TCG CCA c ccc GA and 3 7ACG GAT CTA GAT CCG TCA CAT CA was used to amplify pHCVGFPZ e p r GFPZwas derived from an infectious fullrlength HCV CGlb cloneloandwasconstructed yreplacingt eHc sequences 39 709 CZuI and 8935 33111 by the sequence F human illness worldwide 1 Although it has proven to be a difficult public health problem it as een no easier to study in e laboratory A major impe iment has been the lack of robust model systems to study the wmplete viral life cycle HCV is a m g a c ORF flanked by the 539 and 339 nondoding regions The ORF is divided into the co ing sequences for the structural proteins at the 539 end and the nonstructural proteins at the 339 end Study of expression and manipulationof individual viral proteins in tissue culture e development ofthe subgenomic and genomic replidons is a major breakthrough to understanding viral replication and so e issue culture systems ave en general these systems have not been robust enough to study the complete viral life cycle 4 5 39 39 39 39 39 39 remains unclear however the promise of a system that produces aur virus bewme accessible for study but also such a system would compounds There is evidence for an inverse relationship be organism This relationship is true for hepatitis A and there is evidence that it may be true for HCV as well 6 7 Regardless Wwwpria orggldollo l073pna MOBSSSlOZ coding forlhe GFP The middle 5 rTCC GTG AGG ACG AAA TCC GTG AGG A and 3 7GAT CAT GTT CGT CCT CAC r39r39 This r em was cloned into the SrfI site of Stratagene and in by using NgtI and mm o c pCMVrScri t h c removed and the missing p reinserted to generate the pHr plasmid The mutation in the GDD motif of the polymerase GDDgt Thlxworkwaxprexenmd in pertettne sstnAnnuel Meeting oftheAmerltanAxxotlanon i i h t n 2004 Abbreviation HCV hepatitis Vim tlh ends slownomtorrerpondenteshouldbeeddrerredetliveroueererarentnNetionellnrtitute auildingio Room9B1610CenterDrlveMSCl800BememaMD208924800Ermzlililznganlh gov zoosbylneNetionelAtedemyomienteottneusA PNAS l FebruaryISJOOS l vol i0z i no 7 l 157972533 G 2 2 2 A TRE sz sz thSpA c CGGTACCGTCGCCASCCCCCGA TGCAGATCATGTGACGGAT T A GGCA cscwcss5 3 CTAGTAC cwsccr CC A A A CTG A CTG G A A A A G G c GAC T c GAGT A T A 1 MW 17 T7 G c t c 013 G c G c J5 A G A G G T G T Flg 1 Construction ofHCVr t Tne design or and in 0 ii ii and 539 T end PM Upper tnerontrolorai pi iii 1 i lane labeled T7 was introduced into this Construct and the mutated Construct as named pTHrGND The plasmid pTREhyg2 without any n sert was a used as a control and is hereon referred to as 1 issue Culture and Iranslection and KNEE Plotadion Assay A human hepatoma cell line Huh7 was maintained at 37 C in DulbeCCo s modified Eagle39s medium containing 5 C02 Transfecti 39 I nscribe from a construct containing the core region from nucleotide 342 to nucleotide 707 of HCV CGlb strain flanked y the T3 and T7 promoters Illllllllllo39lllolEsLEllCE and Waterii Blot Huh7 cells were grown on glass coveislips and transfected as described Cells were fixed with acetonemethanol on ice at different time poins after transfection Cells were washed with PBS three times incubated with primary antibody for 1 h washed with PBS incubated with secondary an i ody and washed again with PBS Monoclonal antibodies against the core C1 and E1 A4 were from Greenberg Stanford Medical School Palo Alto CA 12 The antirEZ monoclonal antibodies AP33 an ALP 8 were from A Patel Medical Research Council Glasgow Scotland 13 The NS5A monoclonal antibody was obtained from J Lau ICN eled donkey antirmouse G was obtained from aboratories The same primary antibodies for Western blotting The peroxidaserlabeled goat a m se d as the secondary antibody was obtained from Kirkegaard amp Perry Laboratories Sucrose Gradient Density Centritugatioii The tissue culture men dium was centrifuged to remove cellular debris and the super natant was pelleted over a 30 sucrose cushion The pellet was resuspended in TNC buffer 10 mM TrisHCl pH 741 mM CaC12150 mM NaCl with EDTArfree protease inhibitors 2530 l wvvanascrgegidcilo1073pna50409565102 RNA M t m We expected 1 S rntfragment an be seen ontni gelwrtn longer exposure The 39 end undertne ontrol or tne T7 promoter 39 end under botn Roche Applied Science and applied onto a 20760 sucrose gradient 105ml volume in SW41 tubes Beckrnan Coulter ndcentrifuged at 100000 x 3 fractions from the top of the gradient The fractions were tested or HCV proteins and viral RNA as described below CryoeleCr tron microscopy was performed by using standard techniques V RNA Protein Quantitatioll and RACE HCV RNA level was the TaqMan realytime PCR method as described in ref 10 RNA was extracted from 100 pl of the sucrose gradient fractions or tissue culture media by using TR Izol Invitroge n and resuspended in 20 pl of double filtered RNaserfree water Samples were tested in duplicate The core protein was quantitated by using the HCV core ELISA his which were provided by S Yagi Advanced Life Technology Saitama Japan and used as described in ref 14 Samples were ligasermediate T e 539 an E procedure was performed as described in ref 15 Rsults n39k r a To pmve L L i in the context of HCV genome the HCVrribozyme RNA was generated by in Vim transcription of pHr and analyzed by formamide gelelectrophoresis The results are shown in Fig LB A r r r i ii r HCV 7 nt was detected Also seen were bands corresponding to the vector 5400 nt a 150m fragment corresponding to the RNA between the T7 transcription initiation and the Cleavage site of the 39 ri ozyme and other molecularweight fragments probably representing uncle aved or prematurely terminated transcrips A hm r r r uence in place of the HCV polyprotein sequence data not shown Further proof of the ribozymes cleaving correctly is discussed later with the RACE resulm Hellereta Me 393 r a pTRE pTHr pTHrGND Slmnd lICV TRE pTHr pTlerNT Strand GAPD Flg 2 Detection of HCV positive and negativestrahd RNA Upper The experlment Shown are the total ellular RNA probed for the HCV ore SequerKe either positive or negatlve strand and the findings Wheh ellular Er pTHrr or pTHrGNDrtranxfeded ell Were probed for either gatlvernran r eddehte LoweThemntrol Shown lsthe ai iioiai nw pi e oi io rohiii rig imy are roughly omparable in the three lanes HCV RNA and Plofein Pmduction in Tlals39aded Cells Both positiver H As were detected in cells transr CV HCV RNA in multiple experimenm The GND pTHrGND produced a small amount of positiverstrand RNA but did not produce any detectable negativerstran RNA The positiverstrand RNA produced with the GND mutant was less than that produced with pTHr No viral RNA was detected in cell lysates transfected with pTRE ed with pTHr or the control plasmid pTRE w d b 39 ofluorescence with monoclonal antiz core E2 an A A granular seen with antibodies against all three expression on day 2 and a significant decrease on day 4 after transfection data not shown e rcentage of cells wit fluore ce was 0 despite the transfection efficiency of r E5002r with a GERcontaining plasmid data not shown No immunofluorescence was seen in the cells transfected with TRE Western blot of cell lysates transfected with pTRE or pTHr showed the presence of core E2 and Ns5A in cells transfected with pTHr but not in lls transfected with pTRE Fig A As exp 39 t de ct d 39 CV protein was detected in pTHrGNDrtransfected cells suggesting in this system data not shown Hcv virion Production and Secretion To assess the possibility of HCV particle production culture medium of the p Hre and pTHrGNDrtransfected cells was subjected to sucrose density gradient centrifugation The fractions were analyzed for two HCV structural proteins core and E2 and HCV RNA These 5 are shown in i In the culture medium from cells transfected with pTHr a peak of HCV proteins and RNA coincided in fraction 5 which has the density of 116 g ml This nsi 39 consisten with the published density of free HCV yirions 16 Viral particles were yisual electron micros copy only in fraction 5 Fig 5B These particles are heteroger neous in appearance and have at least two sizes 50 and 100 nm in diameter with the 0 nm being the major form 39 heterogeneity has been described in ref 17 Viral particles are doubleshelled and appear to have spikerlike projections from their surface Shown in Fig 5A are the resulm for pTHrGNDr Heller etel IR 100x lillllllllllllllllllll 100x 630 39 Flg 3 Detedlon of HCV proteln by immunofluoresfehfe A LOerOWer o t 7p i i of Multlple ellswlth tldorestehte ah be seen C LOerOWer VleW of ell transfeded With the ontrol pTRE and named With antHOre There Was ho tldorestehte D p erVi W E Cell Were trahstefted With pTRE 5 or pTHr F G and H highpoWer VleWS h c transfected cells The HCV protein and RNA levels are at least 107fold less than those of the pTHrrtransfected cells we RACE was used to ensure the exact cleavage of the 539 and 339 ends ochV by the ribozymes In vltm transcribed RNA from pHr and RNA from the culture medium of pTHrrtransfected cells were analyzed by RACE The 539 end of the m vitmr transcri e as expected had the same sequence as the cDNA construct Fig 6A However the 339 en of the m vltm 39 rquotquot 4 RAW 39 beCou f less efficient cleavage by the 339 ribozyme and subsequent difficulty in amplifying a heterogeneous population of the 339 ends Both the 539 and 339 ends of HCV RNA from the culture r t r P in Tntprp tin lv arhan r E MW MW PTHr pm p39riir mm Wquot Flg 4 Detedlon of HCVprotelmbyWenem blot lh eahblottheflrt lahe WithpTRE ThemolemlarwelghlsareShownonlhele oftheblot LeftBlot was probed With antHOre Center Blot probed With antlrEZ Rght Blot probed With anlerSSA PNAS l February 152005 l vol loz l he 7 l 2531 MICROBIOLOGV 395 VA send u HCV mun nous1 Line ucvlanm H sunn Core prntein nalL HCV RNA x 10 copiesml H gt Flg s moose density gradient analysis of ulture medium of HCVetramfected ell A Levier Result of tne utrose gradient for pTHr solid lines and tne pTHrtr nef ti n in loading buffer and used for the Western blot B Cryoelectron mlroopy of tradlon 5 Bar 100 nm the most 539 nucleotide from G to A was noted this change has W 1 HCV RNA in infected humans 15 In the 339 end two nuclee otide changes in the stem loop region were noted UgtA an AgtU These changes preserved the stem loop structure Fig GB Such chang s have also been reported in HCV RNA from infected individuals 18 The RNA levels in the medium of th GNDetransfected cells were not adequate to perform RACE Discusion Since the discovery of HCV in 1989 working with HCV has proven to be difficult mostly because of the lack of model systems 19 Each aspect of the life cycle has been difficult to re roduce m vitm The infectious clone was develo d a ter multiple attempo and had to be dem 2o 21 Other smalleanimal models re u r ems 22 23 In vltm virus obtained from infected individuals can 39 39 ary human u o o E E m replicate only in certain B cell lines and prim A a S GCCAGCCCCCGATTGGGGGC b 5 r r r Ar l r l r r C S lZlCCAGCCCCCGAUUGGGGGCU 39f G C GC UA A U CG CG 5 CCG U3 5 CCG U3 Fig 6 Sequemesofthe 539 and 339 endsof HCVRNA A torthe 539 end ofthe CGlB strain a andtne RACE resultsforthe 539 end otln Bl Tne D NA equeme and tne stemeloop Strudure ofthe 339 end ofthe cGlb are boxed 2532 l vvvvvvpnasorggldollol073pn350409666l02 L aalowlevel45l39 m A It t fthe renlirnn l l h b difficult to work with 2 24 Developmentofviruselike particles and pseudovirus have allowed study of viral entry into the cell but do not model other as cm of the viral life cyc e 2523 Therefore a model a39onasse ly an ree isugen system with viral replic ti d l ase r tly needed Furthermore gen ost prevalent form of HCV and the most difficult to treat wasc or this m d l Byengineeri gt ha e quences nea 539 nd he 339 d of n infectious HCV A clone we generated a DNA expression construct for the production of HCV virions An important initial consideration ensure that the ribozymes are indeed functional This functionality was demonstrated by m vltmrtranslation and R Transfection of this H eribozyme construct into Huh7 strated the production of structural and nonstrucr o ins b 39mmunofluorescence and Western blot Both positive and negativeestrand RNAs could be detected intracele u arly As expected the positive strand is much more abundant was to The GND mutant was constructed as a control to determine the extent of replication in this model Evidence for replication the presence of negativeestrand viral RNA in pTHretransfected cells and the lack of negative strand in pTHrGNDetransfected cells A gtloefold difference in the relative amouno of the ira A between the wildetype and GND construco provided additional evidence This observation can be explained by the lack of amp ification as a result of defective replication The positive strand seen with the GND mutant was generated from transcription of the cDNA plasmid This differ ence in product was also evident in the culture medium The pm a t s were gtloefold higher in wildetype cells than in the GND mutantetransfected ce ls The final and perha the most inter esting evidence for replication is the RACE findings The 39 a d 339 l 394 l 1 l39 1 and18The GgtAswitch of the initial nucleotide ofHCV is as iated with replication in WW7 andm vltm 15 Atransposition from an AT 0 H t t t x r a a base pair in the putative terminal stem loop of the 339 end of Hellereta CV viral RNA in this system Evidence for assembly and release was derived in a number of ways The presence ofHCV RNA inthe mediawith the exact 539 and 339 ends showed that the correctly processed RNA was 39 e association ofviral RNA and core and E2 rotein in the same fraction on the sucro gradient with a density of 116gml the published density of free 39 39 d the interpretation that viral particles are 39 i The most co pelling evidence is the visualization of particles resembling were visual ized only in fraction 5where viral RNA and proteins are present 7 more than the viral RNA and E2 protein This core reactivity 39 re particles althou they were not seen ing gt10 million copies of HCV RNA per ml in the culture edium hough replioons using the fullrlength HCV genome 39 scribed In have those p b ti ever in the system presented here there is no extraneous RNA and although mutations can and do occur see the RACE u Theilmann L KL Barrens 75 299773005 KL Yoshikura H G RCanHYen 2003 Vlml 77 75 363373643 Halley ets rpllh L L RNA h 39 39 ce without adaptive mutations This difference might 39 particles are seen It may also be of importance that there is a corstant RNA production inside the cells being channeled directly into the appropriate cellular machinery for assembly This model system does not allow the study ofviral entry and the earliest events in the HCV life cycle In addition whethe these particles are infectious or not remains to deteimined e sequence used is wn e 39 zees It should be noted that the se ue re ults that would be obtained with other genotypes in is system is unknown Despite these caveats it represenm a robust release Very little is known about the assembly and release of CV iswork might present an opportunity to better elucidate the biology ofHCV as well as to develop therapeuti or the treatment of hepatitis C in particular for geno ype Mole Addm in Proof During the preparation of this manuscript two groups T Waklta T Takanobu T Date an M M amoto and T Pietschmann G Koutsoudakls s Kallis T Kato s Foung T Waklta and R Eartenschlager at the 11th International Symposium on HCV and Related Viruses Heidelberg Germany Oct 377 2004 reported the production of infectious HCV in cell cultureby transfecting a fullrlength HCV RNA genome We thank 2 Hong Zhou PhD for superb cryoelectron microscopy Shintaro Yagi for providing the HCV core ELISA kit and Anthony Davrs for excellent technical assistance 16 Berland J L V 2002 s M KL Rice C M 1995 I Vlml 70 W KL Hangman N Bowlln T KL Mounir s 2002 I Med Vinyl 55 PNAS l February stS l vol l02 l no 7 l 2533 MICROBIOLOGV


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Bentley McCaw University of Florida

"I was shooting for a perfect 4.0 GPA this semester. Having StudySoup as a study aid was critical to helping me achieve my goal...and I nailed it!"

Anthony Lee UC Santa Barbara

"I bought an awesome study guide, which helped me get an A in my Math 34B class this quarter!"

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."

Parker Thompson 500 Startups

"It's a great way for students to improve their educational experience and it seemed like a product that everybody wants, so all the people participating are winning."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.