New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

Molecular Biology Lab

by: Clarissa Hermiston DVM

Molecular Biology Lab BIO 181

Clarissa Hermiston DVM

GPA 3.58

Amy Rogers

Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

Amy Rogers
Class Notes
25 ?




Popular in Course

Popular in Biological Sciences

This 10 page Class Notes was uploaded by Clarissa Hermiston DVM on Monday October 5, 2015. The Class Notes belongs to BIO 181 at California State University - Sacramento taught by Amy Rogers in Fall. Since its upload, it has received 60 views. For similar materials see /class/218814/bio-181-california-state-university-sacramento in Biological Sciences at California State University - Sacramento.


Reviews for Molecular Biology Lab


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 10/05/15
Bio 181 BlueWhite screening pBLU A central problem of cloning is the identi cation of a desired clone among countless bacteria transformed amp untransformed In the simple cloning system we have used so far we used antibiotic resistance to select the desired clones This was possible because our desired clones all carried antibiotic resistance genes that untransformed bacteria did not But what if you need to select for MORE than just antibiotic resistance In Labs 1820 we are cloning a PCRamplifled gene into a plasmid vector pBLU After ligation and transformation we are faced with two variables 0 Tranformed vs f med bacteria Bacteria transformed by pBLU are selected from untransformed cells by resistance to ampicillin pBLU carries the ampR gene 0 Bacteria caming empty pBLU vs bacteria carging pBLUPCRproduct the desired clones All of these cells will be able to grow on ampicillin To identify desired clones use BlueWhite screening BlueWhite screening How does it work pBLU and other specially designed cloning vectors make use of the lac operon pBLU carries the gene for galactosidase also known as M This enzyme catalyzes the breakdown of lactose as a food source It can also degrade an artificial substrate called m which turns BLUE when it is broken down by galactosidase o Colonies that produce 8 39 39J and are fed X gal will turn BLUE 0 Colonies that do NOT produce galactosidase remain white in color even in the presence of X gal Plasmid vectors designed for bluewhite screening have a multicloning site carefully placed early within the coding region of lacZ Successful ligation of a foreign DNA into this multicloning site interrupts lacZ and abolishes production of functional galactosidase Therefore Untransformed bacteria No growth on amp Bacteria transformed with original pBLU Blue colonies on amp Xgal Bacteria transformed with pBLU insert DNA White colonies on amp Xgal Note that bluewhite screening is not selection it does not kill the unwanted bacteria it is screening In some bluewhite screening systems an additional reagent must be used IPTG isopropylthiogalactoside IPTG is an inducer that derepresses lacZ expression it turns the gene on In some cases without IPTG not enough galactosidase is produced to turn the colony blue even if the lacZ gene is intact H V ori n i origin 24330 Bgnluciosiduse nimgmoni 45378 i a mukiple cloning site 553750 In promoter 8i 77938 pUC origin i 684825 umpicilli i locZ nmpicillin resistance Kala on 1971772833 Kpnl pBIuescripi SK MC I 30 kb P be paluescripi SK Mul ple Cloning She Region sequence shown 5017325 Aw Hquot i M Louiuvi W A i INNamour Kp m H s i i i i TTGTAAAACGACGGCDAETGMTTGTAATACGAETCADTATAGEGDEAATTGGGTACCGGGCECGDCETCGAGETEGACGGT V r1 r7 o Ts Pquot gt gt M Jim omnomangs nmnonm 5n merbmdiw 9 Msom i WM c ini Wm DKV Emu i w S mn H an S pi hni t ngi nsw SucH Snti Ami cAoTAm icTA gt 4 KS on onang 5w SK onnn binding m n Prumalar igai ocmgmnni I i GETTTTETTECCTTTAGTGAGGGTTAATTTEEAGETTGGCGTAATCATGGTCATABCTGTTTCC n Unmlr m mom N no nangm Shotgun sequencing Sanger DNA sequencing as you may guess only works for a certain distance beyond the sequencing primer best from about 30 nt to 350 nt39 the read length Beyond that very few products are producedbecause chain termination has already occurred Therefore to sequence a longer DNA special methods are required An obvious solution is to sequence as far as you can from your primer39 then synthesize a new primer near the end of the known sequence39 and repeat Works but at best you d be able to sequence maybe 500 bases a dayimaking it impossible to sequence something like the human genome with its billions of bases Another approach used to sequence very large amounts of DNA such as an entire genome is shotgun sequencing In this strategy the DNA is rst shredded into smaller fragments which can be sequenced individually The sequences of these fragments are then reassembled into their original order based on overlaps ultimately yielding the complete sequence Shredding of the DNA can be done using restriction enzymes or mechanically by shearing Alignment of the sequences of overlapping pieces is done by computer In the case of the human genome project a massive amount of data is involved requiring supercomputer technology Shotgun Seguencing To sequence a clone longer than the average read length it is possible to use a shotgun approach The idea is to pepper the DNA with sequence reads such that they overlap and when assembled yield the complete sequence of the clone The shotgun part comes from the way the clone is prepared for sequencing it is randomly sheared into small pieces usually about 1 kb and subcloned into a quotuniversalquot cloning vector The library of subfragments is sampled at random and a number of sequence reads generated using a universal primer directing sequencing from within the cloning vector These sequence reads are then assembled into contigs and the complete sequence of the clone generated Making a shotgun library Genomic DNA is sheared or restricted to yield random fragments of the required size M G V N 2Vxj ZS41 The fragments are clonedinto a universal vector Below is a contig for contiguous sequence The redgreen hybrid in the center is the original dsDNA to be sequenced It was broken up and smaller pieces cloned into plasmids The inserts in various randomly chosen plasmids were then sequenced to give the smaller fragments shown Note that it is important to sequence both strands While this may seem a waste of effort given the rules of WatsonCrick base pairing the fact is that certain areas on one strand may be difficult to sequence accurately for example because of local secondary structure formation The complementary strand however may sequence well Using primers from opposite ends will give you sequence for both strands Once you have sequenced a bunch of small fragments a computer can find regions of overlap shown as hatch marks above and properly align them into the complete original sequence Shotgun Sequencing Sequencing reactions are performed with a universal primer on a random selection of the clones in the shotgun library GAP SINGLE STRANDED 000 These sequencing reads are assembled in to contigs identifying gaps where there is no sequence available and singlestranded regions where there is sequence for only one strand The gaps and singlestranded regions are then targeted for additional sequencing to produce the full sequenced molecule SOURCE httpwwwnematodesorgteachinggenomicsGenomics3html The example of Shotgun Sequencing I RANDOM PHASE BAC DNA or gt 74 Whole Genome Sheared DNA 20 0 kb Random reads from the O O Clones of Sequencing OO Templates Sequencer lt Shotgun Sequencing IIASSEMBLY Sequence overlap between individual reads is used to assemble a contiguous set of reads the contigquot Single Stranded Sequence Reglon Gap Shotgun sequencing III FINISHING gt lt V I Reads t0 mush PCR or other methods are used to isolate and sequence the un nished regions DNA Sequencing Sanger Method Dideoxynucleotide chain termination Sanger sequencing is a DNA sequencing method in which target DNA is denatured and annealed to an oligonucleotide primer which is then extended by DNA polymerase using a mixture of deoxynucleotide triphosphates normal dNTPs and chainterminating dideoxynucleotide triphosphates ddNTPs ddNTPs lack the 3 OH group to which the next dNTP of the growing DNA chain is added Without the 3 OH no more nucleotides can be added and DNA polymerase falls off The resulting newly synthesized DNA chains will be a mixture of lengths depending on how long the chain was when a ddNTP was randomly incorporated Manual DNA sequencing example 0 First anneal the primer to the DNA template must be single stranded 5 GAATGTCCTTTCTCTAAG 339GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG539 0 Then split the sample into four aliquots including the following nucleotides quotGquot tube All four dNTPs one of which is radiolabeled plus ddGTP low concentration quotAquot tube All four dNTPs one of which is radiolabeled plus ddATP quotTquot tube All four dNTPs one of which is radiolabeled plus ddTTP quotCquot tube All four dNTPs one of which is radiolabeled plus ddCTP 0 When a DNA polymerase e g Klenow fragment is added to the tubes the synthetic reaction proceeds until by chance a dideoxynucleotide is incorporated instead of a deoxynucleotide This is a quotchain terminationquot event because there is a 3 H instead of a 339 OH group Since the synthesized DNA is labeled classically with 35SdATP the products can be detected and distinguished from the template Note that the higher the concentration of the ddNTP in the reaction the shorter the products will be hence you will get sequence CLOSER to your primer With lower concentrations of ddNTP chain termination will be less likely and you will get longer products sequence further AWAY from the primer If for example we were to look only at the quotGquot reaction there would be a mixture of the following products of synthesis 5 39 GAATGTCCTTTCTCTAAGTCCTAAG 3 39 GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG 5 39 539GAATGTCCTTTCTCTAAGTCCTAAGTCCTCCG 339GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG539 539GAATGTCCTTTCTCTAAGTCCTAAGTCCTCCGG 339GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG539 539GAATGTCCTTTCTCTAAGTCCTAAGTCCTCCGGATG 339GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG539 5 rGAATGTCCTTTCTCTAAGTCCTAAGTCCTCCGGATGG leooAcAcTTAcAooAAAoAcATTcAcoATTcAooAcoccTAccATcAAoATcAAces 5 rGAATGTCCTTTCTCTAAGTCCTAAGTCCTCCGGATGGTACTTCTAG aleooAcAcTTAcAooAAAoAcATTcAcoATTcAooAcoccTAccATcAAoATcAAces and so on lf the DNA belng sequenced eontrnues to the rrght Cham termrnatron then oeeurred no more polymenzanon Beeanse ddGTP rneorporanon ls random all posslble lengths ofDNA that with G are produeed at 4 nM r H r hm nueleonde The gel ls dned onto ehromatograp ol n of DN by paper and exposed to eray fllm Smee the template e strands generate bands whleh would look llke thls Pulyacrylamde gel eleamphuresls cf the G reaamn 7 What inihigil gang 39 139 d le nt ccwehsdccwcceenwsedncwwcwes AAETCCTCCEGATEG ehsdccwccsenws AAETCCTCCEG on n AAETCCTCCB A n we inert synmesrs gggtggggg Gt bands on agel The cham termmauons elosestto the pnmer generate the smallest DNA moleeules whlch mrgrate further down the gel and cham termmatrons further from the pnmer generate larger DNA w m e llar cham termrnatron reactions are run for eaeh nueleohde the four reaetrons ean be run next to aeh other andthe sequence othe DNA ean be read off ofthe ladder ofbands 5 to 3 sequence belng read from bottom to top up all four reactlons and you res the sequence ladder 5 to 3 ICCTAAG etc dn thls example The resoluu39on olthe gel 39 39 e important i m1 enllencin 39 l l 50 or 200 bases in length must be separable from molecules that are 51 101 or 201 bases in length respectively To accomplish this polyacrylamide not agarose is used at t mesa Samples are denatured before they are loaded and the gels must c tam a onc 39 n of urea 7 to 8 molar to prevent folding ofthe molecules and formation ofsecondary structures by rogen bonding that would alter the mobility ofthe molecule The gels are run at higher temperature about 50 c also to prevent H bond n Negativeend A C G T formatlo i n Y it Y b an m i of the syntheticproducts would have terminated earlier I I llllilll Sequence on gel at left TmT r T39I I T T i Automated DNA seguencing Dye termination sequencing i ill Most DNA sequencing is now automated The Sanger method chain termination reactions are still used but pouring mnning amp reading polyacrylamide gels has Insteadof c L A i I H II each dzdeuxznucleundz is labeled with adszzrem umescem marker When excited Wit i 4 Aquot I39 1 c 1 i i i i n 6quotquot a laser t r a quotquot intensity translated into a data peak Thus all four chain termination reactions can be performed in the same tube and asingle lane on a gel A machine scans the lane with alaser The wavelength offluorescence from the label conjugated to the ddNTPs can be interpreted by the mac ine as an indication ofwhich reaction ddG ddA ddT or ddc apanicular DNA band came from ii I l i ii u Positive end dye label mkzdunmmmnwxhddGTF 5 am cm were em 3 mmmnncmememmm meme senmmemxcmcnmuemuea dxenuuwxmnvnhddA 5 amm39rvcmw39cru mummemes 3 emammmAmmammvmanmmemxcmcnmuemuea mmmcn m cam x mych mnemememnmmanmmemsccmcnmuenmea aye Ink 5 rem mar 3 emeucmcmmeuem ch senmmemxcmcnmuemuea Here s what the products Here s what the products would Jock hke 111 would Jock hke n sepume gel lanes u slngle gel lanes The uorescence output 15 storedm the form ofa chmmemgzam


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Bentley McCaw University of Florida

"I was shooting for a perfect 4.0 GPA this semester. Having StudySoup as a study aid was critical to helping me achieve my goal...and I nailed it!"

Jennifer McGill UCSF Med School

"Selling my MCAT study guides and notes has been a great source of side revenue while I'm in school. Some months I'm making over $500! Plus, it makes me happy knowing that I'm helping future med students with their MCAT."

Jim McGreen Ohio University

"Knowing I can count on the Elite Notetaker in my class allows me to focus on what the professor is saying instead of just scribbling notes the whole time and falling behind."

Parker Thompson 500 Startups

"It's a great way for students to improve their educational experience and it seemed like a product that everybody wants, so all the people participating are winning."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.