New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

General Genetics

by: Clarissa Hermiston DVM

General Genetics BIO 184

Clarissa Hermiston DVM

GPA 3.58

Ruth Ballard

Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

Ruth Ballard
Class Notes
25 ?




Popular in Course

Popular in Biological Sciences

This 14 page Class Notes was uploaded by Clarissa Hermiston DVM on Monday October 5, 2015. The Class Notes belongs to BIO 184 at California State University - Sacramento taught by Ruth Ballard in Fall. Since its upload, it has received 31 views. For similar materials see /class/218817/bio-184-california-state-university-sacramento in Biological Sciences at California State University - Sacramento.

Popular in Biological Sciences


Reviews for General Genetics


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 10/05/15
Mudlfled frum Nip wwwmhh2 cumbruuker FclHZOOb 510184 LECTURE 4 Lecfur e 4 Mufagenesis and Profein Funcfion EC AB TM lo 1 I on raisenew We APPsnL Apps 1m Na APP CTFu AFFVCTFB Y Y 1 vsooreiase vssoreiase 93 AD m NOD PNcessing of mman amxloid Emcursor Emtein Am M in the Aquot gene that inemse betasemtase39s arr ty for its cleave e site on he Aquot N s in t for ysecmtase that inemse its a Alzheimers disease Depositio bmakdown d d ent I m utations te I General Types of Munitions The term nilkm refers to a lieritalole change in the genetic material Mutations provide allelic variations 0 On the pos39tive side mutations are the foundation for evolutionary c ange o On the negative side mutations are the cause of many diseases Page Modified from httpwwwmhhecombrooker Fall 2006 BIO 184 LECTURE 4 o Mutations can be divided into three main types 1 Chromosome mutations I Changes in chromosome structure 2 Genome mutations I Changes in chromosome number 3 Singlegene mutations I Relatively small changes in DNA structure that occur within a particular gene Only singlegene mutations will be discussed here We39ll have future lectures about chromosome and genome mutations II Types of Single Gene Mutations Singlegene mutations change the DNA sequence within a single gene 0 A point mutation is a change in a single base pair I It involves the substitution of one base pair for another 5 AACGCTAGATC gt 5 AACGCEAGATC I A transition is a change of a pyrimidine C T to another pyrimidine or of a purine A G to another purine 0 Eg C gt T is a transhon point mutation o Transitions are more common than transversions I A transversion is a change of a pyrimidine to a purine or vice versa 0 Eg C gt A is a fransverson point mutation o Insertions or deletions can also occur These can involve a single basepair or multiple basepairs I See diagram at top of next page Page 2 Modified from httpwwwmhhecombrooker Fall 2006 BIO 184 LECTURE 4 5 AACGC E 5 AACGCGC I 3 3 Del ti n offour base pfai rfs 5 AACGCTAGATC a 5 AACAGTCGCTAGATC 3 I 3 I Addition39ofifour base pairs III Consequences of Gene Mutations Mutations in the coding sequence of a proteincoding gene can have various effects on the polypeptide 0 Silent mutations are those point mutations that do not alter the amino acid sequence of the polypeptide I Due to the degeneracy of the genetic code 0 Missense mutations are those point mutations in which an amino acid change does occur I Example Sicklecell anemia Refer to Figure 161 in Brooker I If the substituted amino acids have similar chemistry and the protein39s function is not affected the mutation is said to be neutral 0 Nonsense mutations change an amino acid codon into a stop codon I Causes early termination of translation I Protein is often nonfunctional See Table 161 Brooker 0 Frame shift mutations result from insertions and deletions I If the number of nucleotides in an insertion or deletion is not divisible by 3 translation of the gene39s mRNA will be adversely affected Page 3 Modified from hTTpwwwmhhecombr39ooker39 Fall 2006 BIO 184 LECTURE 4 o All codons 339 To The inser Tion or deleTion will be read in The wrong framequot and The polypepTide will become gibberish o This usually also leads To a shor Tened polypepTide because a sTop codon is encounTer ed fairly quickly in The shifTed frame 539 ATG ACC GAC CCG AAA GGG ACC 339 meT Thr39 asp pr39o lys gly Thr39 l 539 ATG ACC GAC GCC GAA AGG GAC C 339 meT Thr39 asp ala glu ar39g asp IV MuTaTions in Noncoding Regions ThaT AffecT Gene Expression or FuncTion o MuTaTions in promoTer s 0 Up promoTer muTaTions make The promoTer more like The consensus sequence I They may increase The r aTe of Tr anscr ipTion 0 quotDownquot promoTer muTaTions make The promoTer less like The consensus sequence 0 They may decrease The r aTe of Tr anscr ipTion A muTaTion can also alTer splice juncTions in eukar yoTes and cause exons To be skipped or inTr ons To be included in The maTur e mRNA See Table 162 Brooker V TrinucleoTide RepeaT MuTaTions 0 Several human geneTic diseases are caused by an unusual form of muTaTion called Tr inucleoTide repeaT expansion TNRE Page 4 Modified from hTTpwwwmhhecombrooker Fall 2006 BIO 184 LECTURE 4 0 These diseases include among several oThers o HunTingTon disease HD 0 Fragile X syndrome FRAXA See Table 163 Brooker o CerTain regions of The chromosome conTain TrinucleoTide sequences repeaTed in Tandem o In normal individuals These sequences are TransmiTTed from parenT To offspring wiThouT muTaTion 0 However in persons wiTh TRNE disorders The lengTh of a TrinucleoTide repeaT increases above a cerTain criTical size I IT also becomes prone To frequenT expansion I This phenomenon is shown here wiTh The TrinucleoTide repeaT CA6 CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG o In some cases The expansion is wiThin The coding sequence of The gene 0 Typically The TrinucleoTide expansion is CA6 gluTamine I Therefore The encoded proTein will conTain long Tracks of gluTamine o This causes The proTeins To aggregaTe wiTh each oTher o This aggregaTion is correlaTed wiTh The progression of The disease 0 In oTher cases The expansions are locaTed in noncoding regions of genes 0 These expansions may decrease or halT expression of The gene or resulT in changes in RNA sTrucTure ThaT disrupT iTs splicing Page 5 Modified from httpwwwmhhecombrooker Fall 2006 BIO 184 LECTURE 4 VI Other Ways of Categorizing Mutations A Germline versus Somatic o Geneticists classify the cells of multicellular organisms into two types 0 Germline cells I Cells that give rise to gametes such as eggs and sperm 0 Somatic cells I All other cells 0 Germline mutations are those that occur directly in a sperm or egg cell or in one of their precursor cells 0 Somatic mutations are those that occur directly in a body cell or in one of its precursor cells See Figure 164 Brooker Example of a somatic mutation The singer Bonnie Raitt has a patch of gray hair in the middle of her forehead This is the result of a somatic mutation during embryogenesis that disrupted a gene involved in hair pigmentation in a single cell This cell then went on to divide to produce a patch of cells that could not produce pigment Photograph from httpwwwimdbcomnamenm0707248 B Forward versus Reverse o In a natural population the wildtype is the most common genotype 0 A forward mutation changes the wildtype genotype into some new variation I If it is beneficial it may move evolution forward I Otherwise it will be probably eliminated from a population Page 6 Modified from hTTpwwwmhhecambraaker Fall 2006 BIO 184 LECTURE 4 o A reverse muTaTion changes a muTanT genoType back inTo iTs original wild Type form 0 Much less common Than forward muTaTions because They musT be much more specific undo The prior muTaTion eXaCTy C Survival PoTenTiaI o MuTanTs are ofTen characTerized by Their differenTial abiiTy To survive o Deleferious muTaTions decrease The chances of survival of The muTanT The mosT exTrerne are leThal muTaTions o Beneficial muTaTions enhance The survival or reproducTive success of an organism O D Condifional 0 Some muTaTions are called condiTional muTanTs 0 They affecT The phenoType only under a defined seT of condiTions o Siamese caTs are TemperaTure sensiTive condiTional muTanTs They have a coaT color gene ThaT produces pigmenT only aT TemperaTures below core body TemperaTure This causes The cooler parTs of Their bodies face ears feeT and Tail To be pigmenTed while Their core body color is whiTe hTTpwwwanimalpi cTuresdublecompicTuresphoTos DicScaTbreedsiamesecaT Page 7 Modified from httpwwwmhhz combrook Fall 2006 O 134 LECTURE 4 VII Two Examples of the Effect of Mutations on Protein Function The seriousness of the phenotype conferred on an organism by a mutation depends on the type of mutation as well as the location of the mutation within the gene PIIIIP39II P 39 39 quot 39 of 1 39 uf the phenotypic39 39 quot39 39 39 39 exon coding for AL v 39 enzyme can be extremely serious Let39s explore two examples in depth A xUnked Muscular DFtnophy Two clinically distinct forms roplly o o lgtuchenne Muscular DFtnophy MD 0 Both disorders arise from mutations within the same gene The gene involved is 0 Located on the x chrom me 0 Extremely large at over 2 million base pairs in length The average size of a human gene is about 20900 base pairs 2 s for a muscle protein called ctystrophin which is part of an interconnected system of proteins that extends from the Factin myofilaments in the cytoplasm of muscle cells to the rigid matrix that surrounds each muscle cell This network is critical because it prevents stressinduced rupturing of the muscle cell plasma membrane during muscle contraction o lininainiir W1 win 7n conumiisi nu is iliui cm iioiz 2 an logo A umn cinlis no 1v 2e cm 41 a inncinllmowx isainmumin iaoiz umo ciioio no won 2 1 c 5133 Exhncullular Matrix 39 39ce i uiiiii39 lilsliollniin runs 1 SVnilnnmllr in cllolin 3 r are acclaim intracellular lllultix httpwww novocastraco uhinddgs htin Page a Modified from hTTpwwwmhhecombrooker BIO 184 Fall 2006 LECTURE 4 Because of The large size of The gene iT suffers abouT a 10fold higher muTaTion raTe Than average 0 In fact gven f1e producfon of 8 X 07 sperm per day a norma mae produces a sperm mm a new mufafon In f1e dysfropnn gene every 10 or 11 seconds Individuals who carry aT easT one quotgoodquot copy of The dysTrophin gene are proTecTed from The disease 0 However since The gene is locaTed on The X chromosome and males only carry a single copy of The X chromosome boys who inheriT even a single muTaTed copy of dysTrophin gene suffer from The disease 0 Females are rarely affecTed since They carry Two copies of The X chromosome DMD is a much more severe disease Than BMD and accounTs for abouT 85 of all cases of Xlinked muscular dysTrophy o AffecTed boys are generally normal during The firsT year or Two of life buT develop muscle weakness aT age 3 To 5 years when They begin having difficulTy climbing sTairs and rising from a siTTing posiTion o The child is confined To a wheelchair by The age of 12 and is unlikely To survive pasT The age of 20 PaTienTs die of respiraTory failure or because The myocardial muscle is also affecTed hearT failure BMB paTienTs are clinically separaTed from DMD paTienTs if They are sTill walking aT The age of 16 0 Muscle biopsies can also be used To make The diagnosis 0 Such paTienTs show a significanT variabiliTy in The progression of The disease ThereafTer ExperimenTs measuring The dysTrophin proTein levels in paTienTs have shown ThaT DMD paTienTs have liTTle or no funcTional dysTrophin whereas almosT all BMD paTienTs have proTein levels ThaT are much higher Though reduced from The levels found in normal individuals Molecular sTudies of The dysTrophin muTaTions of hundreds of paTienTs wiTh DMD or BMD have revealed ThaT mosf cases of Xnked muscuar dysfropny are caused by arge deefons fnaf Invove exons The reason for This is noT known Page 9 Fall 2006 Modified from hTTpwwwmhhecombr39ooker39 LECTURE 4 BIO 184 o InTer39esTingly some of The deleTions ThaT cause BMD are as large or39 larger Than Those ThaT cause DMD even Though The same genera region of ve profein is involved Deletions 46 deletion in spectrinrepeat Gauging BMD region gtmid BMD or intermediate E phenotypes P Deletions causing DMD Diagrams Taken from GeneTics in J Medicine by Thompson and l Thompson 1991 539 Dystrophln cDNA 3 I dvs lronhin ma lure mRNA 0 Why do you Think ThaT This is The case WhaT Types of deleTions do you pr39edicT DMD paTienTs car39r39y39gt BMD paTienTs39gt o WhaT does This Tell you abouT The way ThaT dysTr39ophin funcTions dur39ing muscle conTr39acTion39gt Which parTs of The pr39oTein ar39e cr39iTical and which are less cr39iTical for iTs funcTion39gt Page 10 Modified from hTTpwwwmhhecombrooker Fall 2006 BIO 184 LECTURE 4 B CysTic Fibrosis 0 Since The 1960s cysTic fibrosis CF has been one of The mosT publicly visible of all human geneTic diseases 0 IT is one of The mosT common faTal childhood geneTic disorders wiTh an incidence of abouT 1 in 1600 among Caucasians 0 One in every 22 Caucasians is a carrier 0 The lung and pancreas are The major organs affecTed by The disease 0 Chronic obsTrucTive lung disease develops as a resulT of Thick secreTions and recurrenT infecTions o InTense managemenT of lung problems has increased life expecTancy To abouT 30 years 0 Deficiencies of pancreaTic enzymes lipase Trypsin and chymoTrypsin prevenT normal digesTion DigesTion and nuTriTion can be largely resTored by pancreaTic enzyme supplemenTs o InTeresTingly abouT 15 percenT of CF paTienTs have residual exocrine funcTion These paTienTs are Termed pancreaTic sufficienT PS 0 These same paTienTs also have beTTer growTh and pulmonary funcTion and a superior overall prognosis Than do The majoriTy who are pancreaTic insufficienT PI 0 The CF gene was isolaTed in 1989 and has been exTensively sTudied since ThaT Time 0 IT lies on The long arm of chromosome 7 0 IT spans abouT 250000 base pairs of DNA wiTh 27 exons 0 IT encodes for a large Transmembrane proTein of abouT 170 kiloDaITons kD called The CFTR CF Transmembrane conducTor regulaTor proTei n o The polypepTide is composed of Two repeaTed moTifs each of which has 6 membranespanning regions adjacenT To a nucleoTide ATP binding fold NBF o The Two moTifs are separaTed by a cyToplasmic region ThaT has a regulaTory funcTion and is Thus named The R domain Page 11 Modified from hTTpwwwmhhecombrooker Fall 2006 BIO 184 LECTURE 4 o A diagram of The proTein showing iTs Transmembrane crossings is provided below 0 Keep in mind however ThaT The acTual proTein has a 3D sTrucTure in which The Transmembrane regions conTacT one anoTher To form a round pore channel in The membrane CFTR protein 39 l I Diaaram from GeneTics in Medicine o DefecTs in The proTein disrupT The normal flow of chloride ions inTo and ouT of epiThelial Tissues because The proTein is a regulaTed chloride channel 0 Binding of ATP To The NBFs apparenle acTivaTes The channel When The channel malfuncTions salT accumulaTes inside The cells 0 This causes waTer To flow inTo The cells To relieve osmoTic pressure leaving behind a Thick mucous ThaT clogs pancreaTic ducTs and creaTes a breeding ground for bacTeria in The lungs o The geniTal TracT is also affecTed and only 237 of males and 10 of females are ferTile 0 An individual musT have Two disrupTed copies of The gene To have The disease 0 MuTaTions of all Types excepT major deleTions and rearrangemenTs have been found ThroughouT The coding region including small deleTions and inserTions and poinT muTaTions of all Types 0 The Types and locaTions of The mosT common muTaTions along wiTh Their associaTed phenoTypes are given below 1 Deletion of phenylalanine 508 due To a 3 bp deletion 70 of all CF muTaTions are caused by a Three basepair deleTion ThaT eliminaTes The 508Th amino acid in The polypepTide which is a phenylalanine F This deleTion is wriTTen as AF508 and because iT Page 12 Modified from hTTpwwwmhhecombrooker BIO 184 Fall 2006 LECTURE 4 involves Three basepairs does noT change The reading frame during TranslaTion NoneTheless The muTaTion is very deleTerious All paTienTs who are homozygous for This muTaTion have The more severe PI form of The disease The missing phenylalanine is locaTed wiThin The firsT NBF NBF1 and prevenTs The proTein from properly inserTing inTo The plasma membrane PaTienTs have virTually no funcTional CFTR in The plasma membranes of Their epiThelial cells and chloride ions remain Trapped inside These cells leading To The disease 2 DeleTion of isoleucine 507 due To a 3 bp deleTion A1507 is also caused by a 3 basepair deleTion This muTaTion resulTs in The loss of an isoleucine immediaTely adjacenT To The phenylalanine losT in The A508 muTaTion As mighT be expecTed This muTaTion also confers The PI form of The disease 3 Missense muTaTions in The NBF NBF missense muTaTions are also fairly common Those ThaT confer The PI phenoType resulT in changes in amino acids ThaT are highly conserved in homologous ATPbinding domains of oTher proTeins Those ThaT confer The PS phenoType cause changes in amino acids ThaT are noT highly conserved 4 Missense muTaTion in amino acid 117 117 arg a his is a less common muTaTion buT is inTeresTing because iT is associaTed only wiTh The PS phenoType This missense muTaTion resulTs in a change from an arginine To a hisTidine aT amino acid 117 which is locaTed in a parT of The proTein ThaT siTs in The exTracellular environmenT see diagram nexT page 0 Some individuals have a phenoType Infermedafe beTween PI and PS eg PI buT mild lung disease Many of These individuals are heferozygous carrying The A508 allele on one of Their copies of chromosome 7 and a differenT muTaTion ThaT causes a milder phenoType on The oTher Page 13 Modified from h l39139pwwwmhhecombrooker Fall 2006 BIO 184 LECTURE 4 0 There are probably many phenotypically normal people who have l39wo mufa l39ed copies of The CF gene However bO l39h l39heir mutations are either silent or confer Such a mild phenotype That The diSeaSe is never diagnOSed o A diagram of The CF gene and CFTR protein along with information about various mutations and their associated phenotypes is given below El missense mutation 533 Arg Stop is due to a CGgtTG point B nonsense mutation mutation CG dinucleotides are the most A deletion important mutational hotspots in the genome V insertion splice mutation AF508 is the most common allele d 39 Caucas39ans39 frequency 03968 E ln52556 a zoo insertion in an 8bp D AT dinucleotide repeat Such repeats f 39 AFSOS E are hotspots or mutation A A El El A I39JEI H E El E ElEl V A E CFTR gene I IHHI Exon 1 3 5 9 11 13 15 19 21 23 I ll L NBF 1 exons Rdomain NBF 2 exons exon 117 Arg His mild allele CFTR protein No missense mutations l 10 NBF1 Mutations have yet been found in 1255 Ser gtStop a nonsense I 1 this domain mutation that leads to mild 2 adjacent 3 bp deletions A F508 pulmonary disease even in the Al 507 homozygous state but with Pl 6 of 9 substitutions in a 13 aa conserved sequence critical 560 A Q Thr function 551 GlY ASP 549 Ser Asn I 549 Ser gtArg T gtG 4 mutations In one 549 SerArg AC 4 mutations that together may comprise codon Suggests a 549 ser quote 1020 of the nonAF508 alleles mutation hotspot 2 mild alleles 455 AlagtGlu in NBF1 574 Pro gtHis Figure 129 Selected mutations in the CFTR gene and their effects on the protein Unless otherwise noted all the mutations cause pancreatic insuf ciency PI Alleles associated with PI do not necessarily cause severe lung disease eg 1255 SergtStop The exons introns and domains of the protein are not drawn to scale Based on data from Cutting et al 1990a Dean et al 1990 Kerem et al 1990a Sangiuolo et al 1991 White et al 1990 and Zielenski et al 1991 I Diagram from Genetics in Medicine Page 14


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."

Janice Dongeun University of Washington

"I used the money I made selling my notes & study guides to pay for spring break in Olympia, Washington...which was Sweet!"

Jim McGreen Ohio University

"Knowing I can count on the Elite Notetaker in my class allows me to focus on what the professor is saying instead of just scribbling notes the whole time and falling behind."

Parker Thompson 500 Startups

"It's a great way for students to improve their educational experience and it seemed like a product that everybody wants, so all the people participating are winning."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.