New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

Infant Development

by: Chanel Bogan DDS

Infant Development DEP 6930

Chanel Bogan DDS
GPA 3.6

David Lewkowicz

Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

David Lewkowicz
Class Notes
25 ?




Popular in Course

Popular in Psychlogy

This 6 page Class Notes was uploaded by Chanel Bogan DDS on Monday October 12, 2015. The Class Notes belongs to DEP 6930 at Florida Atlantic University taught by David Lewkowicz in Fall. Since its upload, it has received 16 views. For similar materials see /class/221644/dep-6930-florida-atlantic-university in Psychlogy at Florida Atlantic University.


Reviews for Infant Development


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 10/12/15
Monoamine Oxidase A Gene Promoter Variation and Rearing Experience In uences Aggressive Behavior in Rhesus Monkeys Timothy K Newman Yana V Syagailo Christina S Barr Jens R Wendland Maribeth Champoux Markus Graessle Stephen J Suomi J Dee Higley and Klaus Peter Lesch Background Allelic variation of the monoamine oxidase A MAOA gene has been implicated in conduct disorder and antisocial aggressive behavior in humans when associated with early adverse experiences We tested the hypothesis that a repeat polymorphism in the rhesus macaque MAOA gene promoter region in uences aggressive behavior in male subjects Methods Fortyfive unrelated male monkeys raised with or without their mothers were tested for competitive and social group aggression Functional activity of the MAOA gene promoter polymorphism was determined and genotypes scored for assessing genetic and environmental in uences on aggression Results Transcription of the MAOA gene in rhesus monkeys is modulated by an orthologous polymorphism rhMAOAeLPR in its upstream regulatory region High and loweactivity alleles of the rhMAOAeLPR show a genotype gtlt environment interaction effect on aggressive behavior such that motherereared male monleeys with the loweactivityeassociated allele had higher aggression sco s Conc sions These results suggest that the behavioral expression of allelic variation in MAOA activity is sensitive to social experiences early in development and that its functional outcome might depend on social context Key Words MAOA promoter VNTR rearing aggression rhesus been acknowledged to account for significant individual variation in susceptibility or resilience to risk factors One aspect of environment that is thought to play a critical role in modifying the in uence of genes that convey risk for complex behavioral disorders is one s early experience particularly dure infancy and early childhood however identification of genetic risk factors that can be modified by protective environ mental conditions or exacerbated by adverse experiences re mains largely undetermined for complex psychiatric and behave ioral disorders as does isolation of genetic variants that increase resilience or vulnerability to environmenml risks Monoamine oxidase A MAOA EC 1434 located on chroe mosome Xp113 oxidizes the amine neurotransmitters serotonin dopamine and norepinephrine and is expressed in a cell type7 specific manner Shih 1991 Thorpe et al 1987 In humans low MAOA activity is associated with impulsive behavior and conduct disorder Gabel et al 1995 Lawson et al 2003 and gene variants that result in low MAOA activity are implicated in the pathogen esis of aggression and impulsive violence Brunner et al 1993 Shih et al 1999 but see Manuck et al 2000 2002 A hemizygous chain termination mumtion in exon 8 of the MAOA gene is linked to mild mental remrdation and occasional episodes of impulsive aggression arson and hypersexual behavior such as attempted rape and exhibitionism in affected male subjects from a single T he interaction between genes and environment has long From the Laboratow ofClinical Studies TKN CSBJDH National Institute on Alcohol Abuse and Alcoholism Laboratow of Comparative Ethology MC SJS National Institute on Child Health and Human Development Poolesville Manland and the Department of Psychiatw and Psychor therapy YVS JRW MG KVPL Clinical and Molecular Psychobiology University ofWiirzburg German Address re print req uests to Timothy K Newman PhrDr National Institute on Alcoholism andAlcoholAbuseNational Institutes of Health Laboratory of Neurogenetics 5625 Fishers Lane Room 3532 Rockville MD 20852 Email tknewmanmailrnihgov Received May 10 2004 revised September 20 2004 accepted October 21 2004 0006732230518000 doi101016jbiopsych200410012 large family Brunner et al 1993 Affected male subjects exhibit markedly disturbed monoamine membolism and an absence of MAOA enzymatic activity in cultured fibroblasts Although inhie bition of MAOA in adults leads to antidepressant effects but not aggressionerelated behavior the deviate behavior in MAOA deficient men might be due to structural or compensatory changes resulting from altered mon olism during neurodevelopment The behavioral consequences of mrgeted inactivation of AOA in mice confirm the aggressive phenotype of the nonsense mumtion in the human MAOA gene Cases et al 1995 Seif and De Maeyer 1999 Mice deficient in MAOA display elevated brain levels of serotonin and increased reactivity to stress hyperactive smrtle responses violent motions during sleep and abnormal posture and aggressive behavior Residenti intruder tests elicited enhanced male aggressiveness and in creased injury between male cageemates A functional length polymorphism in the transcriptional con trol region for the MAOA gene MAOAALPR affects transcripe tional activity Deckert et al 1999 Sabol et al 1998 Alleles associated with reduced in vitro MAOA activity were associated with antisocial behavior in one study of alcoholedependent male subjects Samochowiec et al 1999 but not in another Koller et al 2003 Inferred high MAOA activity was associated with impule sivity hostility and lifetime aggression history in a co unity sample of men Manuck et al 2000 2002 Caspi et al 2002 reported a significant interaction between childhood maltreate ment and low MA activityiassociated alleles in modulating the risk for antisocial behavior aggressiveness and violence These results were recently replicated by Foley et al 2004 The role that early adverse experience plays in altering a constellation of physiologic and behavioral processes in nonhue man primates has been extensively studied Harlow was the first to develop a nonhunJ n primate model of early adversity by rearing young monkeys in the relative social impoverishment of sameeaged peers rather then with their mothers in normal social groups Harlow and Harlow 1965 Research since then has clearly esmblished that appropriate parenml input is critically important for normative development of the hypothalamic7 ituimryiadrenal axis and neurotransmitter system function Hi7 gley et al 1994 Primates removed from their mothers and BIOL PSYCHIATRY 2005571677172 2005 Society of Biological Psychiatry 168 BIOL PSYCHIATRY 2005571677172 deprived of early participation in complex social groups later exhibit aberrations in neurochemical function neuroendocrine stress axis activity and in many aspects of social behavior however individual variation in susceptibility to environmenml manipulation remains Kraemer 1985 Suomi 1987 To date few studies have isolated genetic sources for variation in response to early adverse rearing conditions in human or nonhuman prii mates We recently demonstrated a gene gtlt environment inter action between the rhesus macaque serotonin transporter gene promoter polymorphism and early rearing experience that ac counts for some variation in the physiologic and behavioral outcome of early adverse environments Barr et al 2003a Ben nett et al 2002 Champoux et al 2002 Indeed nonhuman primates make excellent models for studying the relative contri7 butions of genes and a stressful environment because unlike humans their environments can be controlled Barr et al 2003b Here we characterize the structure and functional impact of a repeat polymorphism in the transcriptional control region up hypothesis that rhMAOAiLPR genotypes are associated with variation in aggressive behavior and that psychosocial stress following early parenml absence in uences the impact of allelic variation in MAOA function on social competence We based our hypothesis on the observation that 1 pharmacologic or genetic manipulation of MAOA activity alters aggressionirelated behave iors in experimental animals 2 genetic variation associated with low or absent MAOA activity is implicated in the pathogenesis of aggression and impulsive violence in humans and mice and 3 childhood maltreatment modulates the MAOAirelated risk for antisocial behavior aggression and violence Methods and Materials Molecular Genetics e rhMAOAiLPR is located 11 kilobases kb upstream of the MAOA transcription initiation site and is composed of 187base7pair bp repeat elements Figure 1 The sequence of the transcriptional control region of the rhMAOA gene 1327 to 1 with respect to the translation initiation codon was derived from a 137kb clone rhMAP71327 EMBLiGenBank accession number AJ544234 that was isolated from genomic deoxyi ribonucleic acid DNA by polymerase chain reaction PCR7 With primers map1 5iATATACGCGTCCCAGGCTGCTCCAGAi e s rhM A7 and corres ondin to tiOnS 1327 to 1309 malpr1 5 7CCCAGGCTGCTCCAGAAAC and 71103 to 71086 malprZ SAGGACCTGGGAAGTTGTGC with respect to the translation initiation codon of the rhesus monkey MAOA gene 5 anking regulatory region were used to generate 2067 2247 or 2427bp fragments Polymerase chain reaction amplification 40 sec at 94 C 40 sec at 55 C 60 sec at 72 C for 35 cycles was carried out in a final volume of 25 uL consisting of 60 ng genomic DNA 200 pmolL of each def ucleoside triphosphate 2 mCi of 01 ZPldeoxycytidine triphosphate 10 mCimL 300 Cimmol 10 pmol of sense and antisense primers 75 mmolL TrisiHCl pH 90 20 mmolL NH4ZSO4 15 mmolL MgClZ 01 Tween720 and 2 units of Taq DNA polymerase Polymerase chain reaction products were wwweseviercomocatebiopsych TK Newman et al 7 6 Length variation ATG 5 rhMAOA LPR 1 l MAOA transcriptional control region Figure 1 Map ofthe transcriptional control region ofthe rhesus monkey monoamine oxidase A rhMAOA generlinked EMBLrGenBank accession number N544234 polymorphic region The rhMAOArlinked polymorphic 1 L 577 r 1 repeats separated by electrophoresis through a 6 denaturing polyacryli mide gel and detected by autoradiography For the generation of luciferase gene constructs DNA frag ments of rhMAP71327 conmining the 57 67 and 77repeat variants of the rhMAOAiLPR were ligated into the promoterless luciferase luc expression vector pGL3 basic Promega Madison Wisconsin Inserts and insertivector boundaries were verified by sequence analysis Length variants of MAP71327luc constructs and controls were transiently expressed in SH75Y5Y human neuroblastoma cells which constitutiVely express MAOA and in MAOAinegative cos 7 African green monkey kidney cells Klegeris and McGeer 2000 Cells were grown at 37 C in a humidified 5 CO2 atmosphere in Dulbecco s modified Eagle s medium supplemented with 15 feml calf serum 50 ugmL streptomycin and 50 unitsmL penicillin Luc gene expression was studied relative to the pGL3 basic and pGL3 control vectors Transfection efficiency was assessed by cotransfection with 5 pg of pCMV7lacZ vector For transient expression SH75Y5Y neuroi blastoma cells 2 gtlt 105 were exposed for 29 hours to 4 pg of luciferase constructs complexed with FuGENE 6 transfection reagent Roche Diagnostics Basel Switzerland After extraction in 250 uL of lysis buffer Promega luciferase activity was assayed by the addition of 10 til of cell lysate at 157sec intervals to 100 uL of luciferin reagent The extract 10 uL was also tested or 39 activi and 39f ea quot quot39 were normal ized to bigalactosidase activities with equal amounts of toml protein determined by the method of Bradford Four indepen7 dent experiments in triplicate with different plasmid preparations were performed Subjects Behavioral dam were collected from 45 male groupihoused rhesus macaques Macaca mulatm at the National Institutes of Health Animal Center Subjects were selected from five birth cohorts born between 1991 and 1995 and were 375 years of age when tested Individuals within cohort groups were less than 9 months apart in age Only male monkeys were included in this study because their single X chromosome generates two rhi MAOAiLPR genotypes with either high activity 57 and 67repeat alleles or low activity 77repeat allele Female animals were not included because they carry two copies of the X chromosome homozygosity for the lowiactivity allele is rare and it is not possible to determine which of the two alleles is inactivated in heterozygous female monkeysThe subjects were divided into two groups with different social and rearing experiences early in life which fell into one of the following categories 1 mother reared either reared with the biological mother or crossifostered or 2 peerireared with either continuous or dail limited access to a peer group of three to four monkeys Champoux et al 1999 TK Newman et al Peerireared monkeys selected randomly were separated from their mothers shortly after birth placed in the nursery and given access to sameiaged peers at 30 days of age either continuously or during daily play sessions Motherireared and crossifostered monkeys remained with the mother or foster mother typically within a social group At approximately 7 months of age motherireared monkeys were weaned and placed together with their peerireared cohort in large mixedisex social groups Prof tocols for the care and use of experimental animals were approved by the Institutional Animal Care and Use Committee of the National Institute on Alcohol Abuse and Alcoholism and the National Institute of Child Health and Human Development National Institutes of Health Assessing Aggressive Behavior Severe aggressive behavior within relatively small social groups of captive monkeys is generally infrequent Therefore we chose to assess individual aggression by using two types of aggressive behaviors that are commonly displayed in rhesus social groups 1 dyadic food competition whereby aggressive behavior was elicited by offering pairs of monkeys matched for age and relative dominance rank coveted prized food items eg grapes peanuts cereal Primaitreats in a competitive social situation with the frequency of winslosses recorded and 2 home cage social aggression whereby aggressive acts were observed and recorded durin normal social interactions in undisturbed daily observation sessions The frequency of wins losses during competitive aggression was converted to Zscores to control for differences between testing sessions The duration in seconds of threats displacements conmct aggression and other aggressive behaviors were recorded for each subject during three 307min sessions All behavioral observations were con ducted before genotyping Statistics We used analysis of variance ANOVA for testing associai tions between the 39 39 J 39 ariable of MAOA 39 r d rearing condition and the dependent measures of aggression Although our subjects derive from captive colony animals we assembled a panel of subjects with an average idenity by descent o 168 a measure of pairwise relatedness equivalent to eighthidegree relatives third cousins which is sufficiently low to be considered essentially unrelated Robin et al 1997 On the basis of the functional assessment of rhMAOAiLPR variants monkeys with highiactivity 57 and 67repeat alleles were com bined for comparison with those with the lowiactivity 77repeat allele Animals were assigned nominal independent variables according to rhMAOAiLPR function high activity vs low activity and rearing condition peerireared vs motherireared to deter mine the effects of these variables on 1 aggression during food competition and 2 home cage aggression Analyses were performed with JMP smtistical software SAS Institute Cary North Carolina Criterion for significance was set atp lt 05 Results Polymerase chain reactionibased genotype analysis of 217 rhesus monkeys revealed three alleles of 5 6 and 7 repeats each 18 bp in length with allele frequencies of 35 for the Sirepeat 25 for the 67repeat and 40 for the 77repeat allele The activity of both the 57and 67repeat variant was approxi7 mately 26 higher than that of the 77repeat form p lt 005 Figure 2 When clustered by activity the count and fre quency of the highiactivity group versus the lowiactivity BIOL PSYCHIATRY 2005571677172 169 A m on 0 Relative Luciferase Activity arbitrary units N n 5 6 7 pGL3 basic Figure 2 Transcriptional activity of the 57 67 and 7rrepeat rhMAOArLPR variants in SHVSYSY human neuroblastoma cells which constitutively exr MA A quot quot quot M Hr39 7 rayharRalllt are means SD of four independent experiments in triplicate The MAOA transcription control region rhMAP71327 containing the 57 67 and 7rrer peat variants ofthe rhMAOArLPR was ligated into the promoterless lucifr erase luc expression vector pGL3 basici rhMAOArLPR rhesus monkey monoamine oxidase A generlinked polymorphic regiont p lt 005 one way analysis of variance followed by Fisher s protected least signi cant difference test Sr and rrepeats black bars vsi 7rrepeats gray bars group was 11 48 and 12 55 respectively for the peer reared and 7 32 and 15 68 for the motherireared monkeys with no significant differences in the genotype distribution for the two rearing groups x21 12 p 2 There was a significant genotype gtlt rearing interaction on aggressive behavior during food competition F 543 p 03 but no main effects of genotype or rearing Figure 3 Post hoc tests Fisher s protected least significant difference indicated that motherireared male monkeys with the lowiactivity genotype mean Z score 88 38 were significantly more aggressive n A male monkeys with the lowiactivity genoi type mean Zscore 31 i 29 but not more so than male monkeys with the highiactivity genotype regardless of rearing experience mean Zscore motherireared lt19 45 peer reared 34 32 A similar pattern existed for aggressive behavior observed during normal home cage social interactions There was an interaction between genotype and rearing experi7 ence F 668 p 015 but no main effects Figure 4 Motherireared male monkeys with the lowiactivity allele spent more time engaged in aggressive behavior mean sec 2596 546 than nurseryireared male monkeys with the lowiactivity allele mean sec 659 1 446 and motherireared male monkeys with the highiactivity genotype mean sec 660 690 In both tests the higher smndard error around the mean for motherireared male monkeys with the lowiactivity MAOA allele and peerireared male monkeys with highiactivity alleles was due to two outliers Analyses conducted without the outliers did not significantly alter the smtistical findings We also con ducted a power analysis to ensure that our sample size was adequate for this study Given our dam set we estimated the power to detect the interaction effects at 74 for competitive aggression and 79 for home cage aggression Discussion Our results provide evidence of an association between variation in the r 7 R and aggressive behavior in male rhesus monkeys that is dependent on early environment how wwweseviercomocatebiopsych 17 O BIOL PSYCHIATRY 2005571677172 0 Low Activity I High Activity ZScored Food Competition in Peer Reared Mother Reared Figure 3 Effects of rhMAOArLPR highractivity Sr and 67repeat and lowr 39 39h 39 39 39 39 h rreared vsip J 33 39 39 39 39 39 39 39 39 39 natawere available for 34 subjects 22 peerrreared high activity n 10 low activity n 1 i2 motherrreared high activity n 5 low activity n 7 For analysisav 39 39 39 39 39 J39 394 39 L L L 39 39 39 variance yielded no main effects for rhMAOArLPR or rearing environment but did indicate a signi cant interaction between rearing environment an genor ty ompetitive aggression Fi30 543 03 0s 0c tests Fisher s protected least signi cant ifference 05 indicated that age gressiv be i0 as signi cantly in uen ed by p for other ity counterparts and lowractivity peerrreared mon eysi r MA sus monkey monoamine oxidase A generlinked polymorphic regioni ever We found that neither genotype nor early rearing experie ence alone Were suf cient to in uence smtistically meaningful differences in aggressive behavior in our test subjects Male monkeys that engaged in competitive aggression most fre quently measured during dyadic food competition as Well as in normal social group settings carried the loWeactivity rhMAOAe LPR allele but Were raised With their mothers in typical age varied social groups rather than in peereonly groups In our colony monkeys reared Without their parents consise tently show altered behavior including increased aggression and it is abundantly clear that parenml absence during infancy has lifeelong consequences on the development of competent social functioning Bastian et al 2003 Suomi et al 1976 We had anticipated that the effects of impoverished infancy induced through parenml absence Would interact With lOW MAOA activity to increase adult aggression as suggested by the results of similar analyses in human subjects Caspi et al 2002 Foley et al 2004 Yet the peerereared male monke s With lOW MAOA activity engaged in the least amount of competitive and social group wwwelseviercomlocatebiopsych TK Newman et al aggression and Were essentially undifferentiated from mother reared male monkeys With the higheactivity alleles For the motherereared monkeys our findings are consistent With some of the human and rodent studies that associate greater aggression With genetic deficiencies in MAOA Brunner et al 1993 Cases et al 1995 yet are in contrast to studies demonstrating the come pounded risk for high aggression in individuals With both the loWeactivity genotype and childhood maltreatment Capsi et al 2002 Foley et al 2004 There are several potential explanations for our findings First the childhood maltreatment experienced by human subjects in the Caspi and Foley studies primarily took the form of abuse and aggression by adults Whereas the adversity modeled in our rhesus monkeys is characterized by complete absence of adult interactions and limited experience With models for aggression or violence during the early developmenml period Second species differences in the role of aggression and its social context must also be considered For rhesus monkeys the development and expression of competence in aggressive behavior is critical to social success and survival It is important to note that much of e aggression measured during food competition and in social groups should be regarded as falling Within the range of normal 400 0 Low Activity I High Activity 350 300 250 200 150 100 50 Mean Seconds Engagedin Aggresgon Mother Reared Peer Reared Figure 4 Naturally occurring aggression during daily social interactions shown as a function of rhMAOArLPR and early rearing environment Data were available for 35 subjects 22 peerrreared high activity 10 low activity n i2 and 13 motherrreared high activity n 5 low activity n 9 Analysis ofvariance yielded no main effects of rhMAOArLPR genor type or rearing environment but did reveal a signi cant interaction effect between genotype and rearing Fi31 668 p i02i Post hoc tests indicated that motherrreared male monkeys with the low activityrassocir ated rhMAOArLPR allele spent more time engaged in aggressive behavior than their highractivity counterparts as well as the peerrreared subjects with either allelei rhMAOArLPR rhesus monkey monoamine oxidase A generlinked polymorphic regioni TK Newman et al social behavior ie it is not necessarily antisocial behavior It is reasonable to suggest then that the form of increased aggression that does not escalate to injurious levels Which is more common among peerereared subjects might be advanmgeous for male rhesus monkeys and that the lOWHQCLiVitY MAOA allele might be under positive selection This is supported by our observation unpublished that male monkeys With the lOWHQCLiVitY MAOA allele atmin higher dominance rank in our colony Third MAOA deficient mice are reported to shoW increased reactivity to stress Cases et al 1995 suggesting perhaps a similar response in monkeys 39 39 39 39 poun o 7 served increases in stressereactivity evidenced by peerereared subjects Suomi 1991 This might result in increased inhibition that in turn Would manifest as decreased participation in social activity including aggressiveness Indee studies shoW that nurseryereared monkeys are prone to developing fearful and anxious temperaments Higley and Suomi 198 Similar to ndings from human cohorts aggressive behavior in monkeys is increased in the presence of both lOW MAOA enzymatic activity as Well as early exposure to a range of social behaviors that includes adult aggression Taken together these results lend additional support to the observation that genetic susceptibility or vulnerability depends critically on environmene ml modulation Because rhesus monkeys exhibit temperamenm and behavioral traits that parallel human behaviors associated With allelic variation of MAOA function it might be possible to better undersmnd the proximal and ultimate mechanisms pro ducing individual differences in such traits Nonhuman primate studies investigating the genotypic gtlt environmenml interaction in social functioning might also be useful in identifying environ mental factors that either compound the vulnerability conferred by a specific genetic mumtion or conversely act to improve the behavioral outcome associated With that genotype In turn the similarity of both genomic and behavioral variation in humans and rhesus monkeys indicates the potential value of nonhuman 39 AOA gene variation might be used to better mrget therapeutic agents and protective experiential therapies used in the treatment of aggressive and violent behavioral disorders This worie was supported by the National Institutes of Health SJS K70 and Deutsche Forschungsgemeinschaft KAPL SFB 581 KFO 125171 We thanie Allyson Bennett for her contributions to early drafts of the manuscript and to the numerous staffstudents who participated in data collection Wendy Airoso Meredith Bastian A n Dodson Graham Flory Sue Higley Anne Hurley Kristi Kaiss Ted King Stephen Lindell Karen Lucas fudy Pushieas Heather Rupp Courtney Shannon Thomas Tsai Katherine Weld and Kristin Zajiceie We also thanie Stan Graham Longina to this study and authorship order should be considered inter changeable The rst and second authors contributed equally to this study and authorship should be considered interchangeable Barr CS Newman TK Becker ML Champoux M Lesch KP Suomi SJ et al 2003a Serotonin transporter gene variation is associated with alcohol sensitivity in rhesus macaques exposed to earlyrlife stress Alcohol Clin Exp Res 278127817 Barr CS Newman TK Becker ML Parker CC Champoux M Lesch KP et al 2003b The utility ofthe nonrhuman primate Model for studying gene BIOL PSYCHIATRY 2005571677172 171 by environment interactions in behavioral research Genes Brain Behav 23367340t Bastian ML Sponberg AC Suomi SJ Higley JD 2003 Longrterm effects of infant rearing condition on the acquisition of dominance rank in 39 quot d d 39 39 39 Psychobiol 751 BennettAJ Lesch KP HeilsA LongJC Lorenz JG ShoafSE etal 2002 Early experience and serotonin transporter gene variation interact to in ur ence primate CNS function MolPsychiatry 71187122 Brunner HG Nelen M Breake eld X0 Ropers HH van Oost BA 1993 Ab L aedwtha for monoamine oxidase A Science 262578 7580 Cases OSeifIGrimsbyJGasparPChen K Pournin S eta1 995 Aggressive behavior 39 39 39 m M fL 39 39 J 39 39 39 39 mice lacking MAOA Science 268176371766 Caspi A McCIay J Mof tt TE Mi J Martin J Craig IW et al 2002 Role of genotype in the cycle ofviolence in maltreated children Science 297 8517854 Champoux M Shannon C AirosaWD Suomi SJ 1 999 Playand attachment behavior of peerronly reared and surrogatepeerrreared rhesus monke infants in their social groups In Reifel S editor Play and Culture Studies Volume 2 Play Context Revisited Stamford Ablex 209 721 7 Champoux M Bennett A Shannon C Higley JD Lesch KP Suomi SJ 2002 Serotonin transporter gene polymorphism differential early rearing and behavior in rhesus monkey neonates Mol Psychiatry 871 t DeckertJ Catalano M Syagailo W 13051 M Okladnova 0 Di Bella D etal 1999 Excess of high activity monoamine oxidase A gene promoter alleles in female patients with panic disorder Hum Mol Genet 86217 62 4t Foley DL Eaves LJ Wormley B Silberg JL Maes HH Kuhn J Riley B 2004 Childhood adversity monoamine oxidase A genotype and risk for con duct disorderiArch Gen Psychiatry 61 738 7744 Gabel SStaderJ BjornJSchindedecker R BowdenCL1995 Homovanillic 39 and monoamine oxidase in sons ofsubstancerabusing fathers Rer Iationship to conduct disorderJ StudAcohol561357139 Harlow HF Harlow MK1965 The affectional systems In SchrierAM Hare low HF Stollintz F editors Behavior ofNonhuman Primates New York Academic Press 2877334 Higley JD Suomi SJ 1986 Parental behaviour in primates In Sluckin W IVVAVJ 1527207 HigleyJD Linnoila MSuomi SJ1994 Ethological contributions InAmmerr ma RT Hersen M Sisson LA editors Handbook onggressive and De structive Behavior in Psychiatric Patients New York Plenum Press 17732 Klegeris A McGeer PL 2000 RrrrDepreny inhibits monocytic THP71 cell u 39L39Lquot pm 39 39 u Koer G Bondy B Pruess W Bottlender M Soyka M 2003 No association between a polymorphism in the promoter re ion of the MAOA gene with antisocial personality traits in alcoholicsiAlcoholAlcohol3831r43 Kraemer GW 1985 Effects of differences in early social experience on primate neurobiologicalibehavioral development In Reite M Field T editors The Psychobiology of Attachment New York Academic Press 1357161 Lawson DC Turic D Langley K Pay HM Govan CF Norton N et al 2003 Association analysis of monoamine oxidase A and attention de cit hyr peractivity disorderiAmJMed Genet 1 1 6584789 Manuck SB Flow JD Ferrell RE Mann JJ Muldoon MF 2000 A regulatow polymorphism of the monoamine oxidaserA gene may be associated with variability in aggression impulsivity and central nenous system 39 39 39 5 ch39 t He J 723 Manuck SB Flow JD Muldoon MF Ferrell RE 2002 Central nervous system serotonergic responsivity and aggressive disposition in men Physiol Behav 777057709t Robin RW Chester 13 Rasmussen JK Jaranson JM Gold man D 1 997 Prevar Ience d 39 39 39 trauma and 39 439 d in a southwestern American Indian community Am J Psychiatry 15415827 1588 Sabol SZ Hu S Hamer D 1998A functional polymorphism in the mono amine oxidase A gene promoter Hum Genet 8 6217624 Samochowiec J Lesch KP Rottmann M Smolka M Syagailo W Okladnova O et al 1999 Association of a regulatow polymorphism in the pro wwweseviercomocatebiopsych 172 BIOL PSYCHIATRY 2005571677172 moter region of the monoamine oxidase A gene with antisocial alcoholism Psychiatry Res 8667772 Seifl De Maeyer E 1999 Knockout corner Knockout mice for monoamine oxidase A lntJNeuropsychopharmcol2241r243 Shih JC 1991 Molecular basis of human MAO A and B Neuropsychophare macolo 4177 Shih JC Chen K Ridd MJ 1999 Role of MAO A and Bin neurotransmitter metabolism and behaviortAnnuRevNeurosci221977217 Suomi SJ 1987 Genetic and maternal contributions to individual differ ences in rhesus monkey biobehavioral development In Krasnegor NA wwwelseviercomlocatebiopsych TK Newman et al Blass EM Hofer MA Smotherman WP editors Perinatal DevelopmentA PsychobiologicalPerspective New York Academic Press 3977420 Suomi SJ 1991 Early stress and adult emotional reactivity in rhesus monr keys Ciba FoundSymp 1561 71 7183 discussion 1837188 Suomi SJ Collins ML Harlow HF Ruppenthal GC 1976 Effects ofmaternal and peer separations on young monkeys J Child Psychol Psychiatry 1 7 1017112 Thorpe LW Westlund KN Kochersperger LMAbel CW Denney RM 1987 Immunocytochemical localization of monoamine oxidases A and B in human peripheral tissues and brainJ Histochem Cytochem 3523732


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Bentley McCaw University of Florida

"I was shooting for a perfect 4.0 GPA this semester. Having StudySoup as a study aid was critical to helping me achieve my goal...and I nailed it!"

Kyle Maynard Purdue

"When you're taking detailed notes and trying to help everyone else out in the class, it really helps you learn and understand the I made $280 on my first study guide!"

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."


"Their 'Elite Notetakers' are making over $1,200/month in sales by creating high quality content that helps their classmates in a time of need."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.