New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here


by: Mrs. Emilie Bradtke

Bioinformatics CAP 5510

Mrs. Emilie Bradtke
GPA 3.82

Giri Narasimhan

Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

Giri Narasimhan
Class Notes
25 ?




Popular in Course

Popular in System Engineering

This 63 page Class Notes was uploaded by Mrs. Emilie Bradtke on Monday October 12, 2015. The Class Notes belongs to CAP 5510 at Florida International University taught by Giri Narasimhan in Fall. Since its upload, it has received 18 views. For similar materials see /class/221704/cap-5510-florida-international-university in System Engineering at Florida International University.

Popular in System Engineering


Reviews for Bioinformatics


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 10/12/15
CAP 5510 Introduction to Bioinformatics Giri Namsimhan ECS 254 Phone x3748 gir39icisfiuedu wwwcisfiuedugir39iTeachBioinf508h rm 32508 CAP5510 MicroarrayDNA chip technology CI HighThroughpu r me rhod ro s rudy gene expression of Thousands of genes simultaneously CI Many applica rions I Gene ric disorders amp Mu ra rionpolymorphism de rec rion I S rudy of disease Sub rypes I Drug discovery amp Toxicology s rudies I Pa rhogen analysis I Differing expressions over Time be rween ri53ues be rween drugs across disease s ra res 32508 CAP5510 Polymerase Chain Reaction PCR CI For res ring large amoun r of DNA is needed I Idenfifying individuals for forensic purposes gt 01 microlifer of saliva confains enough epifhelial cells I Idenfifying pafhogens viruses andor bacferia El PCR is a Technique ro amplify The number of copies of a specific region of DNA CI Useful when exac r DNA sequence is unknown CI Need To know flanking sequences CI Primers designed from flanking sequences 32508 CAP5510 PCR Region to be amplified Flanking Regions with known sequence Reverse Primer Forward Primer Millions of Copies 32508 CAP5510 PCR Pnlymamsn Ehain Raactinn PER Heal 1 r39r39 11 IquotPi quotquot1 ur a ll I I 32508 Schematic outline of a typical PCR cycle 32508 PC39R Polymerase Chain Reaction 3 O iTarget DNA Wml rmmurmmmmy V J39Wltv z u K Primers Sup 1 mm mm 9 339 1 IL l l L lnli wl l mg l l k kgt dNTPs DNA polymerase CAP5510 P LVMEHHSE EHHIN REHETIDN M4 rewfm m DNA 5 aenamved Pumas mm In each suand A new DNA suand m 5synthesxzedbehmdpwwevsan each temwate suand waev mm mm mm m 5 mm WWW My mm m KZSEIB avqe numbevs a1 menua waqmems Each quotsemen mmams me DNA veqmn a1 mzevesz m m rawwin mm drieth Gel Electrophoresis EIUsed To measure The leng rhs of DNA fragmen rs EIWhen vol rage is applied To DNA differen r size fragments migr39a re To differen r dis rances smaller39 ones Tr39avel farTher 32508 CAP5510 8 Gel Pictures 32508 CAP5510 Gel Electrophoresis Measure sizes of fragments EIThe phosphate backbone makes DNA a highly negatively charged molecule El DNA can be separated according to its size EIGel allow hot 1 solution of purifed agarose to cool and solidifypolymerize El DNA sample added to wells at the top of a gel and voltage is applied Larger fragments migrate through the pores slower EIVarying concentration of agarose makes different pore sizes amp results CIProteins can be separated in much the same way only acrylamide is used as the crosslinking agent 32508 CAP5510 10 Gel Electrophoresis CAFSSIEI 11 Gel Electrophoresis zzsua CAFSSIEI 12 325 WWW my mam ssrgiaigrei mm oxen ia dM Vu n ma aWits m Sequencing 32508 CAP5510 Why sequencing EIUseful for further study I Loca re gene sequences regulatory elements I Compare sequences To find similarities I Identify mutations I Use if as a basis for further experiments Next 4 slides contains material prepared by Dr Stan Metzenberg Also see httpstat wwwberkeleyeduusersterryCassessZ601998Week8bweek8bnode9html 32508 CAP5510 15 History EITwo me rhods independenle developed in 1974 I Maxam amp Gilber r me rhod I Sanger me rhod became The standard EINobel Prize in 1980 32508 CAP5510 Original Sanger Method El Labeled Primer is annealed To TemplaTe sTrand of denaTured DNA This primer is specifically consTrucTed so ThaT iTs 339 end is locaTed nexT To The DNA sequence of inTeresT Once The primer is aTTached To The DNA The soluTion is divided inTo four Tubes labeled quot6quot quotAquot quotTquot and quotCquot Then reagenTs are added To These samples as follows I 6 Tube ddGTP DNA polymerase and all 4 dNTPs I A Tube ddATP DNA polymerase and all 4 dNTPs I T Tube ddTTP DNA polymerase and all 4 dNTPs I C Tube ddCTP DNA polymerase and all 4 dNTPs El DNA is synThesized amp nucleoTides are added To growing chain by The DNA polymerase Occasionally a ddNTP is incorporaTed in place of a dNTP and The chain is TerminaTed Then run a gel El All sequences in a Tube have same prefix and same lasT nucleoTide 32508 CAP5510 17 Modified Sanger El Reactions performed in a single Tube con raining all four39 ddNTP39s each labeled wi rh a differen r color39 dye dye label chainte Iminatiun 51111 ddGTF 5 39 231113131quot339fTITL TL TMGTC39STM39STCC39I39CCG 3 39 GGPGPCTTECAGGMG G TTC GG TIC GGhGGCCT CC I GMG 39IC hGS W 5 39 139BRETE39I YC TI39I Z TTTRBG39DTC TMGTCCICCGGA 3 39 GGBGACTI39PLCBGGABBGHGRTI39CPLGGHTICEGGBGGCCTBCCETGB G mB G S 39 chamtemdnatinn W11 ddl IP 5 393M39D3TI I39 JUST TMG I IC TELAGICCT 3 39 GG GhCHBCBGGMEGEGBthG mBGG GGCCT CCh39IGB GhTCE G S 39 chainte Irm39nation with ddCTP 5 39 GMTquot339I 1L TJTI39IYITITTMVIS39DITCTMG39IUI 3 39 GG G CTThC GGM G G TIC GG m GG GGCCT CC IGMG TCMG E 39 32508 CAP5510 Both Sanger Methods El Example of sequences seen in gel 32508 539 GAATGTCCTTTCTCTAAGTCCTAAG 339 GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGETCAAG E39 539GAATGTCCTTTCTCTAAGTCCTAAGTCCTCCG 339 GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTRCCATGAAGATCAAF S39 539 GAATGTCCTTTCTCTAAGTCCTEAGTCCTCCGG 339GGLGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG E39 539 GAATGTCCTTTCTCTAAGTCCTAAGTCCTCCGGATG 339 GGRGACTTACEGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG S39 539GAETGTCCTTTCTCTLAGTCCTALGTCCTCCGGRTGG 339 GGAGACTTACAGGAAAGAGATTCAGGATTCAGGEGGCCTACCATGAAGATCAAG S39 539 GAATGTCCTTTCTCTAAGTCCTAAGTCCTCCGGATGGTACTTCTAG 339 GGAGACTTACAGGAAAGAGATTCAGGATTCAGGRGGCCTACCATGAAGATCAAG E39 CAP5510 Sequencing Gels Separate vs Single Lanes GCCAGGTGAGCCTTTGCA 32508 CAP5510 20 Sequencing 355 CHAPTER THIRTEEN Sequence Assembly and nishing Methods m N VALTCA m unrcm AA AA I m Hr HHycxeAmnmymvram woman 0 quotMN m vcrwcv mumGr M A MA A R I AHMLCYAH I H m 73 m m Tc JrAam39LCTsrnru ovcam ammcmmmm mamch m quotammmmcmmM A A r M n A vv V V WW 27a gnu m 31c m M MM w qmcm mmm mums ccmeeraarrmucosr mecmmmnm Humour quot m w w M MWWW A M AW WW W WWWWW WWWWW 1 a 7 cm TEARGGAAA xAccc quotcyrmmm mcacaf imc wonquot c quot quotGOG l A A M w M AA A A H H x n A I v1 va1 H 1 x xx 1 H H YlU t m 490 am m mm mm francJahavrycncnz39 y39r39yyTAACl Mcr mm mmrcmm A IN UH I x mm w JUL AacH unm mrm accr A AA WVW X WVWx MWWV MUM mvm mm 1 I f MWAAWMMWAJ WW x m mefm m WWW FIGURE 33 A 39 viewed with Ewing 2002 Signal intensities corresponding to lragments ending with A green c blue G black and T red are shown out to approximately 711 bases H MTMGrGA 32508 CAP5510 Shotgun Sequencing H crarcmca smtgun sequencing Genome DNA BAG iblary aruzed mapped lavge done canngs BAG 1 be sequanued Shclgnn c ones sequauce Assewlb y AUL Gl AAA From httpWWWtulaneeduNbiochemlecture723humgenhtm1 32508 CAP5510 22 32508 Sequencing HGURI 3X Shotgun cloning Genomic DNA sequeneing begins with isolated genomic DNA in green at the of the gure in the hierarchical clcncehascd shesgnn apprnzrh nn rhe Ink A is sh d and the vcctur shown in blue in u are sheared independpnrly generating fragments at approximately 4 Kb which are then ligated to a small 5Eae vectur typically a plasmid red bar suimble for sequencing reactions The w olc genome shutgun apnrmrh bypasses the intermediate largeinsert clone and generates large numbers of small fragments Lypically 4 Kb and la Kb CAPSS 10 Sequencing Generate Contigs CI Shor r for39 con riguous sequencequot A con rinuously cover39ed region in The assembly J Collapsing into a single sequence El Jong W eT ol 1999 Making effecTive use of human genomic sequence doTo Trends Genet 157 2846 KenT WJ and Houssler39 D 2001 Assembly of The working dr39a of The human genome wiTh GigAssembler39 Genome Res 119 15418 32508 CAP5510 24 SupercontigsScaffolds El A super39conTig is formed when an associaTion can be made beTween Two conTigs ThaT have no sequence overlap I This commonly occurs using infor39maTion obTained fr39om pair39ed plasmid ends For39 example if boTh ends of a BAC clone ar39e sequenced Then iT can be inferred ThaT These Two sequences are appr39oximaTely 150200 Kb apar39T based on The average size of a BAC If The sequence from one end is found in a par39Ticular39 sequence conTig and The sequence from The oTher39 end is found in a differ39enT sequence conTig The Two sequence conTigs are said To be linked In general iT is useful To have end sequences from more Than one clone To provide evidence for39 linkage NCBI Genome Glossary 32508 CAP5510 25 Shotgun Sequencing Mlpped From 32508 STS t tt 1 it anm1 CAPSSIO Guam Human Genome Project Play the Sequencing Video Download Windows le from httpWWWcs uedugiriteach6936PapersSequenceexe Then run it on your PC 32508 CAP5510 27 Assembly Simple Example El ACCGT CGTGC TTAC TACCGT El ToTal lengTh 10 CI ACCGT CGTGC TTAC TACCGT TTACCGTGC 32508 CAP5510 28 Assembly Complications D DUDE Errors in input sequence fragments 3 o I Indels or substitutions Contamination by host DNA Chimeric fragments Joining of noncontiguous fragments Unknown orientation Repeats long repeats I Fragment contained in a repeat I Repeat copies not exact copies I Inherently ambiguous assemblies possible I Inverted repeats Inadequate Coverage 32508 CAP5510 29 Assembly Complications w AG I ATTGGCAATC z AATCGA I G u ATGCAAACC I x CCT I TTGG y TTGGCAATCACT AGTATTGGCAATC AATCGATG ATGCAAACCT 39I I GGCAATCACT TTTGG AGTATTGGCAATCACTAATCGATGCAAACCTTTTGG FIGURE 420 A bad solution for an assembly problem with a multiple ali nment whose consensus is a shartesl common superstring This salutian has length 36 and is generated by the Greedy algorithm Hawever its weakest link is zem CC I TT I GG TGGCAATCACT TGCAAACCT AGTATTGGCAATCGATGCAAACCTTTTGGCAA TCACI AGTATTGGCAATC FEM Solution according to the unique Hamiltonian path This solulion has length 37 but exhibits better linkage II 32508 weakest link is 3 30 Assembly Complications FIGURE 48 Target sequence leading 10 ambiguous assembly because of repeats oftheform XXX l I F I 1 Il L J Il A X B Y C X D Y l I I E l A X D Y C X FIGURE 49 Target sequence leading to ambiguous assembly because of repeats of the form X YX Y C FIGURE 49 Target sequence leading to ambiguous assembly because of repeats of the form X YX Y FIGURE 410 Target sequence with inverted repeat The region marked Y is the reverse complement of the region marked X Other sequencing methods EISanger39 Me rhod 7OKbpr39un EISequencing by Hybridiza rion SBH CIDuaI end sequencing CIChr39omosome Walking see page 56 of Pevzner39s Tex r D454 Sequencing 60Mbpr39un CISolexa Sequencing 600Mbpr39un Illumina 32508 CAP5510 32 454 Sequencing New Sequencing Technology CI Cl CI CI 454 Life Sciences Roche Fas r 20 million bases per 45 hour run Low cos r lower Than Sanger sequencing Simple en rire bac rerial genome in days wi rh one person wi rhou r cloning and colony picking Convenien r comple re solu rin from sample prep To assembly PicoTi rerPla re Device I Fiber opTic plaTe To TransmiT The signal from The sequencing reacTion Process I Library preparaTion GeneraTe library for hundreds of sequencing runs I Amplify PCR single DNA fragmem immobilized on bead I Sequencing SequenTial nucleoTide incorporaTion converTed To chemilluminscem signal To be deTecTed by CCD camera 32508 CAP5510 33 a Fragment b add adaptors c 1 fragment 1 bead d emPCR on bead e put beads in PicoTiterPlate and start sequencing 1 beadI 1 read I and gt analyze If 739 34 CAP5510 32508 32508 CAP5510 35 32508 CAP5510 36 J 51 1111 1117 rum v I 7 V 3 139ximwm2 I I n l l I I I I 541531 fya sr 9 AMIa1 puny J PP l RPS 393 r xlff 139 AW Lucifcrin b i nfxi J kl1lquot jlurI1 Ugh I myhlml39nml 32508 CAP5510 37 FEM E El 41 E Solexa Sequencing 15 MEI Li s a39i F H Mg F i 1 pr 3 r I In I39 LUZ Hill3E n 33M SILT CH I neviInk Dm wr 151 39 9 FAVEquot 11 32508 1H mun 391nrm1 frm1mr rr r1rn mi39rr n i 41 7 rm IH rhanwr r CAP5510 rind uniz d lIuLIII39Eiua mu rum 139 iuil um uuliuruham39 hl39Jqu nllpfi lu iun 38 Solexa Sequencing 4 FRAEMENTE EECEVME DGUELE STRANDED er quotquota N x i J N I K T I39R39Ha 1IF39a I y Iw v REEEnid II mchnnj r llquot lurrmrm TF1 PlTm ircmum39aln mialn l39id a Eu Eluild u39 uhlna lun vd bvi 39gu ull Elm iuIiII ulnhu aubi39lrilu 32508 5 DEN39AWJRE THE DDLIELESTHAMDED MDLECULE S COMPLETE AMPLI FIEATIEIN fff gxax If I Iquot i I l i i u I I If iii ll 1 lt39 i Aiuchnnl I 39 I quot ll I n nrlnd fa I I ENquot 339 It F i I 1 f39 1 n y l1quot Ihllallzl I 1 l HEW 1111 al 1 1V 1 E I 139 I i I I 1 l 7 f l I I 39 39 Elam Bun um iun In ll ngkalrimd39 d S ulll milliun durum tlun m a uhlu untill anchuwd Iquot tho duhI39m snarlJuli DNA in gvrarulvd IF and Eher 1l Elm Fluw uL CAP5510 39 Solexa Sequencing 5 I1 TI WWI ll II A39II ILI i l IV 1 vs r 71539 39J Infiml Lyulu Eu rilin n Elm Fn l gunman fih 35 III qu IDEFI39D J 39InmailJII lairin rm winuru AIILI DNA uumkum mar3 I PJ quotnn ml 32508 1 I39M39Irhkibl IIKr39nI 3A5 Altair inquot Aiiulir uplum L u mnqv Li urril39Iud Lamasnug 39mm and Lntcr w I quotml Lnl Hui4M Lu Limit ul Eu Hulbnm luv 1101 Hullm CAP5510 1139 IZ I39M39a39ll l hi A I VAJIII39V39 l Sui d Ll uminilp pLIIr ll Ilquot iil39l llquot numl muunu39m Fil add all TU IuL39quu Inurlihln mummun uml Innmn Eu Elm lluw mall 40 Solexa Sequencing VD INNEE S LE II hum I LLEIAIIJHII I uw image and Ju Ixhnu naler le dll f ul39 1 u 39blL IIL baa 39ul39uuI1Lr39ul 32508 13 IGH CHAT1 11m rmw 39aivmhl w v2 Ih ni p m39r39 Examl moire u wruumujng lu duluvblr e 39Jm ILL I 39E u Lman in n aiyr hnqmuul aI lvr unnuumn rinv39ia39arrnr I ninulc Lug a39 i39quotk CAP5510 41 Assembly Software DD DUDE Parallel EST alignmenT engine hTTpcorbaebiacukESTquot wiTh a CORBA inTerface To alignmenT daTabase Can perform ad hoc assemblies Can acT as foundaTion for CORBAbased EST assembly and ediTing package Parsons EBI SofTware using mulTiple alTernaTive sequence assembly quotenginesquot wriTing To a common formaT file STaden Cambridge hTTpwwwmrc lmbcamacukpubseqindexhTml Phrap hTTpbozemangenomewashingToneduphrapdocsphraphTml Assembler TIGR for EST and Microbial wholegenome assembly hTTpwwwTigrorgsoleab FAKZ and FAKTory hTTpwwwcsarizonaedupeoplegene Myers GCG hTTpwwwgcgcom Falcon Gryan Harvard fasT rascalmedharvardedugryanfalcon SPACE SPASS Lawrence Berkeley Labs hTTpwww hgclblgovinfspacehTml CAP 2 Huang hTTpwwwTigemiTASSEMBLYcapdochTml 32508 CAP5510 42 2DGels H mm mmammn my mm m sewnd mmansmn my 51 zzsua Pmmm WW Appw m gex m mp omcw pHOD 4f pmm CAFSSIEI w a n lsociccu x hanva um Wm st e ecubphm 25 s 2D Gel Electrophoresis 32508 CAP5510 2DGels First Dimension Methodology of a 2D Gel Denatured cell extract layered on a glass tube lled with polyacrylamide saturated with solution of ampholytes a mixture of polyanionic charged and polycationic charged molecules When placed in an electric eld the ampholytes separate and form continuous gradient based on net charge Highly polyanionic ampholytes will collect at one end of tube highly polycationic ampholytes will collect at other end Gradient of ampholytes establishes pH gradient Charged proteins migrate through gradient until they reach their pI or isoelectric point the pH at which the net charge of the protein is zero This resolves proteins that differ by only one charge Entering the Second Dimension Proteins that were separated on IEF gel are next separated in the second dimension based on their molecular weights The IEF gel is extruded from tube and placed lengthwise in alignment with second polyacrylamide gel slab saturated with SDS When an electric eld is imposed the proteins migrate from IEF gel into SDS slab gel and then separate according to mass Sequential resolution of proteins by their charge and mass can give excellent separation of cellular proteins As many as 1000 proteins can be resolved simultaneously Some information was taken from Lodish et al Molecular Cell Biology 32508 CAPSSlO 45 2Dgels quoti wings a g pH gt C Size 39 I 39 fwdJ I I a Proteome 21 i Proteome a l a w Diseased or 1 low q abundance gt high 395 ZDGel iii iii 739 treated sample Electrophoresis 39 l 19 Differential protein GELquot abundance levels Comparing Proteomes For Comparing Different Sample Differences in Protein Expression Types For Changes in Protein 32508 CAP5510 Levels Mass Spectrometry Przolcled MS I Ms 32508 CAPSSIU 47 Mass Spectrometry El Mass measurements By TimeofFlight Pulses of light from laser ionizes protein that is absorbed on metal target Electric field accelerates molecules in sample towards detector The time to the detector is inversely proportional to the mass of the molecule Simple conversion to mass gives the molecular weights of proteins and peptides El Using Peptide Masses to Identify Proteins One powerful use of mass spectrometers is to identify a protein from its peptide mass fingerprint A peptide mass fingerprint is a compilation of the molecular weights of peptides generated by a specific protease The molecular weights of the parent protein prior to protease treatment and the subsequent proteolytic fragments are used to search genome databases for any similarly sized protein with identical or similar peptide mass maps The increasing availability of genome sequences combined with this approach has almost eliminated the need to chemically sequence a protein to determine its amino acid sequence 32508 CAP5510 48 Genomics CI S rudy of all genes in a genome or comparison of whole genomes I Whole genome sequencing I Whole genome anno ra rion amp Func rional genomics I Whole genome comparison gt PipMaker uses BLASTZ To compare very long sequences gt 2Mb hTTpwwwcsepsuedupipmaker gt Mummer used for comparing long microbial sequences uses Suffix Trees 32508 CAP5510 49 Genomics El S rudy of all genes in a genome I Gene Expression gt Microar39r39ay experimenTs amp analysis Pr obe design CODEHOP Ar r ay image analysis Cr azyQuanT IdenTifying genes wiTh significanT changes SAM ClusTer39ing 32508 CAP5510 50 Comparative Genomics CI Comparison of whole genomes I Whole genome sequencing I Whole genome anno ra rion amp Func rional genomics I Whole genome comparison gt PipMaker MulTiPipVlaker EnTeriX PipMaker uses BLASTZ To compare very long sequences gt 2Mb hTTpwwwcsepsuedupipmaker gt Mummer used for comparing long microbial sequences uses Suffix Trees gt Many more 32508 CAP5510 51 Databases for Comparative Genomics CI PEDANT useful resource for39 standard ques rions in comparative genomics For39 eg how many known profeins in XXX have known 3d sfr39ucfur39es how many profeins from family YYY are in ZZZ efc CI COGS Clusters of or rhologous groups of proteins CI MBGD Microbial genome da rabase searches for39 homologs in all microbial genomes 32508 CAP5510 52 Proteomics DSTudy of all pro reins in a genome or comparison of whole genomes I Whole genome onno ro rion amp Func rionol pro reomics I Whole genome comparison I Pro rein Expression 2D Gel Electrophoresis 32508 CAP5510 53 32508 50v plemen Ca 9pm Other Proteomics Tools From ExPASySWISSPROT CI AACompIden r idenTify proTeins from aa composiTion Input aa composiTion isoelecTric poinT mol wt eTc Ou rpuT proTeins from DB CI CI CI AACompSim compares proTeins aa composiTion wiTh oTher proTeins Mul139Iden139 uses mol wt mass fingerprinTs eTc To idenTify proTeins PepTIdenl39 compares experimenTally defermined mass fingerprinTs wiTh TheoreTically defermined ones for all proTeins FindMod predicTs posTTranslaTional modificaTions based on mass difference beTween experimenTal and Theorefical mass fingerprinTs PeptideMass Theorefical mass fingerprinT for a given proTein GlycoMod predicTs oligosaccharide modificaTions from mass difference TGREASE calculafes hydrophobicify of proTein along ifs lengTh 32508 CAP5510 55 Gene Networks amp Pathways El Genes amp Pr39o reins ad in concer r and Therefore form a complex network of dependencies 32508 CAP5510 56 Pathway Example from KEGG Staphylococcus aureus r4444 mm mm zzsua CAFSSIEI 57 Pseudomonas aeruginosa METHIONINE METABOLISM Q Q magmamm mmmm mm mm my um 11125211 m m memhalum errRmasylr LrhmnaCymuw 57mm LrhmnaCymuw 47mm mm Zraxahnmmm STSs and ESTS El Sequence Tagged Si re shor39T unique sequence El Expressed Sequence Tag shor39T unique sequence from a coding region I 1991 609 ESTs Adams ef al I June 2000 46 million in dbEST I Genome sequencing cenTer39 cn ST Louis pr39oduce 20000 ESTs per39 week 32508 CAP5510 59 What Are ESTs and How Are They Made CI Small pieces of DNA sequence usually 200 500 nucleotides of low quality CI Extract mRNA from cells tissues or organs and sequence either end Reverse transcribe to get cDNA 5 EST and 3 EST and deposit in EST library CI Used as quottagsquot or markers for that gene CI Can be used to identify similar genes from other organisms Complications variations among organisms variations in genome size presence or absence of introns CI 5 ESTs tend to be more useful crossspecies conservation 3 EST often in UTR 32508 CAP5510 60 DNA Markers EIUniquely iden rifiable DNA segmen rs CIShor r lt5OO nucleo rides EILayou r of These markers give a map of genome EIMarkers may be polymorphic varia rions among individuals Polymorphism gives rise To alleles El Found by PCR assays 32508 CAP5510 61 Polymorphisms El Leng rh polymorphisms I Variable of Tandem r39epea rs VNTR I Microsa relli res or39 shor r Tandem r39epea rs I Res rr39ic rion fragmen r leng rh polymorphism RFLP caused by changes in r39es rr39ic rion si res El Single nucleo ride polymorphism SNP I Aver39age once every 100 bases in humans I U5uay biallelic I dbSNP da rabase of SNPs over39 100000 SNPs I ESTs are a good source of SNPs 32508 CAP5510 62 SNPS CI SNPs offen ac r as disease markersquot and provide gene ric pr39edisposi rionquot CI SNPs may explain differences in drug response of individuals CI Associa rion s rudy s rudy SNP pa r rer39ns in diseased individuals and compare agains r SNP pa r rer ns in normal individuals CI Many diseases associa red wi rh SNP profile 32508 CAP5510 63


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Jim McGreen Ohio University

"Knowing I can count on the Elite Notetaker in my class allows me to focus on what the professor is saying instead of just scribbling notes the whole time and falling behind."

Allison Fischer University of Alabama

"I signed up to be an Elite Notetaker with 2 of my sorority sisters this semester. We just posted our notes weekly and were each making over $600 per month. I LOVE StudySoup!"

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."

Parker Thompson 500 Startups

"It's a great way for students to improve their educational experience and it seemed like a product that everybody wants, so all the people participating are winning."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.