New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

General Microbiology

by: Alaina Hoeger

General Microbiology MCB 3020

Alaina Hoeger
GPA 3.88


Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

Class Notes
25 ?




Popular in Course

Popular in Microbiology

This 5 page Class Notes was uploaded by Alaina Hoeger on Monday October 12, 2015. The Class Notes belongs to MCB 3020 at Florida International University taught by Staff in Fall. Since its upload, it has received 12 views. For similar materials see /class/221796/mcb-3020-florida-international-university in Microbiology at Florida International University.


Reviews for General Microbiology


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 10/12/15
MCB 3020L Experiment 13 Molecular Taxonomy of Your Isolate In this experiment you will have the opportunity to amplify your bacterium s 16S rRNA gene and determine its sequence Once you know its sequence it then can be compared to other known sequences in GenBank In preparation for this it would be a good idea to review the relevant sections in your text Chapter 11 Microbial Evolution and Systematics sections 116 117 118 1111 and Chapter 7 Essentials of Molecular Biology section 79 Polymerase Chain Reaction Extraction of DNA from isolates We will be using the Bactozol kit to extract the DNA from bacterial isolates gram negative and gram positive bacteria This kit based method consists of the lysing of cells using Bactozyme which contains activated lysozyme and precipitation of DNA from cell lysate using DNAzol that hydrolyzes RNA and allows selective precipitation of DNA and ethanol Using this procedure you should be able to get 10 to 100 ng of DNA A pure preparation of DNA or RNA should have a ratio ofAbs260280 of 1 8 of 20 Contamination with protein will lower this ratio UVspectrophotometer or uorometer can be used to measure the DNA concentration We will be using 10 to 20 ngul of DNA for PCR ampli cation of16S rRNA gene Polymerase Chain Reaction PCR DNA template primers DNA polymerase dNTP s dATP dTTP dGTP dCTP Mg BSA and buffer solution are required DNA template contains the DNA region target to be ampli ed Primers are chemically synthesized single stranded oligonucleotides usually 15 to 30 bases in length which are complementary to the DNA regions at the 5 and 3 ends of the DNA region DNA polymerase is used to amplify ie replicate a piece of DNA by in vitro enzymatic replication The dNTPs the building blocks from which the DNA polymerase synthesizes a new DNA strand DNA polymerase only works when it can attach to the rst nucleotide of an existing 3 OH of a double stranded DNA Note that RNA polymerase does not require primers So to begin a gene ampli cation one needs to design primers so that they will anneal to the gene at a particular spot The buffer solution is used to provide a suitable chemical environment for optimum activity and stability ofthe DNA polymerase PCR reactions rely upon the heat stability of DNA polymerases from extreme thermophilic bacteria The classic DNA polymerase came from Thermus aquaticus a bacterium isolated from a hot spring T aquaticus DNA polymerase is called Taq polymerase and is relatively stable to boiling This is an important point for it allows reaction mixtures to be heated to 95 0C to convert double stranded ds DNA to single stranded ss DNA without destroying Taq polymerase DNA polymerase from most organisms or any enzyme for that matter would be totally destroyed by such heat but not Taq polymerase PCR is done by mixing chromosomal or plasmid DNA with a master mix containing all dNTP s Mg BSA primers and initiated by adding Taq polymerase The tubes are put into a thermalcycler which heats and cools the tubes following a thermal program for each cycle For example a PCR cycle consists of heat tube to 95 C for 1 min makes all DNA single stranded cool to 52 C for 1 min allows primers to anneal to template DNA chromosomal or plasmid DNA 3 heat to 72 C for 1 min the optimal temperature for Taq polymerase allowing DNA synthesis from the primers this is called extension NA This finishes the rst cycleand the cycle is repeated For each cycle there is a doubling of DNA corresponding to the region subtended by the primers In a typical run such as we will do 30 cycles are performed resulting in an exponential amplification lfthe tube had only one copy of the gene being ampli ed after 30 cycles there would be 5 X 108 copies This is ampli cation 500 million fold We will be using the universal bacterial 16S rRNA gene primers that will allow us to amplify a large region ofthe gene 16S rRNA has about 1500 bases At the 5 end of the gene we could use AGAGTTTGATCCTGGCTCAG for the forward primer position 827 in the Ecoi 16S rRNA and at the 3 end we could use the reverse primer ACGGCTACCTTGTTACGACTT position 1512 to 1492 in the Ecoli16S rRNA After ampli cation the PCR products amplicons will be examined with agarose gel electrophoresis In this electrophoresis the bands are separated based on size and they will be visualized by staining the gel with ethidium bromide which is a DNA intercalator Ethidium bromide is relatively non uorescent by itself but increases its uorescence when intercalated into dsDNA The gels will be viewed with ultraviolet light to stimulate ethidium bromide uorescence After preparation of the PCR product we will use Big Dye termination kit to cycle sequence your product This is another PCR reaction that will produce an array of single stranded ssDNA strands terminated at different lengths depending on whether a ddNTP was incorporated at a particular spot dd dideoxy nucleotide one that when incorporated terminates further polymerization due to lack of a 3 OH essential to adding the next nucleotide The ddNTP s each have a different color uorescent dye The products are analyzed by an electrophoresis column read by a fluorometer Analysis of the Sequence We will use GenBank or Riobosomal Database Project to analyze the sequences You will upload your sequence and use the database to search for closest matches and then put the results into a phylogenetic tree Materials General Safety Requirements 1 Wear gloves at all times 2 V pe work bench with 5 hypochlorite or 80 ethanol 3 V pe work bench with distilled water 4 Place clean cover on bench and tape in place FIRST Lab Session DNA extraction and PCR amplification of 16S rRNA gene Part DNA extraction A Reagents Bactozol kit 10X Bactozyme Bactozyme dilution buffer DNAzol Prepare 1X Bactozyme freshly using Bactozyme dilution buffer and use it within 24 hours Required volume 100 pl of 1X Bactozyme per sample B Supplies Autoclaved sterile 15 ml Eppendorf Tubes and Pipette tips C Equipment Thermomixer Centrifuge Pipettes Vortex D Extras Ethanol 96 Kim Wipes Paper towels Gloves Procedure 1 Culture 11 Grow bacterial culture in 15 ml MB medium or a suitable medium for your isolate at 30 37 C using Thermomixer at 500 rpm 12 Spin down the culture at 11000 rpm at 4 C for 10 minutes Discard the supernatant 2 Lysing 21 Add 100p of 1X Bactozyme buffer to the bacterial pellet and resuspend it by vortexing in order to get a homogenous solution 22 Lyse the bacterial suspension by incubating at 50 C for 30 minutes for gramnegative and 60 min for grampositive bacteria 3 Lysate solubilization 31 Mix the resulting bacterial lysate 100 pl with 400 pl of DNAzol by hand for 1530 seconds to obtain homogenous solution Incubate the lysate for 15 minutes at 50 C in a Thermomixer at 500 rpm to improve the DNA quality and recovery 32 lfthe DNAzol lysate is turbid it may contain insoluble cell wall debris that makes it more difficult to resolubilize the isolated DNA Centrifuge the DNAzollysate at 9700 rpm for 7 minutes at 4 C and collect the Supernatant 4 DNA precipitation 41 Precipitate the DNA from the DNAzollysate solution 500 pl by adding equal volume 500 pl of 96 Ethanol Mix the lysate by inversion for 15 seconds and store at room temperature for 25 minutes Samples containing gt10 pg of bacterial DNA often form a white threadlike precipitate Pellet the DNA by centrifugation at 5300 rpm for 4 min at 4 C 5 DNA Wash 51 Following the centrifugation carefully decant the supernatant and remove the residual fluid with a pipette Wash the DNA pellet with 1 ml of 75 ethanol by vortexing and Centrifuge at 5300 rpm for 4 min at 4 C 52 Decant the ethanol and store the tube inverted for 12 minutes and remove any residual ethanol with pipette A second wash step with 75 ethanol may improve DNA quality in some preparations Dissolve the pellet while it is still wet Close the lid and incubate at room temperature for 1 min 60 DNA Wash and Quantification 61 Add 50 pl of DEPC water to the DNA pellet Rehydrate the DNA pellet for 10 minutes at room temperature and mix or pipette the sample until the gelatinous DNA is completely dissolved 62 Quantify the DNA concentration using a fluorometer or spectrophotometer Part II PCR amplification of of 16S rRNA Gene 1 Measure your DNA preparation using a UV spectrometer or uorometer or check your DNA preparation by running a gel 2 Set up the PCR reaction volume 40 pl 3 Place your tube in the thermal cycler The TA will program the cycler and run it overnight the cycler at the end of the last cycle will chill all tubes to 4 C Second Lab Session Gel Electrophoresis PCR purification Sequence reaction Prepare 1 agarose gel in TBE buffer Load an Agarose gel with your PCR reaction mixture Electrophorese until the blue dye reaches gt80 the length of the gel Being careful and wear latex gloves dip the gel into ethidium bromide solution Observe an image your gel with uorescent illumination Purify the PCR product using QIA quick PCR purification kit follow the protocol PCR puri cation using a spin column amp centrifuge Elute the PCR product in 30 ul DNA grade H20 GUIACDNA l 9 Place your tube in the thermal cycler The TA will program the cycler and run it overnight the cycler at the end of the last cycle will chill all tubes to 4 C 10 Next day Submit the sequence reaction at DNA Core Facility for sequencing Third Lab Session Sequencing Results GenBank 1 Take the sequence you have obtained from the DNA core facility to the lab computer 2 Computer should already be connected to GenBank or Ribosomal Database Project RDP 3 Edit the sequence and upload it in the GenBank or RDP database 4 Find the sequence type closely related to your bacteria Remember that 16S rRNA is highly conserved and within any known group there is genetic and therefore phenotypic diversity Preparation of TBE Buffer 5X Tris 54 g Boric acid 275 g 05 M EDTA pH 80 20 ml DI water autoclaved 1000 ml Dissolve and autoclave the buffer 1X TBE Buffer Dilute 5X buffer with DI water 200 ml 5X buffer with 800 ml autoclaved DI water 1 Agarose gel Add 2 g Agarose to 200 ml 1X TBE Buffer Microwave 2 min until dissolved Allow to cool Pour in to gel tray Allow to solidify remove combs and gently place the gel into 1X TBE bath


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."

Allison Fischer University of Alabama

"I signed up to be an Elite Notetaker with 2 of my sorority sisters this semester. We just posted our notes weekly and were each making over $600 per month. I LOVE StudySoup!"

Bentley McCaw University of Florida

"I was shooting for a perfect 4.0 GPA this semester. Having StudySoup as a study aid was critical to helping me achieve my goal...and I nailed it!"


"Their 'Elite Notetakers' are making over $1,200/month in sales by creating high quality content that helps their classmates in a time of need."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.