New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here


by: Cassie Koepp


Cassie Koepp
GPA 3.61

G. Brininstool

Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

G. Brininstool
Class Notes
25 ?




Popular in Course

Popular in Biological Sciences

This 53 page Class Notes was uploaded by Cassie Koepp on Tuesday October 13, 2015. The Class Notes belongs to BIOL 2051 at Louisiana State University taught by G. Brininstool in Fall. Since its upload, it has received 25 views. For similar materials see /class/222790/biol-2051-louisiana-state-university in Biological Sciences at Louisiana State University.

Popular in Biological Sciences




Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 10/13/15
Exam 1 Questions 9292009 55800 PM Exam 1 study Questions What is microbiology The study of organisms too small to be seen by the naked eye Where do you find microorganisms everywhere How many microorganisms are estimated to be on Earth 50 x 1030 How long have microorganisms been on Earth 38 billion years ago Are the majority of microorganisms beneficial or harmful Beneficial Do good or bad microorganisms get the most publicity Why Bad microorganisms get the most publicity because they have the most dramatic effect on our lives How do microorganisms impact our lives through the following 1 Disease Identify new diseases Help to find treatment cure and prevention Vaccinations Cause Diseases themselves as well pathogenic 2 Agriculture o Used in fertilizer to help crop production o Microorganisms in plant nodules transform atmospheric nitrogen to ammonia which can be used by plants Nitrogenfixation o Microorganisms located in the stomach tracts of cows help to break down cellulose rich plants to proteins rumen 3 Food o Used for preservation heat cold radiation chemicals Fermented food cheese and beer Food additives 4 Energy Biofuel fermenting corn to produce ethanol 5 Bioremediation Microbes used to fix human accidents such as oil spills and organic pollutants Microbes actually consume the oil or pollutants 6 Biotechnology Genetically altering microbes Genetically modified microbes to perform a specific function in the human body to be used as pharmaceuticals Ex microbes have been genetically altered to produce insulin for diabetics other human proteins Gene Therapy correcting genetic errors in humans to cure diseases such as cystic fibrosis What are microorganisms made of Mostly made of water Name 6 characteristics of living cells Metabolism and Compartmentaization 0 Cells take up nutrients from the environment and transform them and releases waste into the environment The cell is an open system Reproduction growth 0 New cells are produced from preexisting cells cell division Di erentiation 0 Some cells can form new cell structures such as a spore Communication 0 Cells communicate by means of chemicals that are released or taken up Movement Evolution 0 Cells contain genes and evolve to display new biological properties Who was the first to use a microscope to see microorganisms What did he see 1665 Robert Hooke was the first to see microorganisms He saw fruiting structures of mold What type of microscopy did he use Brightfield Microscope Who was the first to use a microscope to see bacteria How do we know he saw bacteria What type of microscopy did he use o Antoni Van Leeuwenhoek was first to see bacteria in 1676 c We know he saw bacteria due to his drawings from the microscope c He used a brightfield microscope What are the four types of light microscopy Brightfield o Simplest 0 Must use stain to provide contrast 0 Illuminated and magnified 1000x o Phase Constrast o Dark Field 0 See live samples 0 No stain needed 0 Contrast comes from cellular constrast o Fluorescent 0 Used to see autoflourescent molecules or fluorescent stains DAPI What must be done to a microorganism to be able to see it with brightfield light microscopy o Microorganism must be stained because cell is mainly composed of water o Can only see dead samples Which types of light microscopy allow you to view a live sample o Darkfield o Phase Contrast What is the maximum resolution of a compound light microscope Describe what that value means in practical terms when viewing a specimen o Resolution limit of a compound light microscope is 2 pm micrometers This means that if there are 2 specimens they must be 2 pm apart in order for them to appear as 2 separate objects o Resolution ability to distinguish two adjacent objects as distinct and separate o Resolution determines what can be seen on a microscope What are the two types of electron microscopy When would you use one type instead of the other o Electron microscopes limiting resolution is 24 nm 0 Transmission Electron Microscope TEM Used to see internal structure of cell 0 Scanning Electron Microscope SEM Used to see surface of cells and 3D imaging Can view live samples yet most tend to be dead What is the maximum resolution of an electron microscope o 4 nm What is the smallest microbial cell size discovered thus far Would this cell have a high or low surface areatovolume ratio compared to an average eukaryotic cell What is the significance of a cell having a high surface areatovolume ratio o The smallest microbial cell is 2 pm o It would have a higher surface area to volume ratio in comparison to a eukaryotic cell which is ideal for exchange of nutrients and disposal of waste o Wastenutrients will travel a shorter distance into and out of the cell c Shorter distance requires less energy Discuss the problems a cell might have it were less than 02 microns o Microbes smaller than 2 microns would not be able to sufficiently house biomolecules due to the small volume of the cell c Osmotic pressure could be an issue causing the cell to possibly burst Compare and contrast a prokaryotic microbial cell and eukaryotic microbial cell c Components of Microbial Cells 0 Cytoplasmic membrane 0 Cytoplasm o Ribosome o Prokaryotic Microbial Cell 0 No true nucleus 0 No membrane bound organelles 0 Usually contains Cytoplasm Cytoplasmic membrane Ribosomes Plasmid Nucleoid o Eukaryotic Microbial Cell True nucleus Membrane Bound Organelles Usually contains a Cytoplasmic membrane a Endoplasmic Reticulum Smooth and Rough produces ribosomes n Ribosomes n Nucleus n Nucleolus a Nuclear Membrane a Golgi Apparatus n Cytoplasm n Mitochondria n Chloroplast photosynthetic cells a Cell Wall What microorganisms have a phospholipid bilayer that forms their cytoplasmic membrane o Bacteria and Eukarya What microorganisms have a lipid monolayer that forms their cytoplasmic membrane o Archaea o Monolayer is more resistant than bilayer because lysozymes cannot break the 13 glycosidic bonds in monolayer o Monolayer contains NO FA39I39I39Y ACIDS contains isoprene units instead Contrast the phospholipid bilayer with the lipid monolayer What molecules make up each What are the different linkages characteristic of each o Phospholipid Bilayer O O O O O Two layers of glycerolphosphate head and fatty acid tails Selectively permeable Flexible r linkages between glycerol and fatty acids Hydrophilic and Hydrophobic regions o Lipid Monolayer O O One layer of glycerolphosphate and hydrophobic region No fatty acid chain instead have repeating units of 5carbon hydrocarbons v r linkages between hydrophobic region and glycerol What advantage would microorganisms with a lipid monolayer have over those with a lipid bilayer o More difficult to peel apart ideal for microorganisms that live in extreme environments o Peeling monolayer is difficult because lysozymes are incapable of breaking the 13 glycosidic bonds What are the functions of the cytoplasmic membrane o Permeability Barrier o Anchors Proteins 0 site of many proteins involved in transport bioenergetics and chemotaxis o Energy Conservation 0 Site of generation and use of proton motive force Where is the cell wall located relative to the cytoplasmic membrane o Cell wall is located around cytoplasmic membrane just to the exterior What Bacteria lack a cell wall o Chlamydia and Mycopasma What are most Bacteria cell walls made of o Peptidoglycan The amount of peptidoglycan in the cell walls of Bacteria distinguishes what types of Bacteria o Gram Positive Bacteria o 90 of cell wall composed of peptidoglycan o Gram Negative Bacteria o 10 of cell wall composed of peptidoglycan Describe the peptidoglycan structure o Composed of two sugars o Acetlyglucosamine G o Acetylmuramic Acid M 0 Sugars are covalently bonded by 14 glycosidic linkages lysozyme sensitive bond o Each sugar as extensions from Acetylmuramic Acid M 0 Extensions consist of 4 amino acids called tetrapeptide anages 0 Cross links in gram negative bacteria peptide bonds 0 Cross links in gram positive bacteria peptide interbridges The glycosidic bond between the two Nacetylglucose sugars in peptidoglycan can be cleaved by what enzyme What is the significance of using that enzyme to cleave that bond o 14 Glycosidic bond can be cleaved by lysozymes o If the covalent glycosidic bonds are broken then the cell wall would be broken down becoming susceptible to osmotic pressure and could possibly rupture the cell Describe what would happen if a bacterial cell were put in a solution with lysozyme added o Cells would most likely rupture and die due to osmotic pressure Describe the Grampositive cell wall o Composed of cytoplasmic membrane and thick layer of peptidoglycan What is function of teichoic acids and lipoteichoic acids found in gram positive cell wall o Responsible for the negative charge on the surface of the cell c Binds Ca and Mg for eventual transport into cell c Teiochoic Acids o Negatively charged polymers containing glycerophosphates and ribitol residues o Lipoteichoic Acids o Teichoic acids that covalently bond to membrane lipids Describe the Gramnegative cell wall o Innermost to Outermost o Cytoplasmic Membrane o Peptidoglycan 0 Outer membrane LPS What is the lipopolysaccharide layer o It is the outermost membrane of gram negative bacteria It is composed of toxic Lipid A core polysaccharide and specific polysaccharides What part of the LPS is toxic When is it toxic o Lipid A is toxic in LPS and it is toxic when it is removed from the outermost membrane Compare and contrast Archaea pseudomurein and Bacteria peptidog lyca n o Pseudomurein o Polysaccharide 0 Found in Archaea cell walls 0 Composed of sugars Acetylglucosamine Acetylalosaminuronic Acid Sugars are covalently bonded by 13 B glycosdic anages 0 B13 bonds cannot be broken down by lysozymes one of the reasons why archaea can live in extreme environments 0 Peptide chains connect acetylalosaminuronic acids 0 Cross links contain 3 amino acids o Peptidoglycan 0 Found in bacteria cell walls 0 Polysaccharide that is composed of 2 sugars that are held together by B14 glycosdic bonds 0 Sugars are Acetylglucosamine G Acetylmurmamic Acid M o Tetrapeptide crosslinks composed of 4 amino acids What types of cell walls are found in Archaea species o Pseudomurein o ProteinGlycoprotein o Polysaccharide What types of cell walls are found in Eukarya species o Cellulose 0 Ex Algae polymers of glucose Chitin 0 Ex Fungi polysaccharide o Glycoprotein o Widespread What are the functions of the cell wall How does the structure of a cell wall suit the functions o Functions of Cell Wall 0 Protection 0 Maintain cell shape 0 Prevents osmotic lysis o Interact with environment o Cell wall is capable of doing of these functions because cell walls are composed of strong substances and allows the import and export of nutrients chemicals and waste What are fimbriae What does a prokaryotic cell do with fimbriae o Frimbriae are short protein filaments that are on the surface of prokaryotes o They are used for attachment sticking to surfaces What is a pilus What does a prokaryotic cell do with a pilus o Pili are long protein filaments on the surface of prokaryotes that are involved in conjugationattachment o Few pili are present on the surface of the prokaryotic cell Where would an Slayer be found What purpose does it serve I H o SLayer would be found in prokaryotes mainly archae SLayer is 2 D array of proteins or glycoproteins o SLayer is strong enough to withstand osmotic pressure but it can also be present in addition to other cell wall components If it is with other cell wall components it is the outermost layer o SLayer serves as 0 Structural support 0 Selective sieve allowing the passage of lowmolecular weight substances and excludes large molecules and structures Can all Bacteria form a capsule o No capsules are only produced if cell has excess materials and resources What is a capsule made of How does a capsule s composition suit its function o A capsule is made of polysaccharides or peptidoglycan layers o Capsule material is organized in a tight matrix that excludes small particles o Capsules are composed of polysaccharides and these polysaccharides have several functions 0 Attachment of microorganisms to solid surface Microorganisms use capsule to bind to surface components on hosts Can bind to solid surfaces to form biofilm 0 Capsules encapsulate pathogenic bacteria which makes it more difficult for phagocytic cells in immune system Slime is made for what purpose o Slime is used for gliding movement It provides slow smooth movement of cells across surface What type of microorganisms make slime o Nonflagellated prokaryotes Movement using slime secretion is called what Gliding What are the 3 main parts of the prokaryotic flagellum What is the purpose of each o Filament o Composed of flagellin o Prokaryotic filament rotates providing movement o Hook 0 Connects the filament to the motor o Motor 0 Embedded in the cytoplasmic membrane 0 Motor consists of central rod that passes through series of rings L ring LPS P ring Peptidoglycan MS ring cytoplasmic membrane C ring cytoplasmic membrane Mot proteins found in cytoplasmic membrane protons move through mot proteins causing the motor to rotate Fili Proteins found in cytoplasmic membrane motor switch reversing direction of rotation of flagella in response to intracellular signals 0 Proton Motive Force is needed to drive the rotation by the motor 0 There must be a proton gradient where there are more protons out of the cell in the periplasm 14nm Cytoplasmic Mot protein Fli proteins Mot protein membrane motor switch 45 nm Compare and contrast a prokaryotic and eukaryotic flagellum Prokaryotic flagellum information above Eukaryotic flagellum o Flagella and Cilia Move back and forth using dynein motor proteins Made of microtubules 2 in the center and 9 surrounding it No rotation only whipping movement Cilia NOT found in prokaryotes Would you expect a Bacteria and Archaea flagellum to same or different 0 Different o Archaea have thinner flagella 0 Structure of Archaea motor is unknown 0 Several different flagellin proteins exist in Archaea as opposed to Bacteria s single flagellin protein present in the filament 0 Some archaea flagella are composed of glycoproteins o Archaea are slower swimmers Identify the two types of flagellation o Polarly Flagellated o Flagella attached to one or both ends of cells 0 Move more rapidly spinning around and seemingly dashing from place to place 0 Peritrichously flagellated o Flagella are inserted at many locations around cell surface 0 Typically move slow and in a straight line Describe the movement of a polar flagellated prokaryotic cell c Reversible flagella change direction by reversing rotation thus pulling rather than pushing Unidirectional flagella cell stops moving periodically to reorient and then move fonNard with clockwise direction Reversible flagella a lt NQNa pvvwa CCW rotation CW rotation Unidirectional flagella g Ivvgva b Cell 0 CW rotation Stops reorients CW rotation Describe the of a 39 39 39 quot quot 39 prokaryotic cell 0 Forward direction is imparted by counterclockwise rotation o Clockwise rotation causes cell to tumble flagella pushed apart 0 Returns to counterclockwise rotation lead cell to new direction Tumble OA flagella i h cl Bundled Kw apsgrte flagella cw rotation CCW rotation 4 Fla II b dl d ge a un e Mew CCW rotation What are taxes Give 3 examples of taxes 0 Directed movement towards or away a chemical or physical signal 0 Three examples of taxes 0 Chemotaxis move in response to chemicals 0 Phototaxis move in response to light 0 Aerotaxis move in response to oxygen Describe an 39 to 39 39 Describe an 39 to 39 39 Describe an 39 to 39 What does a cell use to sense the environment 0 A cell uses receptors that are located in the cytoplasmic membrane to sense the environment Using the receptors they compare the current environment with the environment they sensed moments ago If the environment is favorable it will move fonNard If it the current environment is toxic or unfavorable it will move away If it is indifferent there is no net movement There are several different receptors 0 Photoreceptors sense light gradient 0 Chemoreceptors sense chemical gradient o Aerorecptors sense oxygen gradient What are 2 other ways that a cell can move other than gliding and flagella o Magnetosomes 0 Contain particles of magnetite o Orient themselves in a particular direction usually down in the sediment 0 Ex magnetospirillum 0 Found in prokaryotes o Gas Vesicles o Prokaryotic cells could contain gas vesicles Gas vesicles are small gasfilled structures that are made of protein and convey buoyancy They are able to orient themselves to harvest optimum light or in response to other environmental stimuli Gas vesicles are common is aquatic animals such as cyanobacteria Seen in prokaryotes Describe how a cyanobacterium could move to obtain optimum wavelengths of light for photosynthesis o A cyanobacterium could use their photoreceptors located on their cytoplasmic membrane to determine light gradient By accessing the light gradient wavelengths using their photoreceptors cyanbacteria can move in response to whether the wavelength is optimum for photosynthesis It is like a hot and cold game where if the light wavelength is unfavorable it will move in a direction until it finds a wavelength that is favorable for photosynthesis Where do Gramnegative purple sulfur bacteria store sulfur o Sulfur is stored in sulfur granules located in the periplasm What does the carboxysome store for some bacteria and cyanobacteria o Stores enzymes to fix carbon dioxide to sugars Describe the process of sporulation Sporulation is the process of producing a endospore in gram positive bacteria It involves three steps activation germination and outgrowth Activation initiated due to harsh conditions where the cell ceases to grow and it will cause a spore to form in the vegetative cell The spore will contain macromolecules to sustain a cell and will contain calcium dipicolinic acid found in the core and acid soluble proteins which are not in the vegetative cell Calcium dipicolinic helps to dehydrate the endospore and it stabilizes the DNA during heat denaturation Dehydration is important because it increase the heat resistance of the macromolecules within the core of the spore Small acid soluble proteins SASP bind to DNA for protection against extreme conditions and it functions as a carbon and energy source for the outgrowth of a new vegetative cell from the endospore Germination is triggered when the endospore is in a favorable environment This is initiated when the endospore is placed in the presence of specific nutrients such as amino acids In the process of germination the spore is released and in the process of outgrowth vegetative cell emerges from the broken endospore The endospore transforms into a vegetative cell This vegetative cell is genetically identical to the vegetative cell that made the spore In the outgrowth process the cell swells due to intake of water and synthesis of new RNA proteins and DNA How does the structure of an endospore help it to be a survival structure The endospore has several layers and the DNA and important macromolecules are protected in the core which is the innermost layer of the endospore The outer layers act as protection for the DNA and macromolecules This protection is essential because DNA and essential macromolecules are needed to create the new vegetative cell Order of the layers in endospore outermost to innermost Exosporium Spore coat Core Wall Cortex DNA 0 O O O O 39 Spore oat LConex 15 mum r c aeaman and Philipp Gerhardt Where is an endospore formed Does this vary depending on the microorganism o Endospore is formed in the vegetative cell c The endospore can be 0 Terminal located at the end of the veg cell 0 Subterminal located near the end of the veg cell 0 Central located in the center of the veg cell Describe the process of germination o Germination occurs when the spore transforms into the veg cell The endospore is released from the vegetative cell during germination o It occurs when conditions are favorable Initially there is an outgrowth from the spore This outgrowth continues to grow until the veg cell is fully produced This veg cell is genetically identical to the veg cell that made the spore What age is the oldest known endospore to have germinated 0 25 40 million years ago 0 250 million years ago Where was the endospore found 0 Found in the gut of an extinct bee trapped in amber 25 40 million years ago 0 Brines within salt crystals 250 million years ago What are the organelles of a eukaryotic cell What is the purpose of each organelle o Nucleus 0 Contains DNA 0 Has pores connect the outer and inner nuclear membranes to allow for import and export of proteins and nucleic acids 0 Contains nucleolus o Endoplasmic reticulum 0 Rough ER Connected to the outer nuclear membrane Contains ribosomes site of protein synthesis Produces glycoproteins and new membrane material o Smooth ER 0 Continuous with the rough ER 0 Lipid synthesis 0 Carbohydrate metabolism o Golgi Complex 0 Sorts molecules from the ER hormonesenzymes Secreted from the cell Used within the cell 0 Chemically modifies glycosylation molecules from the ER 0 Glycosylation conversion of proteins from the ER into specific glycoproteins o Lysosome o Produced by the budding of the golgi 0 pH is around 5 0 contains digestive enzymes nucleases lipases and proteases o recycle macromolecules kill foreign bacteria apoptosis o Mitochondria o Oxidative phosphorlyation and respiration occurs 0 Two membranes Outer membrane Rigid Permeable due to pores small molecules ions 0 Inner membrane cristae folds Folded less rigid Less permeable transport through specific proteins Electron transport chain occurs ATP synthesis occurs Matrix n Cytoplasm of the mitochondria n Citric Acid cycle enzymes located o Hydrogenosome 0 found in anaerobic eukaryotes 0 site of ATP synthesis 0 NO ETC or Citric Acid Cycle 0 Major biochemical reaction Oxidation of pyruvate to acetate hydrogen and carbon dioxide o Chloroplast 0 Found in eukaryotic phototrophs o Stroma Cytoplasm of the chloroplast Site of Calvin cycle a Enzyme RuBisCO helps to fix carbon dioxide to organic molecules sugar n RuBisCO synthesizes phosphoglyceric acid o Key component in the synthesis of glucose 0 Outer Membrane permeable 0 Inner Membrane Less permeable o Grana of Thylakoid Membrane Stacks of flatten membrane discs Contains chlorophyll ATP synthesis and ETC located Impermeable to ionsmetabolites 7 Describe the flow of information within the cell for a digestive enzyme starting with the DNA in the nucleus Are viruses living cells o No because are incapable of reproduction It is reliant on a host cell What is virus made of o A virus is made up of a nucleocapsid A nucleocapsid is made up of nucleic acid surrounded by protective protein capsid What are the two forms of a virus In which form does the virus do harm c There are two main forms of a virus 0 Extracellular Outside of host Harmlessinert Virion a complete virus particle with its DNA or RNA core and protein coat that exists outside of a host it is the structure that a virus genome moves from cell to cell c Intracellular o Replicates inside of a host by taking over metabolic machinery Components of virus coat synthesized Viral genome replicated 0 Describe the genome of a virus How do viral genomes differ from the genomes of living cells known today o Viruses have a small genome 5 kb 230 kb and the genome can be made from DNA or RNA The genome could be linear circular doublestranded or singlestranded Most viral genomes are linear Viral genomes differ from the genomes of living cells today because living cells must have doublestranded DNA Viruses can be single stranded or composed of RNA What part of a virus gives the nucleocapsid its helical or icosahedral symmetry o Arrangement of the capsomers capsid proteins 0 Helical Symmetry rodshaped protein subunits twist up 0 Icosa hedral Symmetry 20 equilateral triangles roughly spherical What is a viral envelope What cell structure is the viral envelope similar too o Viral envelope is a membrane surrounding the nucleocapsid It is very similar to the cell membrane structure A viral envelope consists of a lipid bilayer with glycoproteins embedded in it The lipids in the envelope are derived from the host membrane but the proteins are derived from the viral genome What does it mean for a virus to have complex structure o Complex viral structures consists of several parts each with separate shapes and symmetry Many complex structures are bacterial viruses Bacteriophages Complex structures can include collar tail tail pins endplate and tail fibers Endplate TaiJ o fibers o Viroid o No protein 0 Circular single stranded RNA 0 Smallest known pathogen 0 Cause plant diseases Potato spindle tuber viroid Move from plant to plant via plasmodesmata o Prion 0 Protein particles 0 No nucleic acid 0 CJD humans 0 BSE mad cow 0 CWD elk Deer O o Prion mechanism to cause disease Normal O a function o Neural cells produce normal form of the prion protein PrPc by the gene Prnp Abnormally folded prion protein catalyzes Abnormal form is protease resistant insoluble and forms aggregates in normal cells This eventually leads to the destruction of neural cells l O In what form single or double stranded linear or circular are most prokaryotic genomes 0 Double stranded DNA in single circular chromosome In what form single or double stranded linear or circular are most eukaryotic genomes 0 Multiple Linear double stranded DNA What is a plasmid Genetic element that replicates separately from chromosomes Mainly in prokaryotes rare in eukaryotes Differ from chromosomes do not contain essential genes Differ from viruses 0 No extracellular form 0 Don t cause cellular damage What is a transposable element Sequences of DNA that move around different positions within a genome 0 Describe the process of replication How does replication differ in a bacteria versus a eukaryote Where does replication occur in the cell What is the outcome of replication Replication 0 DNA replication begins at origins of replication Double helix is opened and two strands are exposed to replicating machinery The open ends of the strands are called replication forks o Helicases bind to the replication fork and continue to unwind the DNA and SSBP singlestranded binding protein bind the outside of DNA to ensure that the DNA does not form a double helix 0 Primases produce short segments of RNA which are called primers Primers are needed because DNA polymerase are unable to start replication because they need a 3 OH to bind to The primer provides the 3 OH for the DNA polymerase to bind to and adds nucleotides in 5 to 3 direction 0 DNA polymerase III continues to add nucleotides as the helicase unwinds DNA Leading strand and lagging strand are produced The leading strand is the strand that is replicating continuously in the same direction as the replication fork Lagging strand is replicating in the opposite direction of the replication fork As the replication fork continues to open primers are formed in segments in order for DNA polymerase to add nucleotide sequences 0 DNA polymerase I removes the primers by replacing it with complementary DNA nucleotides Also ligase is used to fill the nicks produced by the lagging strand fragments o Nucleoid o Nucleoid o Single circular o Single circular chromosome chromosome o Supercoiled by DNA o Most are supercoild gyrase by DNA gyrases but some have histones to form nucleosomes o Extrachromosomal o Extrachromosomal plasmids plasmids o Transposable o Transposable element elements o Transposable elements segments of DNA that can be moved from 1 site on a DNA molecule to another site on the same or different DNA molecule o Replication occurs in the nucleus o Outcome of replication 2 identical strands of DNA What is the origin of replication How many are there o The origin of replication is where DNA replication begins o Bacteria 1 origin of replication o Archaea 1 2 or 3 origins of replication o Eukarya multiple origins of replication Name the enzymes involved in replication and what they do during replication Nucleus Multiple I chromoso Wound arr histones t form nucleoson Plasmids rare mitochonc and chlorc have their DNA Transposa elements Mi 399 o Helicase unwinds double helix at replication fork o DNA gyrase supercoils DNA found in prokaryotes archaea bacteria o Singlestranded Binding Proteins SSBP prevents the separated DNA strands from forming a double helix o Primase creates a short segment of RNA called a primer in order for DNA polymerase III to start adding nucleotides o DNA Polymerase 111 main polymerizing enzyme synthesizes DNA from 5 to 3 direction o DNA Polymerase I removes primers by adding complementary DNA nucleotides What are topoisomerases do o Topoisomerases can add or remove supercoils o Class I Topoisomerase o Breaks single strand in DNA 0 1 supercoil added or removed o Class II Topoisomerase o Breaks double helix strand 0 Allowing 2 supercoils to break or added Describe the process of transcription How does transcription differ in a bacteria versus a eukaryote Where does transcription occur in the cell What is the outcome of transcription What strand of the double stranded ds DNA is transcribed 5 to 3 or 3 to 5 o 3 to 5 How would a single gene be transcribed in a bacterial cell c Uses sigma factors to help RNA polymerase to bind to promoter o Use of 1 RNA polymerase How would a single gene be transcribed in a eukaryotic cell c One single gene can only be transcribed one at a time in a eukaryotic cell c Uses transcription factors to help RNA polymerase to bind to promoter o 3 RNA polymerases mRNA tRNA rRNA What is an operon Operon is a group of related genes that are cotranscribed together to give a polycistronic mRNA How would multiple genes of an operon be transcribed in a bacterial cell o All the genes would be transcribed at once producing a polycistronic mRNA o Polycistronic mRNA is formed when multiple genes are cotranscribed found in prokaryotes Are operons found in eukaryote genomes 0 N0 Using the arg operon describe enzyme repression When is the repressor bound to the operator Under what condtions does transcription of the arg operon occur What is the outcome of transcribing the arg operon Enzyme repression is a form of negative control for transcription regulation It is a negative control mechanism because transcription is stopped In a cell arginine is typically produced However the production of the operon arginine is repressed when is arginine enters the cell from the environment The arg operon is repressed because the arginine from the environment acts as a corepressor and binds to the repressor Then the repressor binds to the operator to prevent the transcription of operon arg The operator is a segment of DNA that allows for a repressor to bind in order to cease transcription Operators are only seen in negative control of transcription mg Promoter urgOperator aIgC argB nrgH W i l WMMM lMW nmnlwwmlw gt gtl rnnsuiplion proceeds a v Repressor Compressor dig Operator transcription blinked Repressor quot7 Using the lac operon describe enzyme induction When is the repressor bound to the operator Under what condtions does transcription of the lac operon occur What is the outcome of transcribing the lac operon Lac operon is an example of negative transcription control Lac operon is produces B galactosidase which cleaves lactose into glucose and galactose The repressor protein is active in the absence of an inducer which prevents transcription This occurs when no lactose is present When lactose is present an inducer allolactose binds to the repressor and inactivates it Therefore the repressor is inhibited and transcription can occur Transcription occurs in the presence of lactose because it needs to broken down to glucose and galactose 39l39ransrriplion hlorked la la Promoter Operator IaL39Z IacY lacA Iv I lLI39 leWWMlJNWWNDl WWUNlF Repressor lac Ia Promotewperator IacZ IacY IacA W 1Ler WWW w MM 7 gt gt gt 39l rnnscriplion proceeds Repressor b Inducer How does a repressor protein inhibit the synthesis of a specific mRNA 0 Repressor physically blocks the RNA polymerase from starting transcription How does a negatively controlled operon differ than a positively controlled operon o Negatively controlled operon stops transcription and involves an operator 0 Repressible operon o Inducible operon o Positively control operon starts transcription 0 Allows RNA polymerase to bind to DNA 0 No operator but has activator binding site 0 Controlled by binding of activator protein when inducer present Using the lac operon describe catabolite repression o Catabolite repression ensures glucose is used first or the best available carbonenergy source first In catabolite repression is a form of positive control In the presence of glucose transcription of the lac operon stops Glucose inhibits CAMP synthesis Transcription is stopped when the CAP protein binds to the inducer CAMP This complex then binds to the DNA ion the CAP binding spot allowing RNA polymerase to bind to the promoter How is the lac operon regulated by both catabolite repression and enzyme induction Is catabolite repression of the lac operon positive or negative control of transcription o Positive control When faced with several sugars as possible carbon sources do E coli cells use all of them at the same time or is there a preference and order to their use o Ecoli would always prefer glucose before any sugar because Ecoli grows fastest with glucose Using the mal operon describe positive control of transcription Under what conditions does transcription of the mal operon occur o Maltose is present What is the outcome of transcribing the mal operon o Production of the mal operon which metabolizes maltose The mal operon produces enzymes for the maltose catabolism It is a form of positive control The mal operon is used when there is maltose present in the cell However in order for the mal operon to be produced the maltose activator protein must bind to an inducer maltose The binding of the maltose activator protein to the inducer maltose allows the maltose protein to bind to RNA polymerase The RNA polymerase maltose protein and inducer complex is able to bind to the activator site and start transcription quota Activator mal binding site Womoter maIE maIF maIG WW mmm No transcription Maltose activator protein a Activator binding site WW I39 mal lmPromoter maIE malF malG f WWW W W39W UNJW gt Transcription proceeds Maltose activator protein lnducer b How does an activator protein differ from a repressor protein Activator protein activates transcription Repressor protein preventrs transcription Describe the process of translation How does translation differ in bacteria versus a eukaryote Where does translation occur in the cell What is the outcome of translation In what direction does the ribosome translate mRNA 5 to 3 or 3 to 5 o 539 t0 339 If you were given a ribonucleotide ss mRNA sequence how would you find the open reading frame 5 AGUCAUGUCAGUACCGAACCG 3 mRNA is read from 5 to 3 An open reading frame should be read from 5 to 3 Starting at the 5 end one would have to find the start codon AUG This is where the open reading frame begins mRNA is read until a stop codon UGA UAA UAG Therefore an opening reading frame is from the start codon AUG to the stop codon UAA UGA UAG 0 If you were given a nucleotide ds DNA sequence how would you find the open reading frame 5 AGTCATGTCAGTACCGAACCG 3 3 TCAGTACAGTCATGGC39I39I39GGC 5 DNA would have to be transcribed to RNA The DNA used would be 3 to 5 strand because RNA polymerase transcribes from 5 to 3 After transcribing the 3 to 5 DNA strand the RNA strand would be 5 AGUCAUGTCAGUACCGUUCCG 3 What three types of RNA are used for translation mRNA 0 template used to make proteins tRNA 0 brings the amino acids needed to make proteins o rRNA 0 brings together tRNA and mRNA for protein synthesis How does the ribosome differ in bacteria versus eukaryotes o Bacteria ribosome is smaller 70S It is composed of 50 S and 30S part c Eukaryote ribosome is larger 80S The small ribosomal subunit is 40 S and the large unit is 60 S 239 What part of the ribosome is used to determine which amino acid gets added to the polypeptide o A site determines which amino acid gets added on to the polypeptide The A site is the acceptor site and it is where the anticodon is located This anticodon codes for a codon which is located on tRNA Depending on the codon tRNA brings a specific amino acid What amino acid does AUG code for in bacteria and eukaryotes o AUG in bacteria Nformylmethionine o AUG in eukaryotes methionine How do nonsense codons signal translation to stop o Nonsense codons are another name for stop codons UGA UAG UAA o Signals for release factor to bind to A site causing polypeptide to be released Small rRNA and large rRNA dissemble Describe a way to get a lot of protein from a single mRNA transcript o Several ribosomes can simultaneously translate a single mRNA molecule forming a complex called a polysome o Polysomes create a lot of protein from a single strand of mRNA o It increase the speed and efficiency of translation What is a redox reaction o Redox reactions release energy o Energy is conserved in redox reaction in the form of phosphorylated compounds They are coupled reaction in which 0 Oxidations occurs Loss of electrons 0 Reduction occurs Gain of electrons Electron donor gives electrons to acceptor Electron acceptor accepts electrons from donor Electron donor substance that is being oxidized Electron acceptor substance that is being reduced What happens to a molecule that is reduced o Gains electrons What happens to a molecule that is oxidized o Loses electrons What does an electron carrier do o Help transfer electrons from acceptor to donor o Two types of electron carriers 0 Prosthetic group Enzymes attach to cytoplasmic membrane Cytochrome C o Coenzymes Freely diffusible NADNADH How can NAD act as an electron carrier o NAD can act as an electron carrier o NAD and a substrate electron donor will bind to an enzyme This produces an enzymesubstrate complex when NAD accepts electron from the substrate Products produced which includes NADH and carbon dioxide How can NADH act as an electron carrier o NADH can act as an electron car What are examples of short term energy storage molecules o Short term energy storage molecules 0 ATP Consists of ribonucleoside adenosine and 3 phosophates 2 bonds phosphoanhydride bonds Breaking of phosphoanhydride binds releases energy Phosphoanhydride bonds P O Primary energy carrier in the cell c Coenzyme A 0 Ex AcetyICoA Thioester bonds CS Hydrolysis of coenzyme A causes the synthesis of energy rich phosphate bond such as in ATP 0 O What are examples of long term energy storage molecules How is each considered an energy storage molecule o They are all considered long term energy storage molecules because they are insoluble polymers that can be later oxidized for production of ATP 0 Long term energy storage molecules in prokaryotes tend to be stored as granules Glycogen PolyBhydroxybutyrate Elemental sulfur 0 Long term energy storage molecules in eukaryotes Polyglucose Lipids in form of simple fats Where does a chemoorganotroph get its energy and electrons o Chemoorganotrophs 0 Organic molecules are used as the energy and electron source 0 Process fermentation and aerobic and anaerobic repsiration Where does a chemolithotroph get its energy and electrons o Chemolithotrophs 0 Inorganic molecules are used as energy and electron source 0 Process anaerobic respiration What is the difference between substrate level phosphorylation and oxidative phosphorylation o Substrate Level Phosphorylation o Substrate removes a phosphate group and is added to ADP to form ATP o Oxidative Phosphorylation o Freefloating inorganic phosphate is added to ADP to form ATP by ATP synthase 0 Protonmotive force 39 What type of phosphorylation occurs in glycolysis to make ATP o Substrate level phosphorylation What type of phosphorylation occurs in fermentation to make ATP o Substrate level phosphorylation What type of phosphorylation occurs in respiration to make ATP o Oxidative phosphorylation Electron transport chain c Substrate level phosphorylation What type of phosphorylation occurs in photosynthesis to make ATP o Oxidative phosphorylation What molecules can be fermented o NucleicAcids o Purines o Pyrimidines o Proteins 0 Organic acids Lactate Acrylate Malate Fumarate Citrate Amino Acids o Polysaccharides 0 Sugars Hexoses Pentoses o Lipids CANNOT be fermented O O O O O 0 What is syntrophy When is Syntrophomonas capable of fermenting butyrate What role would a methanogen play in helping Syntrophomonas ferment butyrate o Syntrophy is a cooperative mechanisms in which microorganisms can work together to degrade a compound o Syntrophomonas is capable of fermenting butyrate to acetate only if methanogens are present to consume the waste product hydrogen gas 394 If glucose is fermented where does the ATP come from What type of phosphorylation generated that ATP What happens to pyruvate Why is it necessary for pyruvate to be reduced to lactate or other fermention product c When glucose is fermented glycolysis still occurs and the ATP is produced from converting glucose into pyruvates However in fermentation there is no external electron acceptor and NAD is not made from the electron transport chain NAD must be made in order for fermentation to occur NAD is made by using an internal electron acceptor pyruvate Pyruvate is converted into lactate ethanol or other fermentable product which causes the oxidation of NADHH into NAD Substrate Level Phosphorylation generates ATP in fermentation It is necessary for pyruvate to be reduced to lactate or other fermentation production in order to produce NAD because NAD is necessary for glycolysis to occur What is the difference between fermentation and respiration o Respiration has external electron acceptors o Fermentation uses internal electron acceptor pyruvate N Describe homolactic fermentation of glucose What microorganisms are capable of this type of fermentation Gram positive bacteria capable of doing homolactic fermentation Hexose 2 lactate 2 H Aldose breaks down fructose into glyceraldehyde 3P Catalase negative 0 Streptococcus 0 Some Lactobacillus o 2 ATP produced Describe heterolactic fermentation of glucose What microorganisms are capable of this type of fermentation o Heterolactic Fermentation 0 Done by gram positive bacteria 0 Hexose lactate ethanol C02 H 0 Process Glucose Glucose 6 phosphate n decarboxylated 6 phosphogluconate 0 What is the difference between homolactic and heterolactic fermentation o Homolactic fermentation produces 2 lactate and 2 H It yields 2 ATP It also uses the enzyme aldose which breaksdown fructose into glyceraldehyde 3P Glyceraldehyde 3P becomes oxidized to form 13 Biphosphoglycerate ATP is produced and pyruvate is formed which is then fermented into lactate o catalase Negative streptococcus and some lactobacillus o Heterolactic Fermentation produces 1 lactate 1 ethanol C02 and H It yields 1 ATP and uses the enzyme phosphoketolase to breakdown pentose into glyceraldehyde 3P and acetyl phosphate Glyceraldehyde 3P gives rise to lactate and acetyl phosphate gives rise to ethanol o catalase Negative some lactobacillus and leuconostoc Describe mixed acid fermentation What microorganisms are capable of this type of fermentation Would a broth culture of Escherichia coli fermenting glucose have an acidic low neutral or alkaline high pH Mixed Acid Fermentation o Hexose ethanol lactate formate succinate acetate H2 C02 o Enteric bacteria Ecoli are capable of mixed acid fermentation o E coli would have a low pH because larger amounts of acids released such as lactate 0 Describe butanediol fermentation What microorganisms are capable of this type of fermentation Would a broth culture of Enterobacter aerogenes fermenting glucose have an acidic low neutral or alkaline high pH o Butanediol fermentation o Hexose ethanol 23 butanediol acetate succinate formate lactate C02 H2 0 Enteric bacteria perform butanediol fermentation such as enterobacter o Enterobacter would have a high pH because acid is released in smaller amounts and 23 butanediol helps to neutralize pH causing pH to be higher than mixed acid fermentation O How could you tell if an organism did mixed acid fermentation or butanediol fermentation 0 pH 0 Low pH mixed acid fermentation 0 High pH butanediol fermentation How is ATP made in a hydrogenosome What product of glycolysis is used to make ATP in the hydrogenosome What kind of 39 g 39 has 39 39 quot What quot do these microbes lack ATP is made in a hydrogenosome by oxidizing pyruvate Eukaryotes who conduct anaerobic respiration have hydrogenosomes Eukaryotes who have hydrogenosomes lack mitochondria Ex Of organism who has hydrogenosome trichomonas Cell membrane Eytoplasihf Glucose l Glycolysis Pyruvate C01 II Hydrogenosome ATP Ammo What product of glycolysis feeds the citric acid cycle 0 2 pyruvates Does the citric acid oxidize or reduce pyruvate to carbon dioxide 0 Citric acid completely OXIDIZES pyruvate to carbon dioxide Where do the NADH and FADH generated by redox reactions of the citric acid cycle go 0 Go to the electron transport chain What are the intermediates of the citric acid cycle such as oxalacetate and aketoglutarate used for a o Organic intermediates in the citric acid cycle oxalacetate and o ketoglutarate are used for biosynthesis production of substances from simpler substances requires energy Aerobic and anerobic respiration differ in what way o They differ in their external electron acceptor o Aerobic Oxygen electron acceptor o Anaerobic Non oxygen molecule a N03 n 804 What is the terminal electron acceptor for aerobic respiration o Oxygen molecule is the terminal electron acceptor for aerobic respiration What is the terminal electron acceptor for anaerobic respiration o A nonoxygen molecule from the environment It could be N03 or 804 List 4 protein electron carriers How many electrons and protons can each accept and donate o NADH dehydrogenases o Binds to NADH receive 2 H 2 electrons o Releases NAD donates 2 H 2 electrons to flavoproteins o Flavoproteins 0 Receive 2 H 2 electrons 0 Donate ONLY 2 electrons o Cytochromes 0 Single iron atom that can acceptdonate a single electron 0 Iron located in heme portion of cytochrome 394 H o IronSulfur Complexes 0 Donatesaccepts electrons 0 Number of electrons donated are based on the number of iron atoms List 2 nonprotein electron carriers How many electrons and protons can each accept and donate o Quinones o RECEIVE 2 H 2 electrons o DONATE 2 electrons NADH NAD 0 Receive donate 2 H and 2 electrons Which electron carriers contribute to the proton motive force needed to make ATP o Flavoproteins o Quinones 0 These 2 electron carriers contribute to the proton motive force need to make ATP because they are capable of receiving H ions but are incapable of donating H ions When quinones and flavoproteins receive H ions they are pumped out of the electron transport chain and membrane This creates a a pH gradient more H out of cell and electrochemical potential pos outside membrane negative inside membrane What are the components of an electron transport chain What is the purpose the outcome of an electron transport chain c Electron transport chain consists of 9 complexes These complexes are composed of several proteins o Electron transport chain also consists of electron carriers which carry electron from donor to acceptor o NADH Hydrogenases o Flavoproteins o Cytochromes 394 o IronSulfur Complexes 0 Quinones o Purpose of Electron Transport Chain 0 Create proton motive force by pumping hydrogen ions out of the cell 0 Proton motive force pH gradient and electrochemical potential positive outside cell negative inside cell 0 Protons are able to be pushed out of the cell because in ETC each electron transferred is downhill energetically In a eukaryotic cell in what organelle would an electron transport chain be located In what membrane On which side of the membrane will protons accumulate On which side of the membrane will ATP be made Respiration in Eukaryotes o Electron transport chain will be located along the inner membrane of the mitochondria Protons will accumulate in the intermembrane space in between the inner membrane and outer membrane of the mitochondria They will accumulate outside of the inner membrane of the mitochondria ATP will be made in the matrix of the mitochondria cytoplasmic side of the membrane In a prokaryotic cell in what membrane would an electron transport chain be located On which side of the membrane will protons accumulate On which side of the membrane will ATP be made Respiration in Prokaryotes o Electron transport chain would be located in the cytoplasmic membrane o Protons would accumulate outside of the cell c ATP will be along the cytoplasmic side of the membrane H E coli has the ability to do aerobic respiration Fig 2114a anaerobic respiration Fig 2114b and fermentation Fig 1523a Which form of metabolism will E coli use in an oxygenic environment o Aerobic respiration Which form of metabolism will E coli use in an anoxic environment o Anaerobic respiration if possible If no external electron acceptor then fermentation Which form of metabolism used by E coli can be thought of as a backup way to make ATP to be used when the others cannot be used c Fermentation is thought of as a backup way to produce ATP Fermentation occurs when there is no EXTERNAL electron acceptor It is a backup way because only 2 ATP can be synthesized What term is used to describe the use of a proton motive force to generate ATP Chemiosmosis the use of proton motive force to generate ATP In what way is the ATP synthase similar to bacterial flagella o ATP synthase is similar to bacterial flagella because the way proton motive force applies torque to the bacterial flagella is also applied to ATP synthase o Proton movement through F0 causes proteins c proteinsat the base to rotate The rotation of the proteins at the base transfers torque to F1 The energy transferred is used to phosphorylate ADP to ATP F1 Compare and Contrast Respiration to Fermentation Internal electron acceptor External electron acceptor Pyruvate REDUCED Pyruvate OXIDIZED to Carbon Dioxide Substrate Level Oxidative Phosphorylation Phosphorylation N0 ETC ETC N0 ATP Synthase Use of ATP Synthase to produce ATP 2 ATP produced per glucose 38 ATP Produced per glucose What is the energy source for a phototroph Light What is photoautrophy 0 Reduction of C02 to organic compound Where does photosynthesis occur in a eukaryote In a prokaryote o Eukaryotes o Photosynthesis occurs in choroplasts specifically in the thykaloid membrane 394 Prokaryotes o Photosynthesis can occur H Ulnl MM l39i iv c n Purple bacteria heliobacteria Chlorosomes non unit membraneenclosed structures a Green bacteria sulfur bacteria Thykaloid membrane a Cyanobacteria What is the purpose of photosynthetic reaction centers Photosynthetic reaction center is where light energy is directly converted into ATP Antenna Pigments surround the reaction center Main photosynthetic antenna pigments are chlorophylls oxygenic photosynthesis and bacteriochlorophylls anoxygenic photosynthesis Name the pigments responsible for harvesting light energy for phototrophs Where are these pigments located in a eukaryotic cell In a prokaryotic cell Chlorophyll oxygenic photosynthesis and Bacteriochlorophyll anoxygenic photosynthesis harvest light energy for phototrophs Chlorophyll and Bacteriochlorophyll can be 0 ANTENNA Surrounding the reaction centers 0 IN REACTION CENTERS In eukaryotes pigments located in thykaloid membrane In prokaryotes pigments located in ifxl ri l niliezlii39 iiu quot Heliobacteria purple bacteria 0 Thykaloid Membrane Cyanobacteria o Chlorosomes Gram negative Green Bacteria a Green Sulfur Bacteria o Chlorobaculum tepidum a Green NonSulfur Bacteria o Chloroflexus What pigment resides in the photosynthetic reaction centers in an anoxygenic phototroph o bacteriochlorophyll What pigment resides in the photosynthetic reaction centers in an oxygenic phototroph o Chlorophyll What do antenna pigments do o Capture light energy at certain wavelengths and send it to photosynthetic reaction centers gll rllf llll ll o Anoxygenicoxygenic photosynthesis differ mainly in electron donor o Anoxygenic photosynthesis has inorganic electron donor o Oxygenic photosynthesis has an water as its electron donor What is the initial electron donor to anoxygenic photosynthesis o Inorganic electron donor What is the initial electron donor to oxygenic photosynthesis 0 water How is oxygen generated in oxygenic photosynthesis o oxidation of water How is NADH generated in anoxygenic photosynthesis o NADH is generated when the quinones donate one electron to NAD quotH r gt1 c ifquot r o It is generated by he substrate pho phorylation of NAD o NAD acts as the terminal electron acceptor so when reduction occurs when the electron is accepted by NAD forms NADH What process can use the NADH generated by anoxygenic and oxygenic photosynthesis o Calvin Benson Cyclce Name a model organism used to study anoxygenic photosynthesis o Rhodobacter capsulatus nonsulfur purple bacteria Name a prokaryotic model organism used to study oxygenic photosynthesis o Synechocystis green algae Name a eukaryotic model organism used to study oxygenic photosynthesis o Chlorella List all catabolic processes discussed in class Fermentation Anaerobic Respiration Aerobic Respiration Anoxygenic photosynthesis Oxygenic photosynthesis The short term energy ATP generated by these catabolic processes is used for what o It is used for anabolic processes Energy is used to produce other compounds or molecules for cell usage cell material It is called biosynthesis Where can organisms get there carbon o Autotrophs 0 Get carbon from C02 o Heterotrophs 0 Get carbon from organic compounds What name is given to an organism that can take carbon dioxide from the air to form other organic compounds Autotrophs use C02 from the air in order to make organic compounds carbon molecules for cell usage Where do heterotrophs get their carbon Heterotrophs get their carbon source from organic compounds These organic compounds are then used to make carbon molecules Explain why the CalvinBenson cycle is often referred to as the dark reaction of photosynthesis o CalvinBenson cycle is considered dark reactions because no light is needed for the cycle o It uses the NADH produced from oxygenic or anoxygenic photosynthesis to produce carbon molecules If we split the term photosynthesis into photo and synthesis which would be used to describe the CalvinBenson cycle o Synthesis would be used for the Calvin Benson cycle because carbon molecules are synthesized Where does the CalvinBenson Cycle occur o Eukaryotes o Stroma of chloroplasts o Prokaryotes o Carboxysomes The CalvinBenson cycle is used by autotrophs to make o 6 Carbon molecule fructose What is the initial reaction of the CalvinBenson cycle 6 C02 3 12 3Phospho 12 ATP Vglycerate 6 Ribulose 5 carbons 15bisphosphate 30 carbons 12 13Bisphospho glycerate 36 carbons 6 ATP 12 Glyceraldehyde 6 Ribulose 3phosphate 5 phosphate 36 carbons 30 carbons Sugar Fructose rearrangements 10 Glyceraldehyde 6 Ph sphate 3phosphate 6 carbons 30 carbons 39l39o biosynlhesis Gracia warmly 5 gt galz rihiia 7122 1 RuBisCO fixes C02 by binding it to ribulose biphosphate 5 carbon forming 2 phosphogylcerates 3 carbon 2 ATP is used to make form 2 molecules of biphosphoglycerate 3 carbon from 2 molecules of biphosphogylcerate 3 carbon 3 NADH is needed to form 2 molecules glyceraldehyde 3 P 3 carbon from biphosphoglycerate 3 carbon 4 glyceraldehyde 3 P is used to make 6 carbon sugar fructose 5 Fructose is used for biosynthesis RubisCO fixes carbon dioxide 1 carbon by binding it and ribulose 15 bisphosphate 5 carbons to form two 3carbon molecules of phosphoglycerate RubisCO is an acronym What does it stand for What other molecule besides carbon dioxide can RubisCO bind How could this be a problem o RuBisCO stands for o Ru ribulose 0 Bi biphosphate o C carboxylase o O oxygenlase O o Oxygen can also bind to RuBisCo This is a problem because carbon molecules will not be able to produced if oxygen binds to RuBisCO instead of carbon dioxide What is the purpose of the CalvinBenson cycle o Produce carbon molecule o Fructose 6 carbon sugar What is the purpose of the reverse citric acid pathway c To produce carbon molecules from carbon dioxide What is the purpose of the hydroxypropionate pathway c To produce carbon molecules from carbon dioxide What is the purpose of the acetylCoA pathway c To produce carbon molecules from carbon dioxide How are sugars made What catabolic process is used What catabolic process is used in reverse o Hexoses sugars glucose and derivatives o Catabolic process used citric acid cycle o Catabolic process done in reverse glycolysis o The intermediates from the citric acid cycle are used in reverse glycolysis to produce sugars What are pentose sugars made from o Ex ribose or deoxyribose o Made by removing C02 from hexose Use ADPG to explain activated glucosequot How does this activated glucose provide the energy to add the glucose onto a polysaccharide of glucose like glycogen starch or cellulose Polysaccharides glycogen starch peptidoglycan LPS are produced from activated glucose ADPG ADPG Glycogen ADP GlycogenGlucose The breaking of the activated glucose ADPG releases enough energy to bind glucose to glycogen Glucose is able to bind to glycogen because breaking of the phosphateglucose bond release a lot of energy


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Jim McGreen Ohio University

"Knowing I can count on the Elite Notetaker in my class allows me to focus on what the professor is saying instead of just scribbling notes the whole time and falling behind."

Allison Fischer University of Alabama

"I signed up to be an Elite Notetaker with 2 of my sorority sisters this semester. We just posted our notes weekly and were each making over $600 per month. I LOVE StudySoup!"

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."

Parker Thompson 500 Startups

"It's a great way for students to improve their educational experience and it seemed like a product that everybody wants, so all the people participating are winning."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.