New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here


by: Charles Kohler
Charles Kohler
GPA 3.94

J. Whitehead

Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

J. Whitehead
Class Notes
25 ?




Popular in Course

Popular in Biological Sciences

This 53 page Class Notes was uploaded by Charles Kohler on Tuesday October 13, 2015. The Class Notes belongs to BIOL 3040 at Louisiana State University taught by J. Whitehead in Fall. Since its upload, it has received 35 views. For similar materials see /class/222836/biol-3040-louisiana-state-university in Biological Sciences at Louisiana State University.

Popular in Biological Sciences


Reviews for EVOLUTION


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 10/13/15
PHYLOGENETICS BIOL 3040 Lecture Section 10 See Freeman amp Herron Chapter 14 Eucalya Amma s Gree Enzamuebae S ime nonism r Amhaea molds Bacteria baclena am lt1 mmquot Methanosarcina 1 V cwcmu A P L GKLEHTI 39v Haluarchaea 3 pos wes MetIdnubauferfum magma Methano Thernnprateus CDCCLIS Iceer Cyanobacteria Flavobacterie Pymmnnum Flagellates Tvichumonads Tnennarogales Dip omonad M icrosporidva Most recent common ancestor of aH hvmg organisms W s 22 5 a 4305 up 629 s got 6 7 V 1 0 de dq d wosae Vow e m eie w 650M 0 w 09W NW W16 gun 5w 0 Now PM I M a 69 We xvi o ex37395quot I T Gmbesraned neaa PaMc mmmuvc momlieo so an me pubis is parauel tu me ischiJm and imum 1quot Tan venebraa wum angzs that are red med or absem Fused pelvlc SWUCIUI39B WWquot more man 5 VEHEDYEB Len h of radius lenglh 0f ulr a bones of tha mwel Ving w less hen 07 a A Ureasttmrle will a pmnune l ndqe waved a keel Q Comp ex faathexs ewenhan 2531 vertebrae Simple salhers Slide 1 MACROevolutionary questions How did plants and animals come to be the way they are Where did major groups come from What are a group s Closest relatives How do new species arise and why is the biological world so diverse WHY study phylogenetics insights into the nature of adaptation and origins of diversity tells us about patterns and rates of evolutionary Change through time in different groups and in different priods of Earth s history Alternate osmotic tolerant physiologies have evolved multiple times unidirectional and may evolve quickly Slide 2 Why have some taxa remained virtually unchanged over evolutionary time whereas others show extreml 7 high rates of character evolution human sharkhuman common ancestor Slide 3 Taxon pl taxa the name assigned to a group of organisms in a hierarchical classification scheme o Felis catus Garfield s specific taxon o Felidae Garfield s Family 0 Carnivora Garfield s Order o Eutheria Garfield s lnfraclass o Theria Garfield s Subclass o Mammalia Garfield s Class Slide 4 Important concepts and definitions Taxon pl taxa the name assigned to a group of organisms in a hierarchical classification scheme Phylogeny a description diagrammatic or otherwise that chronicles the genealogical ie ancestraldescendant relationships among a group of taxa Category the rank of a group of related organisms in a phylogeny Species genera families orders classes phyla and kingdoms Taxonomy the process of recognizing monophyletic taxa taxa that represent all of the individuals andor taxa that descended from a most recent common ancestor and naming them ClassificationSystematics in the modern sense The processscience of arranging taxa into a hierarchical scheme that depicts their evolutionary relationships Pongidae orangutan gorilla Slide 5 Polyphyletic taxa Polyphyletic MDWDMMUC Polyphyletic taxa contain more than one implicit common ancestor within the taxon These groupings are most often due to convergent evolution that is these classifications are based on analogous characters CDF would be polyphyletic because EACH C and D and F shared a most recent common ancestor with other taxa B and E and GH respectively than with each other the common ancestor of C and D and F lies outside of the taxon that includes only C and D and F Slide 6 Engler and Prantl 18871915 9 Order Amentiferae included willows walnuts and oaks Oak catkin Walnut catkin Slide 7 Walnut EUI CG itls labids eurosids ll malvitlsj Polyphyletic taxa OakBeech Willow N hofaus Fagaceae beech or mix family Bstiibceae birch family Casuarinaceae sheoak family Fagam Cucurbilaies Resales Fabales Zygophylhles Oxalidales l39ulalpig h iales quot Cebstrales Huaceae Picrarnn39a Alvaradoa Geran tales Crossosomatales My Hales Tapiscia sinensis walnut oak willow are very distantly related catkins evolved multiple times similarities in floral morphology due to convergent evolution Brass bales lulaivales Sapinclaies Salicacsae willmv family incl Flacourt39a v Achariaceae Inc a ourlaceae pro parle Violaceae violetfamily Passifbmceae passionfnverfamiiy Turneraceae lulalesherbiaceae Clusiaceae Podostemaceae incl Tristbhaceaei Hyperioaceae saint johns worl family Balanops Chrysotehnaceae Euphionia Dichapelalaceae Trigon39aceae Erylhinxykiceae Flhizophoraceae red mangrove family Malpigh39acecie Ehrbados cheriy family Ebtinaceae Pandaceae F39utr anjivaceae F39hyllanlaceae Picroclendraccae Euphorbiaceae spurge family Ixonanthaceae Lac slemaceae Linaceae incl Hugoniaceae Lophopyxis maingayi Clenolophonaceae Ochnaceae luledusagynaceae Quiinaceae Irvingiaceae Bonnet39aceae Perid39scaceae Phyllanthaceae Caryccaraceae Pseudanthaceae Gouphcwe Humiriaceae Hafiles39aceae Slide 8 monoghzetic taxon comprises the group of ALL taxa descended from a single common ancestor or node on a tree garaghyletic taxon is a set of taxa that includes its common ancestor but leaves out some of the descendant taxa Dnrnphvhtlc w r s V y quot t 39 I39 x K xl quotIf I I 2 Polyphyletic Slide 9 Paraphyletic taxa example pongidae Pongidae orangutan gorilla chimpanzee Pongo orangutan F an chimpanzee and In ow I H I 7 Homo humans Gurilh Slide 10 Paraphyletic taxa example reptilia Segregating birds into class Aves makes the class Reptilia paraphyletic Sllde 11 Flowers key innovation that led to angiosperm diversity flowers Calamopihjaceae Hydraswrmaceae 1i Lyginopteridaceae f Medullcsaceae chads Callistophyl ceae if Conifers Cordaitopsida 1 Gmsopteridaceae 1i Czekanowslttaceae f Gin kgoe Peltas permaceae Corystospermaceae Cayton39aizeae 39ilr v Penmxylales i BEHHE39HHBIE 1 GI IEIEIES Ang mperms flowering plants I Ephedra G netales ta Sunflowers angiosperms Gymnosperms have naked seed but ancestral state Angiosperms acquired carpal tissue around seeds Am borella lric hopoda magnoliids Cliloianthaceae Oeratophyllaceae lulonocotyledons lilies orchids palms glasses and their relatives eudicots mmtfbwering planlsj Austrobaileyalee Nymphaeaceae water lilies and their relatives SHde12 Pitfalls of building paraphyletic taxa 0 They conceal true evolutionary relationships 0 They move the problem around but they don t solve it 0 They can give very misleading pictures about the evolution not just of taxa but of particular evolutionary features and sometimes particularly important evolutionary features Slide 13 How to build phylogenies 1 Evolutionary systematics the traditional approach based largely on an extensive knowledge of a group based on fundamental Characters rely heavily on homologous Characters and try to avoid analogous Characters rely on number or arrangement of parts rather than size of parts Slide 14 How to build phylogenies 1 Evolutionary systematics the traditional approach 2 Phenetics aka Numerical taxonomy or systematics developed by statisticians in the 1960 s and 1970 s response to the lack of objectivity in the evolutionary systematics school sought more objective approach by grouping taxa hierarchically by overall phenotypic resemblance 9 based on as many characters as possible Rationale overall phenotypic resemblance based on LOTS of characters will reflect recency of shared ancestry false geneological signal from convergent characters overwhelmed by signal from all other characters Method computer algorithms compute phenetic distances between taxa clustering algorithms group taxa based on distance measures Slide 15 aJPbau cmmntsfu vespecies 3 3 39Co 5 39Ix1 2x39 x a a t x J j p39A 39 Chaim 2 longth of VIth uniI 4b Meant neighbor ct Average neighboc 1 1 2 2 3 3 s s Assignment Go through this series of tutorials httpwwwblackwellpublishingcomridleytutorialsClassificationandevolution1asp SHde16 Problems with Phenetics 1 Some characters may be much more informative about ancestral descendant relationships phenetics does not distinguish bt homologous and analogous characters assumes that most morphological variation that persists through time is selectively neutral 2 Many clustering procedures are possible choice of clustering procedure often arbitrary different clustering procedures can sometimes lead to very different phylogenies from the same data set 3 Misleading results if traits evolve at different rates along different branches derived from a common ancestor Port Jackson shark vs Michael Jackson 4 Rank is solely determined by degree of similarity not whether taxa arose from the same ancestor pongidae Slide 17 How to build phylogenies 1 Evolutionary systematics the traditional approach 2 Phenetics aka Numerical taxonomy or numerical systematics 3 Cladistics aka Phylogenetic systematics Willi Hennig 1966 classification based strictly on recency of shared ancestry NOT morphological similarity PHENETICS v David R Maddison Slide 18 CLADISTICS Evolution proceeds by a series of branching processes which give rise to clades at different levels of a hierarchy 96 006 do CLADE MONOPHYLETIC group all taxa derived from a single branch or node of the tree node represents an ancestral species Sister taxa taxa derived from a node are by definition of the same age therefore given same categorical rank Slide 19 Parsimony all evolution has occurred with the FEWEST possible number of character changes Assumptions evolutionary change follows the most direct path possible character changes are rare events ABcd Abcd ABCd ABCD Abcd ABCd ABCd ABCD abcd abcd Ancestral character state plesiomorphic state 3quot 2 Clades defined solely on the basis of sharing derived characters 3 types of similarity only 2 of which represent homologies 1 synapomorphy shared derived Character state 5 a e a 609 a a e a e 0 9 0 Woe o 9 2 579 50 r dime ted 69 06 We d mom ON are 81 a 5 N p Globeshaped head Yquot gt Pelvic structure modified so that the V pubis is parallel to the ischium and illium Tail vertebrae with flanges that are reduced or absent Fused pelvic structure with more than 8 vertebrae Length of radius length of ulna bones of the lower wing lesst an 07 A breastbone with a prominent ridge called a keel 9 Complex feathers fewer than 26 tail vertebrae Simple feathers 3quot 21 Clades defined solely on the basis of sharing derived characters 3 types of similarity only 2 of which represent homologies 1 synapomorphy shared derived Character state 2 symplesiomorphy shared ancestral Character state 3quot 22 Clades defined solely on the basis of sharing derived characters 3 types of similarity only 2 of which represent homologies 1 synapomorphy shared derived character state 2 symplesiomorphy shared ancestral character state 3 homoplasy shared character acquired independently in different lineages can result from convergent evolution of analogous traits or by reversal of character states species 1 2 3 4 1 2 3 4 1 2 3 4 characters A A a a B b b b B b B b Bx Bx Bx b b b 3 A K Er a Eu Vs lt3 a Derived homology Ancestral homology Homoplasy Slide 23 State Ferns Gymnosperms Angiosperms character Type of fertilization 0 0 1 0single 1double Seeds 0 1 1 0NO 1YES True xylem 0 0 1 0NO 1YES fern gymno angio fern gymno angio xylem YES fert DOUBLE Phenetics Cladistics seeds YES ANCESTRAL STATE fertilization single seeds NO true xylem NO Slide 24 Amniotes all possess egg membrane during development monophyletic group alga 6amp9 66 o 0amp6 6 6 5 69 6 mammary gand 4chambered heart synapomorphy synapomorphy suborbital fenestra skull opening endothermy amnion synapomorphy homoplasy reptiles have not evolved at rapid rates similarities among reptiles due to retention of ancestral plesiomorphic characters mammals and birds have evolved extensively and derived many unique characters extensive diversification Slide 25 Ancestral characters 9 4 o a 6 5 69 v99 96 0 O 696 0amp6 V 9 0 6 o fe a th e rs c h ro m cs 0 m a l chromosomal most sp chromosomal sex determination environmental sex determination Environmental sex determination crocs aligators some turtles Environmental sex determination ancestral character state symplesiomorphy Reptiles amniotes without hair or feathers symplesiomorphy 9 paraphyletic grouping have scales symplesiomorphic character Slide 26 WHICH of various character states is the ANCESTRAL one The problem of inferring character polarity 1 Common character state is assumed ancestral 9 parsimony BUT not always true Example taxa with chromosomal sex determination have left more descendent taxa than taxa with environmental sex determination but environmental is almost certainly the ancestral state Slide 27 WHICH of various character states is the ANCESTRAL one The problem of inferring character polarity 1 Common character state is assumed ancestral 9 parsimony 2 Analysis of character changes in development 9 reveal whether a particular state of the character is ancestral or derived In general probably true that derived features tend to be expressed later in development than ancestral ones BUT THERE ARE MANY EXCEPTIONS TO THIS Slide 28 WHICH of various character states is the ANCESTRAL one The problem of inferring character polarity 1 Common character state is assumed ancestral 9 parsimony 2 Analysis of character changes in development 9 reveal whether a particular state of the character is ancestral or derived 3 Fossil evidence 9 assume that most ancient form observed in fossils is the most ancestral F39 uro159 or I 7 39 ia Panelof lb miluidente from it Posilevidence from quotquot quotquot quot 3mquot quot evolution datlvdycomphu mom tela vdylntomphhrocotd Character in l m us have o39olxuj lwd39nrcitsdcrivul sink I39il39 I39 lhl ll ill 39lussil m nul i a 5 lama a relatively c omplne the Tune El amt51ml state will be PYCSCH ul in earlier lumils ll Inn Ii il l incomplete thcdcrived stale quot 393 may liil or may not Ii iiil be lirawit ulrln r ll39lzlll i lk39 ancestral state from Ridey 2004 Evolution l m ll if the earliest state in a lineage is either not fossilized or preserved it can be easy to assume that the derived character state is actually the ancestral one Slide 29 WHICH of various character states is the ANCESTRAL one The problem of inferring character polarity 1 Common character state is assumed ancestral 9 parsimony 2 Analysis of character changes in development 9 reveal whether a particular state of the character is ancestral or derived 3 Fossil evidence 9 assume that most ancient form observed in fossils is the most ancestral 4 Outgroup comparison most widely used method by cladists 9 infer ancestral state from character state of closely related species from outside of the phylogenetic group you are studying S39ide 3 Outgroup comparison mome spay 1 2 3 cme Have 4 species with character states as outlined in a L hm th am 9 1 1 1 a a did character a evolve into bJPlIylogenetkinlum a or did a evolve into a 9 Examine closely related species and INFER the ancestral state in the group of four 9 if outgroup state is a then we infer that species 2 and 4 share more recent common ancestor with each other than with any of the other species a from Ridley 2004 Evolution 9 PARSIMONY is the basis for outgroup comparison Slide 31 Molecular evidence on the origin of tetrapods and the relationships of the coelacanth Axei Meyer TREE no 1039 no 3 Math I995 3quot 32 Characters used to construct phylogenieS 1 Morphological data Most useful a NOT influenced by selection 9 convergent evolution b traits uncorrelated with each other 9 avoid redundant information of the same evolutionary transformation Score as DISCRETE characters according to a Presence vs absence b number ie digits in vertebrates 3quot 33 Characters used to construct phylogenieS 1 Morphological data 2 Moleculardata BASIC assumption most variation at the molecular level is not subject to strong selection is neutral and should evolve at a relatively predictable rate avoid the problem of analogous characters Advantage recent technological developments allow for cost effective generation of HUGE datasets Disadvantage HOMOPLASY there are only 4 character states given enough time 9 reversals more likely some substitutions more likely than others 9 3rd position codon changes more likely than lst or 2nd 9 transitions more common than transversions Types of mutation other than single substitutions such as duplications and inversions are much less prone to problems of homoplasy reversals less likely Slide 34 Bilateria IIIEGl mum le39lLl le gl x I1FIII39Iu JrlhrCIlZJili i Ctenophura H33 v 9 Plamzna 339 Porifer lila rrluem FIG 2 Transmission cl drial genome of the hydrozo control plasmid pBR322 E d Viifhil39 iu39f Evolution Class mitocl Antlm DIANE BR AND LEO ABSTRACT midstinn cl tehrate tooll genome in n and in the I species taste whereas all lestetl displa ctenophore the shared cnidnrian cl within the p Anthcena Cut320a Suzy phozna Hydrcma EeHHleb I I l Inmneg mm I an FIEI Slide 35 Different parts of genome have different evolutionary rates Quickly evolving regions mtDNA introns etc Slowly evolving regions coding regions ribosomal RNA etc Resolving distant relationships 9 Use slowly evolving regions 9 if use quickly evolving regions won t be able to see the forest for the trees bc of homoplasy Resolving recent divergences 9 Use rapidly evolving regions 9 if use slowly evolving regions there won t be sufficient information the fewer the differences the lower the power to resolve S39ide 36 Example Whale Phylogeny a m M Deer Hippo Pig Peccary Outgroup Outgroup H2 whales ARE artiodactyls H1 whales are sister taxa sister to hippos t rt39d tl FampH Fig144 a 39 acys a Dog SI I d e Astragalus 7 Calcaneum Navicular J Cuneiformes j CubOId i Deer Hippo Pig Peccary Outgroup requires 1 evolutionary step MOST PARSIMONIOUS I H Artiodactyi ungulate J Tibial trochlea b Nonartioidactyl ungulate Astragalar fr foramen Tibial 7 trochlea Naviculocuboid facet i Trochleated head gain of character loss of character Outgroup requires 2 evolutionary steps S39ide 38 Example Whale Phylogeny Informative molecular characters must be variable and group more 2 or more taxa PROCEDURE For each informative character find the most parsimonious tree computer algorithm considers all of the most parsimonious trees BEST tree the one with the fewest character state changes across all characters Slide 39 Gatesy et al 1999 Systematic Biology 48 620 Deer Whale Outgroup 142 AGTCCCCAAAGTGAAGGAGA AGTCTCCGAAGTGXAGGAGA AGTCCCCAXAGC TAAGGAGA AGTCCCCAAAGCAAAGGAGA AGATTCCAAAGCTAAGGAGA AGACCCCAAACCTAAGGAGA TGTCCCCAAAACTAAGGAGA AGTCCTCCAAACTAAGGAGA Example Whale Phylogeny 162166 177 CTATGGTTCCTAAGCACAAG CTATGGWCCTAAGCACGAA CTATCCTI39CCTAAGCATAAA CTATCCTI39CCTAAGCATAAA CCATT GTFCCCAAGCGTAAA CCGTT GTI39CACAAGCGTAAA CCATCATI39CCTAAGCGCA AA CCATCT ITCCTAAGCTCAAA 1 92 GAAATGCCCTTCCCTAAATA GAAATGCCCTTCCCTAAATA GAAATGCGCTTCCCTAAATC GAAATGCCCTTCTCTAAATG GGAATGCCCTTCCCTAAATC GGAATGTCCTC CCCTAAATC GA AATGCCCTTGCT TC AG TC GTTATGCCCTOCCTTAAATC FampH H9146 Slide 40 a Deer Hippo Pig Peocary Outgroup H1 whales are sister taxa to artiodactyls Requires 47 substitutions Peccary Outgroup H2 whales ARE artiodactyls sister to hippos Requires 41 substitutions MOST PARSIMONIOUS Slide 41 Transposable elements for phylogeny reconstruction Advantages no problems Since transposition is a with homoplasy rare event the likelihood of convergence is extremely unlikely Locus1234567891011121314151617181920 Cow 00000001111111111100 D951 0 0 0 0 0 0 0 1 7 1 1 1 1 1 1 1 1 1 0 0 Reversal is identifiable Whale 1 1 1 1 1 1 1 O 1 D 1 1 O 0 0 1 0 0 often accompanied by loss of part of host genome Hippo 07011110110110007100 Pig 00070000700077000111 Peocary7711 Cow Camel00000000000000000000 8111415 Deer 1012 Whale 4567 Hippo F39ig 1920 A E k Camel Slide 42 Phylogenetics in ACTION Why are certain species found in some regions of the world amp not in others PHYLOGEOGRAPHY Example Chameleons Question Are contemporary distributions of Chameleons accounted for by A dispersal by riding the pieces of Gondwana after breakup B dispersal after Gondwana breakup by transoceanic dispersal from landmass to landmass k k i 390 0 2 2 39k K K K 39k b D 392 D D 90 2 0 QC 0 O O O o q q Q a q 0 392 Raxworthyetal2002Nature415784787 0Q 39 Q q 62 5 I29 49 79 r19 0 35 o o 39b b r29 r29 00 c rob 106 a 2 rob 9 c 00 lt9 K00 9 sseswsseesseeevw Qr e 90 lt b Zr 5 lt2 09 a eov z 6 03937 3 b oq o 085 Expectation from the Gondwana True relationship among breakup hypothesis chameleon groups Slide 43 Phylogenetics in ACTION Where do diseasecausing agents come from Black plague bacterium Yersinia pestis East As39a type 3 major outbreaks 541767 AD African origin Branch lengths are proportional to the genetic distance between strains 1346early 1800 s Central Asian origin mid1800 s current Gentra39ASiantype East Asian China origin African type Presumed location of root FampH Fig 1415 Slide 44 Phylogenetics in ACTION Analysis of human phylogenetic relations Timing of the origin of the human lineage a bi Ovaryman Gorilla Chimp 8W Home W V Diarymaniiml ampmmus 16mllla Chump Home gt912 million Imago AbomS million ymogo from Ridley 2004 Evolution 2912 million years ago original molecular and revised PaleOHtOIOglcalmorph0090al paleontologicalmorphological evidence evidence Slide 8 b Gorilla Chimp Human Species tree Y Species tree 1 2 3 4 5 6 Alleles 2 3 Gene tree Ancestral species Gene tree FampH Fig 195 What is the problem with this phylogeny based on toe Lizard 5 toes Horse 1 toe Human 5 toes 5 toes represents 1 Homoplasyconvergence 2 Ancestral character 3 Derived character 33 33 33 What is the problem with this phylogeny based on presence of wings 33 33 33 Humans Birds Bats NO wings Wings Wings Presence of wings represents 1 Homoplasyconvergence 2 Ancestral character 3 Derived character 9 Slide Time AMA Ema X Older lineages insertion of a SINE at a locus shared by all the species in the MVhL clade Insertion of a SINE at f loci leading to 39incongruent39 patterns Length of time quotquotquotquotquotquotquotquot 39 7 required for a SINE I 39 to become fixed in a species I III i Fixation 510 MYA Present V SINE Species A B C Slide 45 Phylogenetics in ACTION What was the last common ancestor of all extant organisms LUCA Criteria for identifying useful gene sequence A gene must be present in all species 9 encode essential gene product therefore under strong stabilizing selection 9 otherwise drift would obliterate any signal of similarity among v distantly related taxa B gene must have remained the same in all species 9 if product shifts functions in only some species selection can cause rapid divergence and make species appear more distantly related than real ribosomal RNA 9 responsible for translation 9 a process that is under very strong evolutionary constraint Eukaryotes Slide 46 Prokaryotes Fungi Plants Monerabacteria Ammals 9 traditional 5kingdom tree of life Protists Eucarya G E b SI Animals lee ntamoe ae Ime non sulfur ArChaea molds Bacteria bacteria Euryarchaeota FUHQ39 Methanosarcina Gram Grenarchaeota Haloarchaea Plants b39ZL Etglrap S39tquote3 Methanobacterium mates Methano Thermoproteus COCCUS Cyanobacteria TOGer Flavobacteria Pyrodlctlum Flagellates Trichomonads Thermotogaes Diplomonads Microsporidia rRNA universal phylogeny 9 Most recent common ancestor of all Ilvmg organisms FampH Fig 1618


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Bentley McCaw University of Florida

"I was shooting for a perfect 4.0 GPA this semester. Having StudySoup as a study aid was critical to helping me achieve my goal...and I nailed it!"

Amaris Trozzo George Washington University

"I made $350 in just two days after posting my first study guide."

Jim McGreen Ohio University

"Knowing I can count on the Elite Notetaker in my class allows me to focus on what the professor is saying instead of just scribbling notes the whole time and falling behind."

Parker Thompson 500 Startups

"It's a great way for students to improve their educational experience and it seemed like a product that everybody wants, so all the people participating are winning."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.