New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here


by: Sylvester Mante


Sylvester Mante
Texas A&M
GPA 3.64

Gary Kunkel

Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

Gary Kunkel
Class Notes
25 ?




Popular in Course

Popular in Biochemistry

This 6 page Class Notes was uploaded by Sylvester Mante on Wednesday October 21, 2015. The Class Notes belongs to BICH 440 at Texas A&M University taught by Gary Kunkel in Fall. Since its upload, it has received 47 views. For similar materials see /class/225850/bich-440-texas-a-m-university in Biochemistry at Texas A&M University.

Similar to BICH 440 at Texas A&M




Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 10/21/15
Name Score Exam 3 BICH 440 Honors Monday November 22 2004 You MUST sign the following academic integrity statement On my honor as an Aggie I have neither given nor received unauthorized aid on this academic work Signed Write concise answers to demonstrate effectively your mastery of the subject Show your work in order to receive maxilnuln credit where applicable gas constant R 8315 molK Faraday constant F 965 k molvolt l 12 pts Draw the mechanism of Ribonuclease A You will need to show the phosphodiester backbone of the RNA substrate at the cleavage site the sidechains of the two important active site residues of the enzyme that are involved in catalysis and the movement of protons and electrons in the reaction Name 2 12 pts Draw the structures of deoxyguanosine and deoxycytidine at pH 7 when oriented in a standard WatsonCrick basepair Clearly indicate the hydrogen bonds with dotted lines 3 7 pts What is meant by the steady state assulnption in MichaelisMenten enzyme kinetics Write out the rate equation used to derive the MichaelisMenten equation that describes the steady state assulnption for a simple single substrate reaction catalyzed by an enzyme Assulne you are dealing with the initial stages of the reaction 4 6 pts Name the six general classes of enzymes according to the international classification scheme NaIne 5 12 pts Given the following doublestranded fragment of DNA 5 CCAGTTGGCGTAAAGCTGATCCCAGAGTTGATC 3 3 GGTCAACCGCATTTCGACTAGGGTCTCAACTAG 5 Using the oligonucleotide primer 5 GTTGGCGTAAAGCTGATC 3 write the sequence of ALL the DNA fragments that would be generated in each reaction after adding DNA polymerase and the following sets of nucleotides You do not have to write the sequence of the primer for each DNA fragment just write prilner a dGTP dATP dTTP dCTP 1 mM of each plus ddGTP 003 mM b dGTP dTTP dCTP 1 mM of each plus ddTTP 003 mM c dGTP dCTP dATP ddTTP 1 mM of each 6 4 pts Name two examples of ribozymes 7 9 pts Fill in the following table to differentiate paraIneters of A B and Z forms of DNA approx to axis or NaIne 8 15 pts READ CAREFULLY a Draw the catalytic triad of chymotrypsin at the stage in the mechanism where there is a covalent acyl intermediate Structures of all three amino acid sidechains ARE necessary b Then draw the steps in the mechanism for the deacylation phase hydrolysis of acyl intermediate by water In the latter steps you need only draw structures of sidechains that are directly involved in proton or electron transfers Be sure to illustrate movement of electrons in the mechanism DO NOT draw the entire mechanism just the deacylation phase If you draw the entire mechanism you will LOSE points as it infers that you do not understand the chemistry Name 9 12 pts Calculate how much in grams of enzyme X was added to generate the following data X follows MichaelisMenten kinetics Use the graph paper to plot the data to determine kinetic constants Catalytic efficiency kcat Km of X 5 X 107 M lsec391 Molecular weight of X 50000 Reaction volu1ne 100 microliters Table of V vs for X Name 10 9 pts A laboratory researcher tried to carry out a PCR aInplification of a segment of DNA but was unsuccessful Upon discussing the protocol with you the following issues became focal points For each statement below i Tell whether that step in the protocol is wrong write correct or incorrect and ii Suggest a solution if you believe the protocol was erroneous A 2 3 dideoxynucleoside triphosphates were used in the reaction 1 ii solution B The protocol used a twostep cycle varying the temperature backandforth between 50C and 72C 1 ii solution C Two oligodeoxynucleotide primers were used in the reaction that annealed to opposite strands of the DNA ii solution 11 2 pts Give an exaInple of a nonreversible enzyme inhibitor


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Bentley McCaw University of Florida

"I was shooting for a perfect 4.0 GPA this semester. Having StudySoup as a study aid was critical to helping me achieve my goal...and I nailed it!"

Kyle Maynard Purdue

"When you're taking detailed notes and trying to help everyone else out in the class, it really helps you learn and understand the I made $280 on my first study guide!"

Jim McGreen Ohio University

"Knowing I can count on the Elite Notetaker in my class allows me to focus on what the professor is saying instead of just scribbling notes the whole time and falling behind."


"Their 'Elite Notetakers' are making over $1,200/month in sales by creating high quality content that helps their classmates in a time of need."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.