New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here


by: Johnson Kozey


Johnson Kozey
GPA 3.5


Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

Class Notes
25 ?




Popular in Course

Popular in Military Science

This 30 page Class Notes was uploaded by Johnson Kozey on Thursday October 22, 2015. The Class Notes belongs to MS 10 at University of California Santa Barbara taught by Staff in Fall. Since its upload, it has received 25 views. For similar materials see /class/227074/ms-10-university-of-california-santa-barbara in Military Science at University of California Santa Barbara.


Reviews for TERROR & ASYMM WAR


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 10/22/15
E CD i gush Spreading Dead Zones and Consequences for Marine Ecosystems Robert J Diaz et al Science 321 926 2008 DOI 101126science1156401 Science The following resources related to this article are available online at wwwsciencemag org this information is current as of May 6 2009 Updated information and services including highresolution gures can be found in the online version of this article at httpwwwsciencemagorgcgicontentfull321i5891926 Supporting Online Material can be found at httpwwwsciencemagorgcgicontentfull321i5891926DC1 This article cites 38 articles 5 of which can be accessed for free httpwwwsciencemagorgcgicontentfull321i5891926otherartices This article has been cited by 17 articles on the ISI Web of Science This article has been cited by 4 articles hosted by HighWire Press see httpwwwsciencemagorgcgicontentfull321i5891926otherartices This article appears in the following subject collections Ecology httpwwwsciencemagorgcgicollectionecology Information about obtaining reprints of this article or about obtaining permission to reproduce this article in whole or in part can be found at httpwwwsciencemagorgaboutpermissionsdtl Science print ISSN 00368075 online ISSN 10959203 is published weekly except the last week in December by the American Association for the Advancement of Science 1200 New York Avenue NW Washington DC 20005 Copyright 2008 by the American Association for the Advancement of Science all rights reserved The title Science is a registered trademark of AAAS Downloaded from wwwsciencemagorg on May 6 2009 926 Spreading Dead Zones and Consequences for Marine Ecosystems Robert Diazlquot and Rutger Rosenberg2 Dead zones in the coastal oceans have spread exponentially since the 19605 and have serious consequences for ecosystem functioning The formation of dead zones has been exacerbated by the increase in primary production and consequent worldwide coastal eutrophication fueled by riverine runoff of fertilizers and the burning of fossil fuels Enhanced primary production results in an accumulation of particulate organic matter which encourages microbial activity and the consumption of dissolved oxygen in bottom waters Dead zones have now been reported from more than 400 systems affecting a total area of more than 245000 square kilometers and are probably a key stressor on marine ecosystems ication is the greening of the water column as the algae and vegetation in coastal areas grow in direct response to nutrient enrichment The most serious threat from eutrophication is the unseen decrease in dissolved oxygen DO levels in bottom waters created as planktonic algae die and add to the ow of organic matter to the seabed to fuel microbial respiration 1 Hypoxia occurs when DO falls below 52 ml of Ozliter at which point benthic fauna show aberrant behavior for example abandoning burrows for exposure at the sediment wa er interface culmi nating in mass mortality when DO declines be low 05 ml of Ozliter 2 In most cases hypoxia is associated with a semi enclosed hydrogeomor phology that combined with water column strati cation restricts water exchange More recently dead zones have developed in continental seas such as the Baltic Kattegat Black Sea Gulf of Mexico and East China Sea all of which are major shery areas Although the anthropogenic fertilization of marine systems by excess nitrogen has been linked to many ecosystem level changes there are natural processes that can lead to nutrient enrichment along continental mar 39 s that produce similar ecosystem responses Coastal upwelling zones associated with the western boundary of continental landmasses are highly productive but are associated with severe hypoxia lt05 ml Ozliter These oxygen minimum zones OMZs occur primaril in the eastern Paci c Ocean south Atlantic west of Africa Arabian Sea and Bay of Bengal and are persistent oceanic features oc curring in water column at intermediate depths typically 200 to 1000 m 3 Where they extend to the bottom the benthic fauna is adapted to DO concentrations as low as 01 ml of Ozliter This is in stark contrast to the fauna responses seen dur The visible ecosystem response to eutroph JVirginia institute of Marine Science College of William and Mary Gloucester Point VA 23062 USA ZDe artment of Ma rine Ecology University of Gothenburg Kristineberg 566 450 34 Fiskebatkskil Sweden To whom correspondence should be addressed E mail d diazvimse u 15 AUGUST 2008 VOL 321 ing recent eutrophication induced hypoxic events 39n oasta an es arine areas where DO concen trations this low led to mass mortality and major changes in community structure 2 Global Nature of Eutrophicationlnduced Hypoxia The worldwide distribution of coastal oxygen de pletion is associated with ma39or opulation cen ters and watersheds that deliver large quantities of nutrients Fig 1 and table S1 Most ofthese systems were not hypoxic when first studied but it appears that from the middle of the past c tury the DO concentrations of many coastal ecosystems have been adversely affected by eu trophication The observed declines in DO have lagged about 10 years behind the increased use of industrially produced nitrogen fertilizer that be gan in the late 19 0s with explosive growth in the 1960s to 1970s 4 For marine systems with data from the rst half of the 20th century de clines in oxygen concentrations were rst ob served in the 1950s in the northern Adriatic Sea 5 between the 1940s and 1960s in the north western continental shelf of the Black Sea 6 and in the 1980s in the Kattegat 7 localized declines of DO levels were noted in the Baltic Sea as early as the 1930s but it wasn t until the 1960s that hypoxia became widespread 7 Lo calized hypoxia had also been observed since the 1930s in the Chesapeake Bay 8 and since the 1970s in the northern Gulf of Mexico 9 and many Scandinavian coastal systems 7 Paleo indicators foraminifera ratios and organic and inorganic compounds show that hypoxia had not been a naturally recurring event in these ecosys tems 10 8 The number of dead zones has ap proximately 1 J L J J 39 1 1960s g S1 and table S1 Hypoxia tends to be overlooked until higher level ecosystem effects are manifested For ex ample hypoxia did not become a prominent environmental issue in the Kattegat until several years after hypoxic bottom waters were rst re ported and sh mortality and the collapse of the Norway lobster shery attracted attention 1 Although hypoxia in the northern Gulf of Mexico has affected benthic communities over the past several decades there is no clear signal of hy poxia in sh landings statistics 9 Ecosystem level change is rarely the result of a single factor and several forms of stress typ ically act in concert to cause change The shal low northwest continental shelf of the Black w1 other stressors including over shing and the introduction of invasive species all of which led to drastic reductions in demersal sheries Nutrient inputs declined in the 1990s hypoxia disappeared and ecosystem services recovered however nutrient inputs are again rising as agri culture expands and a return to hypoxic condi tions may be imminent 12 The key to reducing dead zones will be to keep fertilizers on the lan and out of the sea For agricultural systems in general methods need to be developed that close the nutrient cycle from soil to crop and back to agricultural soil 13 Degrees of Hypoxia The most common form of eutrophication induced hypoxia responsible for about half the known dead zones generally occurs once per year in the summer after spring blooms when the water is warmest and strati cation is strongest and lasts until autumn table S1 The usual ecosystem re sponse to seasonal oxygen depletion is mortality of benthic organisms fol 39hvn a hatnth northenn Adriatic Pomeranian Bay and the Ger man Bight Paleoindicators and models from the of commas 39 MM 2 of nutrient enrichment is a positive force in en hancing an ecosystems secondary productivity and t an m 39 mwmht 2N n and seasonal hypoxia favor only benthic species quot quot 39 39 39 hnMHf mm e of organic matter that reaches the sediments there is a tendency for hypoxia to increase in 39 ce In systems prone to persistent epletion may also er 9 cm a 3 E e in the world as well as many ftordic systems Progression of Hypoxia Coastal hypoxia seems to follow a predictable and smaller body sizes 2 Ecosystem Responses The tfect of seasonal hypoxia on biomass and REVIEW I result ofhypoxia have profound effects on eco sys em energetics an function as or 39sm r r r r b tem models for the Neuse River estuary 23 Chesapeake Bay 24 and Kaoegat 25 all show hypoxia anced diversion ofenergy ows into microbial pathways to the detriment of higher trophic levels Fig 2 Only under certain circum s es wil denersal sh predators be able to con r r 2 9 hat is not i ho hy poxia affects the habitat requirements of dif 4 m1 ofO2lita than that ofthe benthic fauna Thus v sion when hypoxia makes deeper cooler water unavailable in the summer 15 or overlaps with osition of organic matter which in turn promotes greater demand for oxygen DO levels become 39 column statue In e sec ond phase hypoxia occurs transiently accompa nied by mass mortalities ofbenthic animals With t39 er buildup of nutrients and organic matter in the sediments a third phase is initiated and hypoxia becomes seasonal or periodic char a o poxic zone expands and as the c n o continues to fall anoxia is established an microbially generated H28 is released This type of threshold response has been cumented in the Gulf ofMexico 17 ChesapeakeBay s and Danish waters 18 0 E S m an ecosystem to eutrophication is the appearance 39 E v OHypoxic system Human 39loolprinl 04 Fig 1 Global distribution oi 4007plu5 systems that have scientifically n s of being eutrophi atlunsassucl reported accou t c distribution matches the global human iootprtnt wwwsciencemagcrg SCIENCE VOL321 ated de the n or example the spawning success ofcod inthecentral 39 39 39 r V V r r39 L I L 39 y con eggs 20 Similar habitat compression occurs when sulphide is generated S m insedl39mmt In is Case benthos die microbial pathways quickly dominate enegy flows Ecologically important places such as nursery and recniitment areas suffer most from p in summer when growth Missing Biomass discontinuity layer is compressed close to the se imentw er in face deeper dwelling spe cies including the ke L39 L h l pore water chemistry 21 are eliminated The resence ofFe and Mn in the sediment may buffer the system and reduce th 3913 of hypoxia have low annual secondary produc tion and typically no benthic fauna Estimates of now pesistently hypoxic are 464000 metric tons ofcaibon MT C annually and represent 40 of total Baltic secondary production 26 Simi poisonous H28 Reduced bioturbation associ larly estimates for the Chesap e indicate ated with hypoxia also alters selim tary hab that 10000 MT C is lost because of hypoxia 39 39 39 quot 39 quot 39 each year p t Bay stotal Hence under hypoxic conditions instead ofni secondary production 27 If we estimate that trogen being removed as N2 by denitr39 tcation 40 ofbenthic energy should be passed up the monium together with phos phorus are the main fluxes out of reduced sedi ments 8 39 39 production ad Zones Their urmallzed human the Southern Hemisphere the occurrence of dead being reported Details on each system are in tables 51 an 15 AUGUST 2008 foo Chesapeake Bay 26 when hypoxic conditions prevail 106000 MT C of potential food energy sheries is lost in the Baltic and 6000 MT C in influence is expressed as a percent 41 in the Northern Hemisphere Fur zones is only recently d 52 927 Downloaded from www50iencemagorg on May 6 2009 J REVIEW 928 1 00 Mild periodic E nergy to mobile predators E nergy lo Seve re microb Seasonal Normoxia Fig 2 w 39 r 39 39 nnrinrlir hvnn i energy o preda ors ihis vh39ndiall is typically shunrlived and does n Hypoxia Perslslem H S o Anoxia typicallyZS o 75 oi c c c quot o always occur VWth declining E oxygen higherrlevel preda ion is suspended ben hic preda ion may con inue and he proporlion of bequot anoxia develops red he Chesapeake Bay respectively In areas of he nne enernv w is slill processed by oleran benthus Microbes process all ben hic energy as hydrogen sulphide and a prurg or and predao39on 29 Thus he shor er he in erval 39 39 th hypoxia ben hic biomass is reduced by as much as 14 MT 1ka 9 39 n f efficiency his is c 39 l a 39 l 17000 MT 1 of los prey o demersal fisheries made up by he ecosy em during normal condi produc ion ou side he dead zone The la er seems o occur in he Baldc where second as a resul of eutmphication 26 bu if he dead zones were elimina ed he al ic would be manta was 0 quotI mass for about a third of the Communin maturin hypoxia e ura ion of seasonal hy Fig 3 p declines to lt07 ml oi Ozliter and exlends through time mas greases 39 energy in he food chain During persis en M a production and microbes remineralize vinually all organic matter Recovery I 4 we dented n of marine sys ems had become a maior world Norrnoxia Hypoxia fac or affecting ecosys em ener gyflows 39 39 o hypoxia 34 A5 D0 s niorlalily oi bolh equir wide environmenorl problem wi h only a small frac ion 4 of he 400 plus sys ems ha had developed hypoxia exhibicing any signs of im provemen able 5 These improvemen s in o ere rela ed o reductions in hree fac ors 39 39 soadficacion s reng lc 90 he hypoxic zone on he nor hwes em con inen al shelf of he Black Sea had expanded o 40000 kmz wever since 1989 malized ecosys em funccion improved and he ben hic fauna s ar ed o recolonize bu have no recovered o prehypoxic levels In he Gulf of in an 4 39 column s ra ifica ion occurred be ween 1987 and 1994 which improved DO condi ions and facili a ed re urn ofben hic fauna 7 however wi h e e urn of s ra ifica ion condi ions have again de eriora ed In he nonhern Gulf ofMexico he occurrence and ex en of he dead zone are igh ly coupled wi h freshwa er discharge from he Mississippi from us agricul ural ac ivi ies During years wi h low river ow he area ofh oxia shrinks o lt 1 on y o increase o gt15000 kml when river flow is high 30 The man b in pu s has vir ually eliminated dead zones from several sys ems including heHudson and Eas Rivers in he Uni ed s a es an e ersey and Thames Esmaries in England 31 32 However in o her sys ems such as he Chesapeake Bay he 39 39 ha n t imnv I DO Nevenheless he managemen of sewage d pulp mill e luents has led o mal e ev sals in any s hypoxia able The key fac e enn in he de ee of ecosys em and succession escribed in Anoxia as d he Pearson Rosenberg model ofsp I 5 Emma is reached the 53m S thathave strong seasonal cycles ben hos are eliniinaled The recovery pa h from severe hypoxia is diiierenl han he pa em ofspemes lossdurmg 0 increases in pop 131139 4 4 Wh eri anion onse ly u ons axe re lated to recruitment events timed en exposed o niild hypoxia niorlalily is nioderale and he recovery pa h is closer o he r r n quotall 4 15 AUGUST 2008 VOL 321 Wh en exposed to SCIENCE wwwsciencemagorg Downloaded from www50iencemagorg on May 6 2009 MICROBIOLOGY AND MOLE 109221720608000 doi101128MMBR0001606 CULAR BIOLOGY REVIEWS Sept 2006 p 8307856 Vol 70 No 3 Copyright 2006 American Society for Microbiology All Rights Reserved Epigenetic Gene Regulation in the Bacterial World Josep Casadesusl and David Low Departamento de Gen tica Universidad de Sevilla Seville 41080 Spain1 and Molecular Cellular and Developmental Biology University of California Santa Barbara California 931062 INTRODUCTION inn FOUNDATIONS M7 Origins RM chlnmc m7 Orphan DNA MTases M am mg Cch 9114 Regulation of Cellular Events by the quot 39 39 39 DNA State 834 DNA 2 an mg DNA ADE NE METHYLATIONDEPENDENT REGULATORY SYSTEMS 838 ili mg The Pap OFF to ONphase trancitinn ma 39 for switch mmrnl M1 The Pap ON to OFFphase trancitinn M1 PapRelated Svsteme M7 PapI homologue acting as a positive regulator of pilus evnressinn M7 PapI homologue acting as a negative regulator of pilus evnressinn M PhaseVariable Outer Membrane Protein Ag43 M4 VSP Repair 245 Bacteriophage Infection RAE Regulation of DNA packaging in 39 39 P1 245 Regulation of the ore gene in 39 P1 M7 Regulation of the mom operon in 39 39 M7 Conjugal Transfer in the Virulence Plasmid of Salmonella varim M7 Regulation of traJ M39I Regulation of MP Mx Bacterial Vimlam n Mx Roles of Dam methylation in Salmonella vimlnmn Mo Attenuation of bacterial virulence by Dam methylase M Cch Methylation and Regulation of Cell Cycle in 15 Regulation of L ch 39 39 Mn Regulation of ctrA 20 CONCLUDING REMARKQ 20 ACKNOWLEDGMENTS 21 REFERENCES 21 INTRODUCTION considered epigenetic Here we review the current state of The word epigenetics is based on the Greek pre x epi denoting on or in addition and genetic meaning pertain ing to or produced from genes In the past the term epigenet ics has been used to describe the ditferentiation of genetically identical cells into distinct cell types to form tissues and organs during development of a multicellular organism In current prac tice the word is used by biologists to describe heritable changes in gene expression that occur without c anges in th DNA se quence In the strict sense epigenetic systems involve two or more heritable states each maintained by a positive feedback loop In a broader sense however any additional information superim posed to the DNA sequence eg methylation of DNA can be Corresponding author Mailing address Room 3129 Biosci 2 Building Molecular Cellular and Developmental Biology University of California Santa Barbara CA 93106 Phone 805 8936097 Fax 805 8934724 Email lowlifesciucsbedu 830 research in the eld of bacterial epigenetics with an emphasrs on systems controlled by DNA methylation which are the best known at the molecular level We refer the reader to reviews covering other aspects of DNA methylation and related topics 16 32 51 96 143 160 172 178 202 214 264 265 285 Epigenetic phenomena include prions in which protein structure is heritably transmitted 223 231 235 259 genomic imprinting characterized by monoallelic repression of mater nally or paternally inherited genes 52 84 128 195 213 histone modi cation such as methylation of lysines by histone phase methyltransferases MTases that maintain active and silent chromatin states 132 273 and DNA methylation pat terns formed as a result of inhibition of methylation of speci c DNAbases by protein binding 29 41 118 262 263 Each of these phenomena involve selfperpetuating states be they pro tein or DNA related 116 155 2307232 and the particular state that the molecule is in affects gene expression VOL 70 2006 Epigenetic regulation can enable unicellular organisms to respond ra i ly to environmental stresses or signals For ex m 39 PSI 39 a p1e the yeast prio is generated by a wnformatlonal cha e of the Sup35p translation termination factor which is then inh rited by da 1 of 3 5p ns that can provide a element that is generated and lost spontaneously at low rates and thus within a population of yeast some yeast cells will carry the prion and others will not This situation provides potential exibility in the response of the yeast population to environmental changes orchestrated through the ability of the PSI prion to act upon native Sup35p protein and convert it to prion protein 223 Me hylation of speci c DNA sequences by DNA methylr transferases provides another mechanism by which epigenetic inheritance can be orchestrated For example in certain eur kmquot a t a at S rCGrS c G sequences facilitates binding of methylr CpG binding proteins 134 156 187 In turn methyerpG binding proteins atfect the transcription state of a local DNA region through further interaction with chromatinrremodeling proteins14 L l 39 r T 39 and the methylated state is usually correlated with transcrip tional repression The methy1ation pattern of a DNA 39 39 methy1ation patr vo met 1ation during the rst mbryonic development 28 81 213 Such patterns are propagated yDNA methyltransferases o as maint e nance methylases Dnmt1 which are active on hemimethylr ted DNA substrates generated by DNA replication Thus if a A region contains methylated c G sequences they will be propagated in the methylated state Nonmethylated CpG se quences how ver are not substrates for the maintenance stages of e at understanding the mechanisms by which DNA methy1ation then established via de novo methy1ation 74 81 141 180 D A methy1ation plays important roles in the biology of bacteria phenomena such as timing of DNA replication pare 39 i of DNA generated by semiconservative replication of a fully methylated DNA molecule In the case of DNA replication t t a DNA target sites GATC sequence clustered in the origin of replir cation ch and sequesters the origin from replication initir a ion 39 ks synthesis of the which is necessary for replication initiation by GATC sites in the dnuA promoter 36 49 146 163 179 249 In DNA repair the methylrdirected mismatch repair protein MutH recognizes EPIGENETIC GENE REGULATION IN BACTERIA 831 k l Pap phase variation in uropathogenicE ccli Pap17 pilus phase variation of uropathoge i E ccli strain c1212 was vis alized With anterap17 antibodies labeledvuth 10mm colloidal gold particles T e bacterium at the le t is in the ONrphase state fo Pap17 express sionwhereas the two bacteria at the right are in the OFthase Note that these two bacteria express unmarked Pap21 pili which are also under phase variation control but are not marked With the anterapl7 agella arm mm diameter of about 20 nm can also be seen 39 DNA sites and cum the nonmethylated daughter DNA strand ensuring that the methylated parenr ta1 strand will be used as the template for repairrasmciated an ncing binding of NA target sites 144 181 219 DNA methy1ation appears to p1a similar roles in regulating Tn5 transposition 73 161 175 217 253 292 N phenomena are heritable since the hemimethylated state ofDNA is not heritable occurring transiently in newly replicated DNA enomena involving inheritance of DNA methy1ation pate 39 39 trknown examples 390 p s U39PEC cells undergo pilus phase variation which can be L l mirrnsnnnv wit antip39 us an tibodies marked with colloidal gold Fig 1 Phase variation n occur t rough a variety of genetic mechanisms involvin changes in nucleotide sequence eg siterspeci c rewmbinar tion and mutation which result in heritably altered gene ex pression 1 4 26 32 33 42 53 69 75 79 86 98 113 119 122 133 164 191 229 240 244 256 265 298 39 3 mother cell on to the daughter cells A DNA 39 39 39 39 pioieiin to asite that overlaps a methy1ation target blocking methy1ation This pattern can control gene expression if methy1ation in turn ai fecm binding of the regulatory proteins to in DNA target site which could occur by steric hindrance or alteration of DNA structure due to methy1ation 206 207 Not adhesin genes in E ccli are regulated b nisms involving DNA methy1ation patterns 32 115 116 262 832 CASADESUS AND LOW Little is known concerning how widespread epigenetic con trol is in the bacterial world and the roles that epigenetic regulatory systems play in bacterial biology including patho genesis Our main goal in writing this review is to introduce the reader to epigenetic regulatory control focusing on the main features and unique aspects of the epigenetic control systems that have been studied The list of examples discussed below can be grouped into several classes strictsense epigenetic inheritance involving heritable transmission of DNA methyl ation states to daughter cells as in the pap operon of uropatho genic E coli ii DNA methylation signals that generate dis tinct epigenetic states in DNA molecules coexisting in the same cell as in I510 transposition and in tra regulation and iii systems that are epigenetic in a broader sense since DNA methylation provides a signal for temporal or spatial control of DNAprotein interactions but does not give rise to distinct lineages of cells or DNA molecules Examples of the last class include the control of bacterial mismatch repair by DNA methylation and the coupling of promoters to distinct DNA methylation states during the cell cycle We hope that this will be useful not only in understanding experiments car ried out to date but also as a primer for future work in bacterial epigenetics FOUNDATIONS Most epigenetic systems known in bacteria use DNA meth ylation as a signal that regulates a speci c DNAprotein inter action These systems are usually composed of a DNA meth ylase and a DNA binding proteins that bind to DNA sequences overlapping the target methylation site blocking methylation of that site Methylation of the target site in turn inhibits protein binding resulting in two alternative methyl ation states of the target site methylated and nonmethylated The epigenetic regulatory methylases known in bacteria are designated orphan methylases since they lack a cognate re striction enzyme We begin by discussing restrictionmodi ca tion RM systems since they are likely the progenitors of the orphan methylases regulating epigenetic processes Indeed DNA methylation plays a regulatory role in some RM sys tems as described below Origins RM Systems DNA methylation was originally discovered in the context of restrictionmodi cation systems in which a restriction endo nuclease recognizes a speci c target DNA sequence unless that sequence has been methylated by a cognate DNA methyltrans ferase 5 27 39 153 220 260 Three main groups of RM systems types I II and III have been described based on whether the restriction and modi cation activities are within a single polypeptide types I and III or separate polypeptides type II and on whether the restriction enzymes cut at a site close to types II and III or far from type I the methylation target sequence 185 221 236 238 284 It has been postu lated that RM systems evolved as a form of cellular defense targeting incoming viral and other foreign DNA sequences for degradation Note that foreign DNAs would not be methylated at the appropriate target sites unless that sequence was derived from a bacterium with a cognate methylase of the same spec MICROBIOL MOL B101 REv i city 6 77 In these systems the restriction enzyme and cognate methylase are both expressed at levels that allow com plete methylation of the genome suf cient to block double strand DNA cleavage by the restriction enzyme a potentially fatal event Incoming foreign DNA is ef ciently destroyed since the restriction enzyme has the upper hand over the meth ylase for the DNA to survive every restriction site it carries would have to be methylated before even a single site is cleaved by the cognate restriction enzyme an unlikely event Work by Kobayashi and colleagues has suggested that RM systems have attributes of sel sh genes 1487150 Nakayama and Kobayashi showed that a plasmid containing the type II RM EcoRV system could not be displaced from cells by an incompatible plasmid due to the death of cells that lost the EcoRVcontaining plasmid a form of postsegregational killing 186 In cells lacking the RM gene complex the levels of methylase and cognate restriction enzyme drop to a point where insuf cient methylase is present to protect all chromo somal target sites the restriction enzyme then cleaves one or more sites killing the cell This scenario is similar to that for addiction modules such as hokSok in which 50k gene expresses an antisense RNA that inhibits translation of the hok toxin ene When cells lose a plasmid containing hokSok they die since hok mRNA is stable but 50k RNA is unstable halflife tl lt30 s translation of hok ensues which leads to cell death 91 92 Other addiction modules are made of two proteins a toxin and an antitoxin 82 90 106 Further analysis of the EcoRV system has shown that a regulatory gene designated C sandwiched between the R and M genes codes for a product that activates R gene ex pression 186 The C gene appears to be required for expres sion of the R gene since postsegregational killing does not occur in C gene mutants One function of the C gene is in establishment of an RM system in a new host In this case the M gene is immediately activated allowing modi cation of host DNA sites At the same time C gene expression is also acti vated building up the C protein level to a point that allows activation of R gene expression This temporal delay in expres sion of the restriction enzyme is critical in allowing time for all chromosomal sites to be methylated and protected from diges tion In addition C also functions as a suicide immunity gene forcing expression of the R gene of an incoming closely related RM complex with different restriction speci city resulting in host cell death This would be expected to prevent spread of a competing RM complex of the same C gene immunity group any RM complex in which the resident C protein activates expression of an incoming R gene within a bacterial popula tion 250 A second regulatory strategy used by RM systems utilizes methylation of the cognate restriction site to control RM transcription via a direct effect on RNA polymerase binding For example in the CfrBI system of Citrobtzcter eundii meth ylation of a cytosine underlined within the 5 QCATGG3 DNA restriction site decreases expression of the CfrBI meth ylase CfrBIM and concomitantly increases expression of the CfrBI restriction enzyme CfrBIR 18 294 This appears to occur as a result ofthe location ofthe c 39BI site within the 35 RNA polymerase 03970 binding site of the c 39BIM gene Since the c 39BIM promoter is stronger than that of c BIR any bacterial VOL 70 2006 cell receiving the CfrBI system will be methylated before re striction can occur As the intracellular methylase level in creases the c 39BI site is methylated decreasing expression of e BIM and enabling expression of cfrBIR The latter may pro tect the cell from incoming foreign DNA lacking methylated sequences A third RM regulatory mechanism utilizes the methylase itself as a feedback regulator In a number of cases binding of the methylase to DNA occurs via an Nterminal extension containing a helixturnhelix motif 142 196 197 For exam ple in the SsoII RM system of Shigella sonnei the SsoII methyltransferase SsoIIM represses its own synthesis and stimulates expression of the cognate restriction endonuclease SsoIIR Similar Nterminal extensions are present on a num ber of 5methylcytosine methyltransferases including those in the EcoRII dcm MspI and LlaJI systems 142 The last system present in Lactocoecus lactis encodes two methylases M1LlaI1 and M2LlaI1 recognizing the complementary and asymmetric sequences 5 GACGC3 and 5 GCGTC339 re spectively with methylation of the internal cytosine in each case Two Lla I restriction sites are present 8 bp apart within the regulatory region of the llaJI operon with one site over lapping the i35 RNA polymerase 03970 recognition site of the operon Notably methylation of both 539GCGTC339 sites by M2LlaI1 enhances binding of M1LlaI1 repressing transcrip tion of the llaJI operon The ability of the M1LlaI1 methylase to distinguish methylated and nonmethylated target sites pro vides a feedback mechanism by which expression of the llaJI operon is controlled by DNA methylation The analysis of regulation of the EcoRV CfrBI and LlaJI RM systems described above has provided insight into the evolution of epigenetic control systems that are predominantly controlled by orphan methyltransferases including DNA cy tosine methylase Dcm 202 in E coli It has been postulated that orphan methylases such as Dcm may have arisen by se lection as vaccines against invasion of a restrictionmodi ca tion complex 250 In the case of Dcm which methylates the duplex sequence 5 CCWGG3 top strand shown W A or T at the rst cytosine this methylation protects against cleav age by EcoRII It was shown that postsegregational killing by the EcoRII RM complex was diminished by the presence of dcm 250 which partially protected host chromosomal DNA from restriction attack This function of Dcm as a possible molecular vaccine may be analogous to the function of cytosine methylation in certain eukaryotes including mammals where methylation has been postulated to inactivate transposons 293 although this hypothesis has been challenged 30 Dcm is not known to be involved in gene regulatory control How ever the other orphan methylase in E coli DNA adenine methylase Dam with homologues in other Alphaproteobac teria does play an essential role in regulating epigenetic cir cuits As well Gammaproteobacteria have a cell cycleregulated methylase Cch which plays a major role in the control of c romosome replication and regulates expression of certain genes In the next section we describe the biochemical prop erties of these DNA methylases and additional components of epigenetic switches before discussing speci c epigenetic sys tems in detail EPIGENETIC GENE REGULATION IN BACTERIA 833 Orphan DNA MTases Dam Dam of E coli is classi ed in the 01 group of DNA MTases based on the organization of 10 domains 167 The E coli dam gene accession no J01600 is 834 bp and codes for a 32kDa monomeric protein 114 Dam homologues are present in Salmonella spp Haemophilus in uenzae and addi tional gramnegative bacteria 16 204 254 Dam binds to DNA nonspeci cally as a monomer moving by linear diffusion and speci cally methylating 5 GATC3 sequences At GATC sites the adenine base is ipped out 180 into the active site of the enzyme where it is stabilized by hydrophobic stacking with a tyrosine in the DPPY motif which is conserved among ad enine methyltransferases 123 157 The methyl group donor SadenosylLmethionine AdoMet is required for stable binding of the ipped adenine in the activesite pocket of the enzyme and binds to Dam after the methylase binds DNA transferring a methyl group to the exocyclic N6 nitrogen of adenine 261 AdoMet binds to two sites in the Dam protein one is the catalytic center and the other seems to be involved in an allosteric change that may increase speci c binding of Dam to DNA 22 Dam appears to methylate only one of the adenosines of duplex GATC DNA sequence at a time 261 Notably Dam shows high processivity for most DNAs that is after one methylation event it slides on the same DNA mol ecule and carries out additional methylation events tum overs This high processivity effectively increases the rate of Dam methylation and may re ect the fact that there are few lt 100 Dam molecules present in a single E coli cell yet there are about 19000 GATC sites to methylate Dam levels vary according to growth rate as a result of increased transcription from one of ve dam gene promoters designated P2 158 Based on the estimated numbers of Dam and GATC target sites per cell each Dam molecule modi es between 20 and 100 GATC sites per minute km 261 This number is about 100fold higher than the turnover number observed in vitro using an oligonucleotide substrate with one GATC site indi cating that there is likely some differences in vivo that en ables Dam to be more ef cient at methylation 261 One possibility suggested by Urig et al 261 is that Dam is asso ciated with the DNA polymerase III machine scanning DNA for GATC sites as DNA replication proceeds and thus meth ylating DNA much more ef ciently than it would in a random walk The processive nature of Dam contrasts sharply with DNA methylases associated with RM systems such as the EcoRV methylase MEcoRV which methylates its GATATC recog nition sites distributively 95 In this case and for other RM stems incoming DNA needs to be restricted cut by the restriction enzyme before every site is methylated The restric tion enzyme has the advantage since if just one restriction site in an incoming phage genome is left unmodi ed the enzyme can cleave the DNA and block its replication Note that re striction could be hampered if RM DNA methylases were highly processive like Dam processivity would increase the chances that all restriction sites in an incoming phage for example would be modi ed before restriction could occur Other gramnegative Gammaproteobaeteria besides E coli including Salmonella spp Serratia marcescens Yersinia spp Vibrio cholerae Haemophilus in uenzae and Neisseria menin 834 CASADESUS AND LOW gitidis code for orphan MTases with signi cant sequence iden tity to EcoDam and which target adenosine of the G TC DNA sequence 162 Although Dam is not essential for growth of E coli and Salmonella on laboratory media 14 172 254 the Dam homologues in Yersim tz pseudoluberculosis Yer Sim39a enterocolitictz and Vibrio cholerae are essential gene prod ucts 135 However a strain of Y pseudoluberculosis in which dam mutations are viable has been described 252 It is not known what essential functions Dam plays in the pathogens in which it is essential but it is provocative that both Yersim tz and Vibrio contain two chromosomes in contrast to the single chromosomes in E coli and Salmonella spp where Dam is not essential A speculation is that Dam may be essential to co ordinate DNA replication in bacteria with two or more chro mosomes 78 Dam homologues without a restriction enzyme counterpart are also present in bacteriophages including Sulfolobus neoz ealandicus dropletshaped vims 7 halophilic phage Chl 15 H in uenzae phage HP1 204 phage P1 61 phage T1 9 and phage T4 226 The last MTase T4Dam has been well characterized biochemically primarily by Hattman and colleagues 123 228 T4Dam like EcoDam is highly proces sive 169 and complements a dam mutant E coli mutator phenotype 226 T4Dam and EcoDam may have a common evolutionary origin sharing up to 64 sequence identity in four different regions 11 to 33 amino acids long 105 After methylation with resulting formation of SadenosylLhomo cysteine AdoMet binds to T4Dam without dissociating from the DNA duplex 299 Like EcoDam T4Dam appears to ip out the adenosine of GATC sequence facilitating its methylation 168 Cch The cell cycleregulated DNA MTase family Cch constitutes a second important group of orphan methyltrans ferases classi ed in the B group of MTases and originally identi ed in Caulobtzcter crescentus 167 242 300 Cch binds to and methylates adenosine in the sequence 5 GANTC 339 where N is any nucleotide 167 300 Like EcoDam Cch is a functional monomer and acts processively 20 although evidence suggests that it is a dimer at physiologic concentration 234 However unlike EcoDam Cch has a distinct prefer ence for hemimethylated DNA as a substrate based on the observation that the turnover rate for hemimethylated DNA containing a GANTC target sites was signi cantly higher than that for DNA containing nonmethylated sites 20 Cch binds to and methylates adenosine in the sequence 539 GANTC339 where N is any nucleotide The GANTC se quence is also the target of HinfM methylase which shares 49 identity with Cch and whose cognate restriction enzyme Hinfl from H in uenzae cuts at nonmethylated GANTC sites 300 In Caulobtzcter Cch is an essential cell component and plays a crucial role in cell cycle regulation 20 139 170 214 216 242 243 300 Cch homologues which are likewise essential have been found in Agrobacterium tumefaciens the causative agent of crown gall disease in plants 137 in Rhizo bium meliloti the nitrogen xing symbiont of alfalfa and other legumes 286 and in the animal pathogen Bmcelltz abortus 222 In B abortus aberrant Cch expression impairs the pathogens ability to proliferate in murine macrophages rais MICROBIOL MOL B101 REv ing the possibility that Cch methylation might control the synthesis of virulence factors 222 Regulation of Cellular Events by the Hemimethylated DNA State Following passage of the DNA replication fork in E coli GATC sites methylated on the top and bottom strands in a mother cell denoted as fully methylated are converted into two hemimethylated DNA duplexes one methylated on the top strand and nonmethylated on the bottom strand and one methylated on the bottom strand and nonmethylated on the top strand due to semiconservative replication Fig 2A Most GATC sites are rapidly remethylated by Dam and exist in the hemimethylated state for only a fraction of the cell cycle Fig 2A Exceptions are the DNA replication origin oriC the dmzA promoter and possibly additional GATC sites in the chromo some which bind Squ 60 Squ preferentially binds to clus ters of two or more hemimethylated GATC sites spaced one to two helical turns apart Fig 2B In the case of oriC which contains a cluster of 13 GATC sites sequestration delays re methylation and prevents binding of the DnaA protein which controls the initiation of DNA replication At other sites bind ing of Squ tetramers to hemimethylated GATC sites may organize nucleoid domains 100 Notably the transcription pro le of an E coli Squ mutant was found to be similar to that of a Dam overproducer strain Based on this observation a model was developed in which Dam and Squ compete for binding to hemimethylated DNA generated at the replication fork 159 The halflife of hemimethylated GATC sites not bound by Squ has been estimated to be between 05 and 4 min based on analysis of synchronized E coli cells and monitoring the methylation status with restriction enzymes Dpnl which cuts fully methylated GATC sites Mbol which cuts fully non methylated sites and Sau3Al which cuts GATC sites regard less of methylation state 50 In contrast analysis of the origin of replication in the colicinogenic plasmid ColE1 indicated that remethylation of hemimethylated GATC sites occurs within a few seconds of passage of the replication fork 241 Notably remethylation appeared to occur asynchronously with methylation at GATC sites on the leading replication arm occurring more rapidly than GATC methylation on the lagging arm about 2 seconds versus 4 seconds suggesting that re methylation on the lagging arm occurs after ligation of Oka zaki fragments The reason for the discrepancy in estimation of the halflife of GATC sites is unclear but could re ect differ ences in chromosomal versus plasmid replication For chromo somal replication the DNA polymerase III replication machin ery is stationary bound to the cytoplasmic membrane with DNA moving through it 154 179 It is possible that Dam is present in a complex bound near the origin methylating nas cent DNA sequences as they arise The presence of hemimethylated GATC sites provides a signal that DNA replication has just occurred and plays a role in diverse cellular processes For example in methyldirected mismatch repair the MutH protein binds to nonmethylated GATC sites and cleaves the nonmethylated DNA strand en suring that mutations in the daughter DNA strand are repaired using the parental strand as a template In the absence of Dam VOL 70 2006 EPIGENETIC GENE REGULATION IN BACTERIA 835 A 0 0 4 gt Dam 4 Rapid I FIG 2 Generation methylated until DN r alt strand Within a short time GATC site BTw R a F A n n rm two after replication t Dam m thyla to methylate the hemimethylated DN protein binding sites 1n some but not a ca state in e hrstgeneration and lea ing to on the top strand is shown at the right MutH can cleave the daughter strand the parental strand or both DNA strands 1f the cell survives doubleestrand breakage 50 of the time the mutant daughter as a template to repair the parental strand resultm xation of a mutation into the DNA 172 28 ated GATC Sites are also used to 00mm rates of trans Ition of insertion sequences 133 131 0 1350 and 13903 as well as transposons Tn5 Tn10 and Tn903 73 17 2 wed 19 292 Elegant studies from Kleckner39s laboratory sho 39 y e transposase promo er plN 00m posase gene Full methylation of the GATceos inhibis RNA ymerase binding reducing the level of my 131 tion A second GATC site at hp 1320 to 1323 GATC71321 near the inner terminus of 1310 controls binding of 131157 pos ull methylation of GATC71321 blocks transposition by inhibiting transposase binding These two effecs of DNA methy a n ansposase expression and binding effectively limit 1310 transposition to a brief period immediately following DNA replication when GATCV68 and GA 39 TC71321 are hemir a W a a S w 5 9s at a 5 o 3 more active than 1310 ontem late strand and 1000 times more active than fully methylated 1310 219 The majority of this tion a u As generating fully methylated DNA ll ses protein binding blocks a m E 00 are fully he top strand and one methylated on the bottom m i t a less than 5 min Dam methylates the nonmethylated GATC site regenerating a fully methylated l r r h 11 l D H Dam c Certain GATC sites are present Within or adjacent to regulatory DNA methylation over the entire cell cycle stabrlrzrng the hemimethylated f r the DNA methylated difference is due to increased binding of transposase at the inner 1310 terminus in addition activation of the transposase promoter is more 39 whose transposition following DNA replication is less e icient than for 1310 219 Like that of Tn10 transposition of 1350 and of Tn5 is slime ulated by DNA replication 175 GATC sites are present within the inside end B of 1350 similar to the case for 1310 and within t e e 10 region of the transposase regu atory region 73253292 In both 1350 and Tn5 Dam methylation res presses mp promoter activity an posase binding to the 1350 E 73 253 292 1ncreased transposition of 1350 and Tn5 in a Dam host requires integration host factor LHF prob ably to compensate for a DNA conformational defect asmcir ated with the lack of Dam 165 In turn binding of Fis factor for inversion stimulation to the IE inhibis 1350 tr 39 39 ognition sequence inhib39 is us immediately owing DNA replication Fis binds to the IE inhibiting 1350 tr ition and counteracs the positive effecs of the hemie methylated state on 1350 transpos tional genes that contain GATC sites within their promoter regions The list includes gm suZA trpS trpR and ryrR of E 836 CASADESUS AND LOW coli and cre ofbacteriophage P1 16 172 205 246 Expression of these genes was increased in the absence of Dam suggesting that GATC methylation may decrease binding of RNA poly merase The possible physiologic signi cance of methylation of these sites is not known but it could tie gene expression to the replication state of the cell increasing transcription immedi ately after passage of the replication fork In the case of the trpR gene which encodes the repressor of the tip operon an attractive speculation has been proposed by M G Marinus because trpR is located between the origin of replication and the hp operon a transient boost in trpR transcription might provide the increased concentration of repressor necessary to maintain repression when chromosome replication doubles tip operon dosage 171 DNA Methylation Patterns About 16 years ago Blyn et al discovered that one of two GATC sites within the regulatory region of the chromosomally encoded pyelonephritisassociated pilus pap operon of uro pathogenic Escherichia coli UPEC was heritably nonmethyl ated depending upon the pilus expression state of the cells 34 When DNA was isolated from cells expressing pyelone phritisassociated pili Pap pili ONphase cells it was found that a GATC site proximal to the pap pilin promoter was methylated whereas the promoterdistal GATC site was non methylated This DNA methylation pattern characteristic of ONphase cells differed from that of OFFphase cells which contained the converse pattern where the GATC site proximal to the pap pilin promoter was nonmethylated and the promoter distal GATC site was methylated The term nonmethylated is de ned here as a state in which the GATC target of DNA adenine methylase is not methylated on either the top or bot tom DNA strand constituting a DNA methylation pattern analogous to those observed in mammalian cells 34 Since the term unmethylated might imply that an active demeth ylation has occurred we prefer use of nonmethylated to describe DNA lacking a methyl group on both the top and bottom DNA strands The phenomenon of demethylation which occurs in euka otes to reset the DNA methylation pattem after zygote formation 88 147 has not been reported to occur in prokaryotes DNA methylation patterns are formed in bacteria by binding of a proteins at a DNA sites over lapping or near a GATC sites preventing methylation of that sites throughout the cell cycle 2C A direct role for DNA methylation patterns in the heritable control of gene expression in bacteria was rst shown in the Pap system 41 Further analysis of DNA methylation patterns in E 601139 showed that multiple GATC sequences ca 36 sites in the genome of E coli K12 which lack pap DNA sequences were stably nonmethylated 218 272 These sites were identi ed by digestion of chromosomal DNA with Mbol which cuts at non methylated GATC sites Since nonmethylated GATC sites are rare the DNA fragments generated by Mbol digestion are too large to be resolved by conventional agarose gel electrophore sis Pulsed eld gel electrophoresis was used to resolve these fragments however the DNA sequences anking the non methylated GATC sites were not determined Ringquist and Smith 218 also showed for the rst time that a number of MICROBIOL MOL B101 REV Dcm target sites CQATGG the second cytosine is methyl ated at the C5 position were stably nonmethylated Wang and Church analyzed Dam DNA methylation patterns to assess the binding of proteins to chromosomal DNA sites Chromosomal DNA was digested with Mbol and Clal and cloned into pBluescript which enabled the nonmethylated GATC sites to be sequenced 272 Since binding of proteins such as catabolite gene activator protein CAP is dependent upon environmental conditions via the secondary regulator cyclic AMP cAMP DNA methylation patterns within the regulatory regions of genes bound by cAMPCAP and other regulatory factors were found to be environmentally controlled 218 251 For example a GATC sequence within the regula tory region of the car operon controlling carbamoyl phosphate synthetase and involved in arginine and pyrimidine anabolism was found to be protected from Dam methylation 272 This nonmethylated GATC site and others are listed in Table 1 with the chromosomal position bp 29444 for the GATC near the carA gene in E coli MG1655 a K12 isolate also shown No protection of the car GATC site was detected in the ab sence of pyrimidines consistent with the hypothesis that a pyrimidine repressors binds to the car promoter region near or overlapping the GATC site protecting it from methylation lndeed CarP and lHF were shown to bind in the regulatory region of carLB and protect GATC207 Table 1 from meth ylation 54 Another nonmethylated GATC site identi ed was in the gut also known as srl operon controlling uptake of the alcohol sugar glucitol bp 2823768 A binding site for CAP was iden ti ed near the nonmethylated GATC site located at 445 GATC445 relative to the transcription start site 263 sug gesting the possibility that binding of CAP to the gut promoter blocks methylation ofthe GATC 445 site note that in Table 1 this GATC site is 86 bp upstream of the AUG start site for gutA and is thus labeled 86 Analysis of DNA methylation in E 601139 containing a deletion of the CI gene coding for CAP showed that methylation protection of the GATC445 was reduced from 95 in 010 cells to 50 in Amp cells These data supported the hypothesis that CAP contributes to meth ylation protection of GATC445 in vivo However further analysis of the gut operon showed that although cAMPCAP binds to sites overlapping GATC445 CAP does not protect this site from Dam methylation 263 Instead the GutR re pressor which also binds at GATC445 blocks methylation of this site both in vitro and in vivo GutRdependent protection of methylation of GATC445 in vivo was not observed in the presence of glucitol an activator of gut transcription indicating that under these conditions GutR was no longer bound at GATC445 allowing methylation of this site by Dam How ever methylation of GATC445 did not affect binding of GutR to the gut regulatory region These results led to the conclusion that although methylation protection indicates the presence of a DNA binding site in vivo the absence of meth ylation protection of a GATC site does not prove the absence of binding of a protein at that site 263 Wang and Church also identi ed nonmethylated GATC sites within the Mt mannitol bp 3769597 cdd deoxycytidine deaminase bp 2229798 h agellar synthesis bp 1976481 psp stress response bp 1366007 and fep iron transport bp 621523 operons 272 Using a similar approach in which VOL 70 2006 EPIGENETIC GENE REGULATION IN BACTERIA 837 TABLE 1 Nonmethylated GATC sites in the E coli K12 chromosome Location bp z Sequenoeb Genetic arrangement Memgiitgi kzggcmng Referenoes 29444 AGGTTAGATGATCTTTTTGTCG 1E1 GATC 7207 Ca CarP IHF 54 55 272 141293 GTGATGGACGATCACACATGTT g 7 68 GATC 7 126 gt CAP 290 344410 ATAAAAAATGATCTCATGCAGA yn GATC 7 188 ym 25 1 621523 TCCAAATAAGATCGATAACGAT fan 7 40 GATC 770 yml Fur 233 765198 AGTGAAATTGATCACATAATGG fm 7 102 GATC 7 8 ha Fnr 25 1 1099422 AATAAGTCTGATCTACGTCACT y GATC 7 49 ym CAP 251 1168245 TTAGTTATCGATCGTTAAGTAA yaTQ 7 114 GATC 7 51 y CAP 251 1366007 CTTCAATCAGATCTTTATAAAT pm 7 58 GATC 796 p534 IHF 272 275 1653241 GCTTTTTTCGATCTTTATACTT r3174 776 GATC b z 99251 272 1859455 TAAAACGCAGATCATTATCTGT b 799 GATC b 7 99 251 1976481 CGTGATGCAGATCACACAAAAC fly 7 102 GATC 7 8 WE CAP 251 272 YR GTTTATATCGATCGATTAGCTA 2229798 TGAGATTCAGATCACATATAAA y0gthK GATC 7 66 Cat CAP 120 251 272 2599026 ACTTCTCGTGATCAAGATCACA ha 776 GATC 7156 kW CAP 251 2823768 TCATTTTGCGATCAAAATAACA at GATC 7 8 6 Sm GutR 99 251 272 3490085 GGTGATTTTGATCACGGAATAA pm 7139 GATC 7134 yWC Lrp CAP 99 192 251 3638351 TAACCAGATGATCACACTAATG GATC 7143 yhiP Lrp 99 251 3740362 TTAAAAAGTGATCGATATATTT ygf 7 125 GATC 779 y 251 3769597 TGTGATTCAGATCACAAATATT ym 7228 GATC 7310 quot31 CAP 99 212 251 3873122 TACAATTTAGATCACAAAAAGA ylngW 7147 GATC 7 190 ya 251 4071313 TCTGTTTTTGATCGTATTTGTA y U 770 GATC 795 y 251 4099262 TGTGGTTTTGATCACTTTTATT Sm GATC 799 kdggtT Fnr 251 4328080 TGTGAAGTTGATCACAAATTTA ya GATC 7215 pm CAP 251 289 4346646 GATTAATCTGATCTACCCATTT 1m 7324 GATC W70 IHF 251 4537512 GTTATACCAGATCAAAAATCAC will 7 43 6 GATC 7 17013 fl NanR 239 4538525 AAATATGTCGATCTTTTTCTAA NagC 239 ijA 7499 GATC 7950 z 1 Location in the E ml K712 strain MG1655 chromosome Analyses were carried out using Pattern Search and Fragment Viewer in ColiBase httpColibase bhamacu b GATC sites protected from methylation are shown in boldface with 9 base pairs of anking sequence on each side C The distance from the G in GATC to the A of the start codon for a particular gene is shown in base pairs For regions where divergent transcription occurs the distances to both genesopen reading frames is shown in ase pairs 4 Regu proteins known to protect methylation of a speci c GATC site based on in vitro methylation protection are shown in boldface Other potential methylationrblocking proteins are shown based on indirect ta such as resenoe of a consensus regulatory protein binding site observation of protein binding near T sequence or increased methylation of a GATC site observed in a regulatory mutant of E w x nonmethylated GATC sites in the E coli chromosome were cloned by digestion with MboI and Aval Hale et al identi ed four nonmethylated GATC sites in the regulatory regions of theppiA bp 3490085yhiP bp 3638351 rspA bp 1653241 and 171776 bp 1859455 genes 99 Protection of the ppm GATC site was dependent upon growth phase and carbon source Protection of a GATC site near yhiP required leucine responsive regulatory protein Lrp and was leucine respon sive similar to the case for some operons controlled by this global regulator 44 68 188 189 The other GATC sites were protected under all the environmental conditions examined mr A 39apprac to39 39 39 onon methylated GATC sites was undertaken by Tavoizoie and Church 251 this approach allowed 12 additional sites to be identi ed all of which were located within 5 39 noncoding re gions of genes and open reading frames Table Recent work by Blom eld s group on m regulation control ling type 1 pili has identi ed two nonmethylated GATC sites at bp 4537512 and 4538525 in the E coli chromosome near yjhA that are stably nonmethylated separated from the m locus by 14 kilobase pairs 80 These GATC sites are located near cisactive element regions 1 and 2 both of which play positive roles in transcription of the mB recombinase gene control ling type 1 pilus phase variation together with Fim Binding of two regulatory proteins the NanR sialic acidre sponsive regulator and Nag the N acetylglucosaminere sponsive regulatory protein is required to activate mB ex pression Binding of NanR to region 1 blocks methylation of 838 CASADESUS AND LOW one adjacent GATC site and binding of NagC to region 2 blocks methylation of the second GATC site Only a fraction of the two GATC sites are nonmethylated after growth in glycerol minimal medium 239 Methylation protection of these GATC sites is not observed after addition of sialic acid also known as N acetylneuraminic acid This likely occurs via in hibition of NanR binding which is sensitive to sialic acid and inhibition by NagC via binding of Nacetylglucosamine6phos phate generated by sialic acid catabolism Thus binding of NanR and NagC controls methylation of two GATC sites ad jacent to yjhA likely by steric hindrance of Dam However mutation of the GATC site adjacent to region 1 did not affect mB expression 239 indicating that methylation of this GATC site does not in turn modulate NagC binding More over in a dam mutant expression of mB is decreased the opposite of what would be expected if GATC methylation inhibits NagC and NanR binding These results indicate that the reported regulation of m expression by Dam 199 does not occur via methylation of the GATC sites located near regions 1 and 2 adjacent to m In summary a small fraction of the approximately 20000 GATC sites in the E coli chromosome are totally or partially nonmethylated in any given growth state and environmental condition The protection of GATC site methylation by Dam is dependent upon competition between Dam and speci c DNA binding proteins Dam appears to methylate most GATC sites in a highly processive manner as discussed above Recently however analysis of methylation of the regulatory GATC sites in the pap operon indicates that they are not methylated pro cessively 32 That is Dam binds topap DNA7 methylates one GATC site and then dissociates before methylating the second site This effectively reduces the ability of Dam to compete with proteins that bind to DNA sequences containing one or more GATC sites Bergerat et al rst proposed that DNA sequences surrounding GATC sites may dictate the avidity of Dam for its target sites 23 Mutation of the ATrich anking sequences of the pap GATC sites to CG sequences increased processivity which appeared to be due to changes in the kinetics of methyl transfer and not in binding af nity 203 Analysis of known nonmethylated GATC sites tentatively suggests a trend toward having ATrich anking sequences though this is not always the case Table 1 Since DNA methylation patterns are formed as a result of binding of proteins primarily at gene regulatory regions they are altered by growth conditions that affect regulatory protein levels andor DNA binding properties As discussed above identi cation of nonmethylated GATC sites has been used as a sort of natural in Vivo footprint system to track binding of regulatory proteins under different environmental conditions 251 272 In addition it is clear that a subset of nonmethyl ated GATC sites for example within the pap Sftl dtltl agn43 and other operons see below play important roles in epige netic regulation In these systems not only is a DNA methyl ation pattem established by protection of speci c GATC sites by a regulatory proteins but methylation of the GATC sites in turn modulates regulatory protein binding 263 This results in two heritable states either the regulatory pro tein is bound to a speci c DNA sequence containing a GATC sites protecting it from methylation or the regulatory pro tein is not bound due to a reduction of binding af nity for MICROBIOL MOL B101 REV target sequences caused by GATC methylation Clearly only a subset of all nonmethylated GATC sites have these particular properties and are involved in epigenetic control systems For example as shown in Table 1 DNA methylation patterns have been shown to directly control expression of agn43 111 271 but do not control thegut er operon 263 and do not appear to directly regulate m 239 Further study will be necessary to determine if any of the other genes containing nonmethylated GATC sites in their regulatory regions are under methylation pattern control Table 1 DNA ADENINE METHYLATIONDEPENDENT REGULATORY SYSTEMS In the sections below we describe the current state of knowl edge regarding how DNA methylation controls bacterial gene expression Our focus for each methylationcontrolled operon is on aspects of regulation affected by methylation and not on complete descriptions of regulatory networks Pap Pili Pyelonephritisassociated pili play an important role in at tachment of UPEC to uroepithelial cells lining the upper uri nary tract facilitating colonization of the kidneys Pap pilus expression switches on and off within individual cells in the bacterial population a process known as phase variation The biological role of Pap pilus phase variation is not known but possibilities include escape from immune detection ii facilitation of a bindreleasebind series of events in w ic successive generations of bacteria ascend the urinary tract and iii controlling growth of UPEC by modulating the effects of contactdependent growth inhibition a newly described bacte rial phenomenon nNA 39 39 m 1 pd by math ylation of two GATC sites one proximal to the pap pilin pro moter GATCP quot located 53 bp from the papBA transcription start site and the other located 102 bp upstream of GATCPmquot designated GATCdiSt 3A Note that these two GATC sites are located within Lrp DNA binding site 2 and site 5 respectively Methylation at these two pap GATC sites controls the binding of the global regulator Lrp 44 189 and the coregulatory protein Papl 118 138 to pap DNA sites 1 2 and 3 proximal to the papBA pilin promoter and to sites 4 5 and 6 distal to papBA Lrp appears to bind cooperatively to sites 1 2 and 3 or to sites 4 5 and 6 193 Binding to all six sites can be achieved in Vitro by addition of suf cient Lrp but rarely occurs in Vivo based on anal ysis of the methylation states of GATCP ox and GATC St 41 In ONphase cells GATCdist is nonmethylated and GATCprox is methylated 41 3D Protection of GATC St from Dam methylation requires both Lrp and Papl based on the observation that GATCdiSt is fully methylated in either an I or a pap mutant 40 41 In contrast OFFphase cells display the converse DNA methylation pattern in which GATCprox is nonmethylated and GATC St is methylated 3A Protection of GATCPmquot re quires Lrp but not Papl 41 263 Based on these in Vivo DNA methylation pattems together with in Vitro studies of Lrp binding it was concluded that in ONphase cells PaplLrp binds to sites 4 5 and 6 protecting GATCdiSt from Dam and in OFFphase cells Lrp binds to sites 1 2 and 3 protecting GATCprox from Dam VOL 70 2006 EPIGENETIC GENE REGULATION IN BACTERIA 839 papp GATcd S GATCW papBAp A Lrpsite 4 5 612 3 D FIG 3 TheD r W p mechanism h p h at the topwrth sntDNAblnding sites for dlluu Tcas Within r u n I A romoters are shown wrth arrows Lrp ovals PapI triangles and PapB diamonds are shown The methylation states of the top and bottom DNA strands ofa GATC t a r t a by an open I th I t a or closed I th I t a T F FetonN swrtch is described in the text 41 These DNA methylation patterns result from competition The Pap OFF to ONphase transition In Fig 3A lower between Dam and Lrp for binding at sites 1 2 and 3 and at sites section pup regulatory DNA with the OFFephase DNA math 4 5 and 6 containing GATCW and GATcdm respectively as ylation pattern is depicted GATcvim is fully methylated and discussed in detail below GATCPM is fully nonmethylated as a result ofbinding of Lrp 840 CASADESUS AND LOW at pap sites 1 2 and 3 overlapping GATCPmquot Transcription from papBA is blocked by binding of Lrp at sites 1 2 and 3 overlapping the promoter likely as a result of steric hindrance of RNA polymerase binding 278 The OFFphase state is stabilized by two main factors mutual exclusion and DNA methylation Binding of Lrp at sites 1 2 and 3 reduces the af nity of Lrp for pap sites 4 5 and 6 overlapping GATCd S b 10fold via a phenomenon that has been denoted mutual exclusion 116 Mutual exclusion requires a supercoiled pap substrate by an unknown mechanism One possibility is that Lrp could induce bending at sites 1 2 and 3 propagating an alteration in twist to sites 4 5 and 6 Methylation of GATCdiSl reduces the af nity of Lrp for sites 4 5 and 6 by about 20fold based on in vitro DNA binding measurements 118 In addi tion there is an intrinsic twofoldhigher af nity of Lrp for sites 1 2 and 3 versus 4 5 and 6 These factors contribute to stabilization of the OFFphase Pap expression state 116 The transition from the OFF to ON phase requires that GATCP ox be methylated by Dam either a dam mutant E coli strain or a GCTCprox AtoC transversion mutant that cannot be methylated by Dam but does not signi cantly alter the af nity of Lrp for sites 1 2 and 3 is locked in the OFF phase 41 In contrast methylation of GATCdjSt has an inhibitory effect on the OFFtoON switch overexpression of Dam by just fourfold prevents the OFFtoON switch Moreover E 601139 containing a GCTCdiSt mutation that blocks Dam methyl ation is locked in the ON phase even under conditions of Dam overexpression 41 These data support the hypothesis that OFFtoON switching requires DNA replication to generate a hemimethylated GATCdiSl intermediate which is bound by PaplLrp with a higher af nity than DNA with a fully methyl ated GATCdiSl 118 A low level of the coregulatory protein Papl required for Pap pili expression 138 193 194 increases the af nity of Lrp for pap DNA hemimethylated at GATCdiSl but does not enhance binding of Lrp topap DNA fully meth ylated at GATCdiSl 118 Notably the hemimethylation state of pap matters Papl increases Lrp s af nity for DNA methyl ated on the top strand at GATCdist about fourfold more than for DNA methylated on the bottom strand 118 These results raise the intriguing possibility that Pap phase switching may be biased daughter cells receiving a DNA methylated on the top strand may have a higher probability of switching to the ON phase than cells receiving DNA methylated on the bottom strand Papl is a small 9kDa coregulatory protein expressed from the pap promoter divergent to the papBA pilin promoter Fig 3A top Papl increases the af nity of Lrp forptzp site 5 and to a lesser extent site 2 but has no effect on binding of Lrp to any of the other four Lrp binding sites 118 Fig 3Cptzp Lrp binding sites 5 and 2 share the sequence ACGATC which differs from the other four pap Lrp binding sites and the ileH Lrp binding site 2 65 129 138 which do not display Papldependent Lrp binding 118 Allptzp Lrp binding sites share the sequence GNNNTTT with the Lrp binding con sensus determined by systematic evolution of ligands by expo nential enrichment 64 Papl does not appear to bind speci cally to pap DNA by itself based on gel shift analysis 138 and DNA crosslinking 118 DNA methylation interference indicated that methylation of bases in the sequence 5 GNCGAT3 overlapping GATCdist in MICROBIOL MOL B101 REv the top strand and 3 TGCTAG5 in the bottom strand signi cantly reduced Papldependent Lrp binding compared with bind ing of Lrp alone Methylation of the bottomstrand cytosine com plementary to the guanine of GATC meC9 blocked formation of the ternary PaplLrpptlp site 5 complex without affecting Lrp binding 118 These results support the hypothesis that enhance ment of Lrp binding to site 5 occurs via formation of a Papl dependent ternary complex with Lrp and pap DNA Crosslinking with a photoactivatible 9A azidophenacyl crosslinker three bases from the presumptive Papl binding sequence ACGATC showed that Papl and Lrp were both crosslinked to pap DNA in the ternary complex with nonmethylated DNA while only Lrp was crosslinked with DNA methylated at C9 118 These results indicate that Papl is located near the pap ACGATC sequence in the PaplLrpptlp site 5 ternary complex and may directly contact this sequence The observation that Papl 100 nM increases Lrp s al nity for pap site 2 which contains the ACGATC Paplspeci c sequence identical to site 5 118 presents an apparent para dox since this should block pap transcription due to its close proximity to the papBA pilin promoter 278 Further analysis showed that at low Papl levels signi cant enhancement of Lrp binding occurred at sites 4 5 and 6 CGATCdjS but not at sites 1 2 and 3 CGATCPmX 118 At 5 nM Papl the af nity of Lrp was fourfold higher forptzp sites 4 5 and 6 Kd 025 nM than for sites 1 2 and 3 Kd 10 nM Conversely in the absence of Papl the af nity of Lrp for sites 1 2 and 3 Kd 12 nM was about twofold higher than that for sites 4 5 and 6 Kd 25 nM Thus binding ofLrp at sites 4 5 and 6 should be favored at low Papl levels resulting in activation of papBA transcription This in turn would increase the Papl level via a PapBmediated positive feedback loop whereby PapB binds upstream of the pap promoter and helps activate Papl expres sion 11 85 288 3B High Papl levels could potentially shut off pap transcription by increasing the binding of PaplLrp complexes at promoterproximal sites 1 2 and 3 However this is prevented by methylation of GATCP ox by Dam which speci cally blocks Papldependent Lrp binding without alfect ing binding of Lrp alone 118 To determine if the essential role of methylation of GATCprox in the OFF to ONphase transition is to speci cally block Papldependent Lrp binding to sites 1 2 and 3 the wildtype QGATCprox sequence was mutated to IGATCprox to speci cally inhibit Papldependent Lrp binding It was rea soned that under conditions in which Papldependent binding of Lrp to sites 1 2 and 3 was blocked switching from OFF to ON phase should occur in the absence of Dam Analysis ofthe TGATCPmquot mutant showed that Papldependent Lrp binding to sites 1 2 and 3 was inhibited but binding of Lrp was unaffected both in vitro and in vivo Switch frequency analysis of E 001139 containing the TGATCprox mutation showed that the OFFtoON rate 56 X 10 4cellgeneration was about sev enfold higher than that of wildtype cells 82 X 10 5cell generation Notably in a dam null mutant background cells were locked in the ONphase state showing that methylation is not required for pap transcription under conditions in which Papldependent binding of Lrp to pap site 2 containing GATCprox is blocked These results support the conclusion that methylation at GATCprox is required for the OFF to VOL 70 2006 ONphase transition by speci cally inhibiting PapIdependent Lrp binding to sites 1 2 and 3 Fig 3C top Environmental mechanisms for switch control Binding of Lrp at sites 4 5 and 6 together with binding of cAMPCAP at i2155 relative to the papBA transcription start site 277 enhances papBA transcription via contact between CAP acti vating region 1 and the otCterminal domain of RNA polymer ase 277 In this way Pap pilus expression is environmentally controlled by carbon source via the cAMP level The role of Lrp may be structural bending pap DNA between the CAP binding site at i2155 and the papBA promoter to facilitate contact between cAMPCAP and the otCterminal domain This results in transcription initiation from papBA and expres sion of PapB which has been reported to bind with highest af nity to a site between the pap promoter and the CAP binding site 85 stimulating pap transcription which consti tutes a positive feedback loop 3D The high PapI level ensures binding of PapILrp to sites 4 5 and 6 and methyl ation of GATCP ox prevents binding of PaplLrp to sites 1 2 and 3 which would shut off papBA transcription and turn the switch OFF 278 The fact that both PapI and PapB are required for switching from the OFF to ON phase raises a chickenandegg problem that has not been adequately ad dressed which regulatory factor initiates the switch We spec ulate that regulation is at the level of PapB expression and that a low level of papBA mRNA is made following DNA replica tion and LrpHNS dissociation from sites 1 2 and 3 266 If this papBA mRNA is rapidly translated it would induce pap transcription initiating the OFFtoON switch cascade There is indirect evidence to support the idea that there may be translational control involved in Pap pilus expression since a rim mutation affectsptzp gene regulation 2807282 Riml acetylates ribosomal protein S5 in the 305 subunit Thus it is possible that ultimately the initiation of the Pap OFF toON switch may be dependent upon the translation of a basal level ofptzpBA mRNA present immediately following DNA replication The global regulatory protein HNS is not required for Pap phase variation 266 but it does modulate Pap gene expres sion and Pap switch rates HNS represses papBA transcription in response to low temperature 94 high osmolarity 283 and rich medium 283 This may occur by speci c binding of HNS to the pap regulatory region as evidenced by blocking of methylation of both pap regulatory GATC sites in vitro and in Vivo 279 Binding of HNS near the papBA promoter could inhibit binding of RNA polymerase repressing transcription Notably at 37 C HNS appears to positively affect Pap phase variation since the OFFtoON switch rate is reduced in an hns mutant 266 283 This positive effect of HNS on the OFF to ONphase transition could occur via competition with Lrp at sites 1 2 and 3 which would help to move PapILrp to sites 4 5 and 6 analogous to the role of methylation of GATCP ox 3C Another environmental input into Pap phase variation is mediated by the CprR response regulatory system 117 127 Under certain conditions that stress the cell envelope includ ing high pH Cpr located in the inner membrane autophos phorylates and then transfers a phosphate group to CpxR to yield CpxRphosphate CpxRP 176 211 CpxRP binds to sites overlapping all six pap Lrp binding sites competes with Lrp for binding to these sites and shuts off papBA transcription EPIGENETIC GENE REGULATION IN BACTERIA 841 and Pap pilus expression 115 117 Notably CpxRP binding to pap sites 1 to 6 is not inhibited by DNA methylation in contrast to Lrp even though CpxRP like Lrp binds at sites overlapping the pap GATprX and GATCdist sites The bio logical role of CprR regulation of Pap pilus expression is not fully clear One possibility is that under conditions of envelope stress it makes sense to curtail pilus expression to prevent further damage to the membrane Another provocative possi bility is that under conditions of stress UPEC cells stop making Pap pili making them susceptible to contactdependent growth inhibition The physiologic signi cance of this is unknown but it might contribute to survival under harsh conditions by slowing bacterial metabolism and growth The Pap ON to OFFphase transition The Pap ON to OFFphase transition occurs at about a 100foldhigher rate than the OFF to ONphase transition 35 266 Notably fac tors including HNS carbon source and osmolarity do not affect the ON to OFFphase transition rate 35 266 283 therefore it appears that the ON to OFFphase transition is relatively constant under different environmental conditions The ON to OFFphase transition has not been thoroughly examined but based on knowledge of the OFFtoON switch mechanism 1167118 see above the following model is pos tulated Starting with a cell in the ONphase state Fig 4A DNA replication is postulated to dissociate PaplLrp from sites 4 5 and 6 enabling Dam to compete with Lrp forbinding at GATCdiSl Fig 4C Methylation of GATCdiSl is essential for the OFFphase state 41 DNA replication also generates two hemimethylated GATCPwX sites one methylated on the top strand and one on the bottom strand 4B Whether a cell remains in the ON phase or transitions to the OFF state may be dictated by competition of Lrp for binding to pap promoter proximal sites 1 2 and 3 versus distal sites 4 5 and 6 Fig 4B Lrp has about a twofoldhigher at nity for the proximal sites than for distal sites and methylation of GATCP ox does not affect Lrp binding to these proximal sites 118 In contrast methylation of GATCdiSl inhibits binding of Lrp and PapILrp to the distal sites 118 194 These two factors should favor binding of Lrp to the proximal sites over the distal sites which may account in part for the high ONtoOFF rate observed Following one additional round of DNA replication the OFF phase state is attained Fig 4D Clearly the Pap epigenetic switch mechanism is complex involving distinct DNA methylation and proteinDNAbinding states Therefore it would be highly useful to have a mathe matical model that could predict switch rates under a variety of conditions and identify the key regulatory steps determining switch outcome Liao and coworkers have developed a model for Pap phase variation that takes into account many of the proteinprotein and proteinDNA interactions of Lrp PapI and Dam described above 131 297 To rigorously test a model one would need to alter cellular levels of PapI Lrp and Dam and experimentally determine switch rates In addition a useful model should be able to predict switch outcomes when the af nities of PapI Lrp and Dam forptzp DNA have been altered for example Although these types of analyses have not yet been carried out preliminary data suggest that the Markov chain model for Pap may be useful in understanding Pap switch dynamics However the frequency of ONstate cells in the population was underestimated for example 297 Reliable 842 CASADESUS AND IDW MICROBIOL MOL BIOL REV Phase ON Phase OFF to OFFephase tiansition mechanism See the legend to Fig 3 for explanations of symbols The ONetonFF svutch t 1316 4 The Pap ONV mechanism is described in the ex numbeis for biochemical paiameteis of the Pap switch such as association and dissociation binding constanm for PapIeL Lip 39 and at sites 4 5 and 6 and have not yet been obtained This makes it dif cult to deteimine if the Pap model doe not accuiately re ect experimental data ue to incoiiect biochemical paiameteis used in the model oi because assumptions in the model aie incoiiect oi incomplete Recently anothei Pap switch model was developed by Munsky and Khammash 183 184 Fuithei woik as outlined above will be necessaiy to test these models and deteimine if they aie useful in furthering oui undeistanding of the Pap switch and othei epigenetic switch systems see below PapRelated Sysmms o ions containing iegulatoiy iegions with homology to pup indicates that theie aie two giou s ologues similai to the pup system and those negatively iegulated by Papl homologues Pa 1 homologue ac ng as a positive iegulatoi oi pilus ex iessiou The iegulatoiy iegions of many pilus opeions in E call including Paperelated mbriae Pit m F1651 pili ch c341 pili sfu s pili duu F1845 fue K88 and ufu a me biial adhesin shaie two GATC sites analogous to GATCW VOL 70 2006 EPIGENETIC GENE REGULATION IN BACTERIA 843 pap TCAATTTGCCATGATGTTTTTAT GAGTACCCTCTTGCTATTAGTGTTTT foo TCAATTCACCATGATGTTTTTAT GAGTGTATTCTTGTTGTTTGTGTTTT sfa GArTrT A A ATACTGAiAT TCATGCTTATACAGTATTAAT CGCCAATCCACTGCGAGATATA afa GATTAT ATTCTAC AC GAATAATATCCCGGTTATATATT GATTGTATTCTTTTTTGTGTTATCTG daa AATTAT A ATTCTGC AT GAATAATATTCCAGTCATATATT GATTGTATTCTTTTTTGTGTTATATG Clp GTTTTAGTATCTGTGATT TTGTGTTTTTTTGGTGGCTTTTG GTTGTTTGTTGTTTTTGTGGTTTTAT fae TGAAATAGATTTGTGTATTTTTTCTGTTTTTGGTTGTTTGTGGTGCTTTTGTGTTGTTGTGGTTTTTT pef TGCTATAGATTCTGCATTA GTATGATAA ATAGACGTTTAACGTTTTCTTGTGATTTTGTGGTGAAAC GATcpIOX pap GTTCTAGTTTAATTTTGTTTTGTGGGTT AAAGATCG AAATCAAT TACAACAT A A CTAAATT foo ATTCTAGTTTGATTTTGTTTTGTAGGT TACAACAT A A CTAAATT sfa ACCCTAAAAATAAACAGCTTTACAGATC AAAGATC TACAACAT CTAAATA afa ATTCCGGTGTTTTGTTTTTTTGTAGAT A AAAGATC TTAAGTG A A A Ac CCATGGT daa ATTATGGTATTTTGTGATTTTGTAGAT A AAAGATC TTAAGTAA A A ACRCCATGAT Clp TTGTTGTTGATGTTTGTTTTTGTAGTTGT TTCGCTAT A A AC ATCGTGAI fae GCTCTGCAATTTTTGTTTAATTCGCTATTG TTAEGCGTGAGAEGACGATAT AAGT pef ATTCTGATTTATTTTGTTTGCATGGTAGAAWCAAQAWTTTTCAAAAC C TCTGTAT 4 FIG 5 DNA sequence alignment of the GATC box regions from pilus operons under DNA methylation pattern control DNA base pairs conserved in all pap family regulatory regions are shaded black with light lettering The distal and proximal regulatory GATC sites GATCd St and GATCPIOX respectively are shown Arrows show the inverted orientation of the two GATC box regions The accession numbers for the sequences shown are as follows pap X14471 foo AF109675 sfa 59541 afa X76688 dag M98766 clp L48184 fae X77671pef L08613 and GATCdliSt and spaced 102 base pairs apart as in pap 151 Fig 5 Moreover these GATC sites are present within addi tional conserved sequences CGATCdiStTTTT and CGAT CPrOXTT with the entire sequence called a GATC box note the inverse orientations of the GATC boxes in the pilus regu latory sequences shown in Fig 5 Since the GATC box se quence contains binding sites for Lrp and Dam as well as a portion of the PapI response element ACGATC this pro vides the means by which these various pilus operons are con trolled by DNA methylation patterns The sfa dad prf paprelated mbria and afa3 operons appear to be regulated by DNA methylation patterns analo gous to regulation of pap Each of these pilus operons codes for a PapI and a PapB homologue and crosscomplementation between the PapB and PapI homologues between prf and sfa 182 and between pap and sfa and dad 267 was shown The DaaF and SfaC proteins function similarly to PapI positively regulating expression of dad and sfa respectively by facilitat ing binding of Lrp to promoterdistal binding sites overlapping GATCdliSt 267 Methylation of the paprelated GATC sites in turn controls binding of Lrp PapI homologue acting as a negative regulator of pilus ex pression Two methylationcontrolled pilus operons in E coli clp CS31A and le K88 and one pilus operon in Salmonella enterica serovar Typhimurium pef share common regulatory features with pap but have distinct diiferences as well The regulatory regions of clp le and pef contain conserved GATC box sites and spacing identical to that in pap Fig 5 Also similar to pap binding of Lrp to regulatory DNA is controlled by DNA methylation and a PapI homologue However all three methylationcontrolled operons are carried on plasmids and in each case PapI homologues negatively control phase variation and transcription K88 pili expressed by enterotoxigenic E coli infecting pigs is not under phase variation control in contrast to the case for all other Pap family members 124 The le regulatory region shares GATC box sequences with pap spaced 102 bp apart as well as a PapI homologue FaeA and a PapB homologue FaeB 124 A third regulatory GATC site GATCIII is present 28 bp downstream toward the faeB promoter of GATCPrOX and two IS sequences are present between faeB and faeA Fig 5 In contrast to the case for pap F aeA and Lrp act to negatively control le transcription Data from Huisman et al indicated that in the absence of FaeA Lrp binds at sites overlapping GATCPrOX protecting it from methylation by Dam 124 125 However in contrast to the case for pap this Lrp binding has little eifect on pilin transcription In the presence of FaeA the PapI homologue additional binding of Lrp near GATCIII occurs blocking methylation of both GATCprOX and GATCIII and reducing fae transcription This GATCIII site shares the CGATCTTTTA sequence of the pap and le GATCdliSt sites though in opposite orientation possibly ac counting for FaeAmediated binding of Lrp to this region However FaeAmediated binding of Lrp to GATCdliSt was not observed In fact mutation of the GATCdliSt site to GTTC sequence was lethal due to overproduction of K88 pili indi cating that methylation of GATCdiSt normally blocks binding of FaeALrp Whether FaeALrp binds to GATCdliSt under nor mal physiologic conditions is not clear but it is possible that binding to a hemimethylated GATCdliSt site might occur imme diately following DNA replication stimulating K88 expression under certain conditions Another difference between regula tion of le and pap is in control of faeA and of pap transcrip tion In the case of pap pap is regulated by PapB via a positive 844 CASADESUS AND LOW feedback mechanism 116 whereas in fae an IS insertion apparently disrupts this positive feedback Instead FaeA may bind to its own promoter acting as a positive autoregulator 125 Regulation of the clp operon coding for CS31A pili which are expressed by enterotoxigenic E coli shares common reg ulatory features withpap but like forfae and pef has distinct differences as well In E coli isolate CS31A harboring clp CS31A pili are under phase variation control yet the plasmid carried clp operon does not have a pap homologue associated with it 62 173 It seems likely that a pap operon identi ed on the chromosome of E coli CS31A supplies PapI in trans but this has not been con rmed Analysis of clp regulation in E coli K12 no papI homologue present showed that Lrp and the PapB homologue ClpB repressed clp transcription How ever even in the presence of Lrp and ClpB a moderate level of clp pilin transcription was observed In addition in lrp r ClpB cells lackin Dam transcription was almost maximally derepressed Introduction of the PapI homologue AfaF re sulted in phase variation of CS31A expression instead of a normally distributed transcription of CS31A among the cell population individual cells either transcribed ON phase or did not transcribe OFF phase the clp operon with the meth ylation pattern of the former cells being GATCdiSt nonmethyl ated and GATCP ox methylated and with the converse pattern for the latter cells These results can be explained if Lrp and ClpB bind near the clp pilin promoter moderately repressing transcription but still allowing some pilus expression to occur in the absence of the PapI homologue AfaF The repressive effect of Dam on clp transcription could occur via methylation of GATCdist to block binding of Lrp to promoterdistal sites Addition of AfaF should increase the af nity of Lrp for both GATC St and GATCPmquot similar to the case for pap However it may be that the af nity of AfaFLrp is marginally higher for GATCP ox than GATCdjS the reverse of the case for pap which could explain why only a small fraction of cells are in the ON phase in the presence of constitutively expressed AfaF This could also explain why the transcription of AfaF r OFF phase cells appears to be lower than that of cells lacking AfaF which do not show phase variation since AfaF would in crease Lrp s af nity for clp pilin promoterproximal sites and more ef ciently block transcription than Lrp alone The clp operon and the closely related foo operon coding for F1651 pili 24 63 101 have the distinction of being the only members of the Pap regulatory family controlled by the aliphatic amino acids leucine and alanine Alanine and to a lesser extent leucine reduce the expression of CS31A pili 62 173 This appears to occur as a result of diminished PapI homologuedependent binding of Lrp to GATC St and in creased binding of Lrp to GATCPmquot locking cells in the OFF phase transcription state Lrp has a binding site for aliphatic amino acids which appears to modulate the multimeric state of Lrp between dimeric octameric and hexadecameric states 57 59 If Lrp binding sites are phased such that they occur on the same DNA face then an octameric Lrp could engage up to four sites contributing to binding cooperativity The reason that the transcription of certain operons including clp is mod ulated by alanine and leucine whereas that of other operons such as pap is not is unclear However recent results with the MICROBIOL MOL B101 REV ileH operon which is repressed by leucine indicate that leucine inhibits longrange interactions between Lrp proteins bound to different sites in the ileH regulatory region 58 The pef operon in Salmonella enterica serovar Typhimurium codes for plasmidencoded mbriae Pef mbriae that appear to play a role in intestinal colonization 17 126 Pef mbriae are encoded on the pSLT virulence plasmid 87 Pef pili are expressed in vivo in bovine ligated ileal loops 126 but in the laboratory are expressed only in acidic pH 51 rich broth in standing culture 190 Under these conditions Pef pili are expressed under phase variation control The pe gene is lo cated about 6 kb away from the pef regulatory region and PefI acts negatively on Pef phase variation blocking Pef pilus ex pression when expressed on a multicopy plasmid 190 This appeared to occur via increased af nity of Salmonella Lrp which is almost identical to E coli Lrp one amino acid differ ence for DNA sites overlapping GATCquotox previously de noted GATC II Binding of Lrp at GATCdiSl appeared to correlate well with the ONphase state similar to the case for pap Thus a common theme for pef clp and fae is that in each case PapI homologues act negatively by increasing the binding of Lrp to pilin promoterproximal sites protecting GATCprox from methylation and inhibiting transcription The reason why PapI Lrp binds with the highest af nity to sites around GATCdist in pap and closely related operons see above and to sites around GATCprox in pef clp and fae is not known Analysis by Hemday et al showed that the af nity of PapILrp for Lrp binding site 5 containing GATC St was signi cantly higher than its al nity for site 2 containing GATCprox 118 Analysis of site 2 and 5 regions in pap versus pef clp and fae does not provide any simple possible explanation for the mechanism by which PapILrp af nity is re versed in these operons Fig 5 However this regulatory dis tinction may explain the reason why the pap homologues in pef clp and fae have been disconnected from the positive feedback loop operating in other paprelated operons If they were connected one would expect that the consequence would be to turn off pilus expression entirely Since pef and clp ex pression is under phase variation control this shows that a positive feedback loop is not essential for phase variation In fact Pap phase variation occurs in papIminus mutants con taining PapI expressed constitutively on a plasmid showing that disconnection of the feedback loop is not an essential feature of phase variation although it likely contributes to signaltonoise parameters Although it is not clear why pef clp and fae display this regulatory difference from pap it pro vides an additional means by which Pef CS31A and K88 pilus expression can be controlled by environmental and host factors via regulation of pe the resident pap operons and faeA respectively PhaseVariable Outer Membrane Protein Ag43 Besides the pap regulatory family of operons described above the only other characterized phase variation system regulated by DNA methylation patterns is a gene originally designated by B Diderichsen as u for uf ng based on the propensity of bacteria to aggregate uff and sediment 71 Henderson et al and Owen et al 111 200 later identi ed and characterized an autotransporter protein denoted antigen 43 Ag43 which was shown to be identical to the u product and VOL 70 2006 agn43p A 7 a GAIC aquot sues I II III wit 6 OFF a let o o o i B iciogo We Dam oxyR ON 2 Ar OFF Assam FIG 5 Model for phase variation of the outer membrane protein Ag43 The regulatory region oft e agrl 3 operon is shown at the to ethylation states of the to andbottom DNA strands of a c site are depicte y an open circle nonmethylated or closed circle methylated Rep indicates a DNA replication event The Ag43 swrtch model is discussed in the text the gene was renamed cgmd The regulatory region of ma has a consensus binding site for the OxyR repressor 29o present on a number of genes regulated by oxidative stress h u see below In addition three GATC sites GATCVI GATCVH and GATCV 111 are present in the regulatory region within the OxyR bind ing sites Fig 6A Transcription ofugmi begins at the G of the promoteredistal GATCeI site 269271 Fig 6A Binding of 0in to the cgmd regulatory region represses cgmd trans scription in vivo based on the phaseelocked ON phenotype of the ugmi regulatory region Methylation of any two of the EPIGENETIC GENE REGULATION IN BACTERIA 845 three ugmi regulatory GATC sites was suf cient to inhi it binding of OxyR in vitro and allow phase variation to occur in vivo 269 although all three sites appear to attaining normal protected all GAT cgm transcription in vitro 271 This regulatory arrangement is similar in basic form to that of the pup regulatory 39 both systems 39 sites in turn inhibim regulatory protein binding For Pa the 39t h between the OFF and ON phases is facilitated by the coregulator PapI which controls binding of Lrp between o GA of o R might be important in Ag43 regulation This hypo esis is attractive since it would tie the oxidative stress response to bio lm formation which is aided under certain conditions by Ag43 66 exists in two redox states within cells formed by die sul de bonding between cysteines 199 and 203 Disul de bond reduction occurs enzymatically primarily by glutaredoxin 1 295 Data from Schembri and Klemm showed that expression type 1 pili m and P pili pup blocked Ag 39 tion in these pili possibly driving OxyR toward the reduced state repressing Ag43 expression If this is correct then trans scription of other genes in the OxyR regulon such as kch should be affected but this was not tested Further analysis of the possible role of the redoxstate of OxyR in Ag43 regulation was e using OxyRA233V and OxyRH198R mutanm which are locked in the oxidative form and constitutively actie vate genes in the OxyR regulon 152 Neither mutant was found to repress Ag43 expression 112 224 and it was Gone cluded that only the reduced form of OxyR expression However Wallecha et al showed that the af nity of OxyRA233V for nonmethylated ugmi regulatory DNA was at least vefold lower than that of oxidized wildetype OxyR and that the af nity of OxyRH198R was also lower than that of wildetype OxyR 270 Thus the assumption that these mun tanm accurately re ect the role of oxidized wildetype o R pear to be valid In vitro analysis showed that oxidized wildetype OxyR binds to ugrl43 DNA and represses ugmi transcription 270 Therefore it appears that the redox state of OxyR does not control phase variation of Ag43 270 The mechanisms by which ugrl43 expression switches bee tween the OFF and ON states is not known though it likely requires DNA replication to generate a hemimethy intermediate 60 o u 43 provides following DNA replication OxyR presumably dissociates from 846 CASADESUS AND LOW agn43 DNA in OFFphase cells giving a window of opportu nity for Dam to compete with OxyR due to the decreased af nity of OxyR for hemimethylated DNA Fig 6B Full methylation of the agn43 GATC sites could occur in one step preventing OxyR binding and repression forming the ON phase state Similarly hemimethylated DNA could facilitate the ON to OFFphase transition by providing an opportunity for OxyR to bind to hemimethylated agn43 GATC sites block ing their methylation by Dam 6C After an additional round of replication the OFF phase DNA methylation pattern would be formed in half of the transitioning cells Fig 6D It is not clear if environmental or cellular factors directly regulate Ag43 switching but it is possible that Squ may play a role Squ binds to agn43 regulatory DNA containing hemi methylated GATC sites but does not bind to fully methylated or nonmethylated DNAs 60 The OFF to ONphase rate was reduced in a squ mutant but much of this effect could be accounted for by a reduction in the DamDNA ratio caused by increased asynchronous initiation of DNA replication that oc curs in the absence of Squ7 which normally sequesters oriC and plays a critical role in timing of DNA replication 36 Under these conditions the balance is tipped toward repres sion since OxyR more effectively competes with Dam VSP Repair In enteric bacteria veryshortpatch VSP repair recognizes GT mismatches and corrects them to GC 25 VSP repair activity is partially redundant with Damdirected mismatch repair and the mechanisms that coordinate the use of either system are not fully understood 25 MutL and MutS are required for VSP repair while MutH is not involved Dam methylation is dispensable for VSP repair mismatched du plexes containing GATC sites are repaired with similar et ciencies in methylated and nonmethylated DNA substrates However Dam mutants of E coli are defective in both Dam directed mismatch repair and VSP repair 19 and their VSP repair defect appears to be caused by lack of Dam methylase Synthesis of Vsr the endonuclease that initiates VSP repair is reduced in Dam mutants suggesting that Dam methylation regulates Vsr synthesis 19 The vsr gene is cotranscribed with dcm the gene for Dcm methylase however synthesis of Dcm remains unaffected in a Dam background 19 The absence of GATC sites in the dcm promoter 67 provides further evidence that Dammediated control of the Vsr level is not transcriptional Because DNA modi cation cannot be ex pected to act directly at the posttranscriptional level we are left with two alternative explanations the Dam methylase might have additional hitherto unknown functions unrelated to DNA modi cation or ii more likely Dam methylation may regulate Vsr synthesis in an indirect fashion by control ling transcription of one or more cell functions involved in posttranscriptional control The case of vsr is unlikely to be unique since evidence for posttranscriptional regulation by Dam methylation has been also found in the Std mbrial operon of Salmonella enterica 130 These examples raise the possibility that Dam methylation might regulate cell functions involved in RNA stability mRNA translation or protein turn over However the underlying molecular mechanisms remain to be identi ed MICROBIOL MOL B101 REv Bacteriophage Infection In the genomes of certain virulent phages of enteric bacteria GATC sites are relatively scarce Total E coli DNA contains GATC sites at a frequency of one GATC site per 232 bp which approaches the predicted random frequency of one GATC site per 256 bp 110 In contrast bacteriophage T7 contains 6 GATC sites while the predicted number is 141 174 In the genomes of temperate phages such as E coli lambda and Salmonella P22 the frequency of GATC sites is also lower than expected from their nucleotide composition but the differ ences are not as spectacular as in the case of T7 110 174 Other phage genomes contain GATC sites at frequencies sim ilar to that found in the host genome 31 It has been pro posed that scarcity of GATC sites in the genomes of virulent phages may protect against DNA digestion by the host MutH endonuclease 70 Note that Damdirected mismatch repair requires partial degradation of the daughter strand and resyn thesis by host DNA polymerase I and DNA ligase a laborious process that may not be feasible during the late stages of phage growth On the other hand Teven P1 and other phages carry their own dam genes which may ensure methylation of GATC sites during the lytic cycle 31 Aside from conferring protec tion from accidental MutHLS cleavage of concatemeric DNA T4Dam may also protect T4 phage DNA from restriction by competing P1 phage 177 Regulation of DNA packaging in bacteriophage P1 Packag ing of phage P1 DNA into capsids proceeds by a processive headful mechanism that uses concatemeric phage DNA mol ecules produced by rollingcircle replication during the late stages of phage infection 291 Packaging is initiated at the pac site a 162bp DNA sequence that contains seven GATC sites a density 10fold above random The methylation state of these GATC sites affects packaging of P1 DNA into capsids because the P1 packaging enzyme can cut pac only if most of its GATC sites are methylated in both DNA strands 245 The importance of Dam methylation in the regulation of P1 pack aging is illustrated by the observation that growth of a P1 Dam mutant on a Dam E coli strain causes a 20fold re duction in phage progeny compared to infections carried out in the presence of either phage or host Dam methylase 245 Furthermore the few phage produced in the absence of Dam methylation carry genomes which lack pac sequences at their ends 245 Cutting phage genomes in a precise manner may optimize DNA packaging and facilitate circularization of phage DNA upon entry into the next recipient cell However the use of Dam methylation to label phage DNA ends is an enigmatic evolutionary acquisition Because the DNA substrate for pack aging is concatemeric DNA methylation of all pac sites in a concatemer would permit multiple packaging initiations dis rupting the serial process of head lling A model proposed by Yarmolinski and Stemberg in the late 1980s envisages that the P1 packaging enzyme protein 9 which is the product of an early phage gene might bind hemimethylated pac sites pro duced by theta replication and protect them from the host Dam methylase P1 circular molecules with hemimethylated and nonmethylatedpac sites would thus be produced 291 In the second stage of replication rolling circle P1 Dam meth ylase the product of a late gene would be allowed to meth VOL 70 2006 ylate one and only one pac site per concatemer the other pac sites would be protected but not cut by protein 9 This mech anism would permit headful packaging and avoid cutting of pac sites inside a concatemer 291 Note that every concatemer contains several P1 genomes and cutting every pac site would prevent headful packaging and thus waste phage DNA Regulation of the ore gene in bacteriophage P1 Cre is a sitespeci c recombinase involved in cyclization of P1 DNA upon injection into the host cytoplasm The cre gene is driven by three promoters and one of them pctel contains two GATCs in its 35 module 246 Transcription from pct81 is repressed by Dam methylation 246 The signi cance of this Dam dependence is unknown Cre is expressed in cells lysog enized b P1 and may play a role in the partition of newly replicated prophages 291 Based on these observations one may speculate that hemimethylation might cause transient de repression of the pc81 promoter The resulting boost in Cre synthesis might ensure proper partition of the daughter pro phages Regulation of the mom operon in bacteriophage Mu The mom gene of bacteriophage Mu encodes a DNA modi cation enzyme that converts adenine to N6carboxymethyladenine 102 248 257 Mommediated modi cation of Mu DNA is postreplicative and protects Mu DNA from cleavage by a num ber of restriction endonucleases 103 Mom is not essential for phage growth but increases the host range of Mu within E coli if Mu infects a bacterial cell harboring restrictionmodi cation systems different from those found in its last host Mommod i ed Mu DNA will be protected against nucleolytic attack 103 The mom gene is part of the mom operon which in cludes a second gene com involved in translational regulation of the commom transcript 103 In turn transcription of the mom operon requires a phage roduct protein C which binds the mom upstream activation sequence UAS 33 to 52 relative to the transcription start site 38 In the absence of protein C RNA polymerase starts transcription at the opposite DNA strand generating a transcript directed away from the mom gene 247 The DNA region upstream from the C bind ing site contains three GATC sites spaced between 54 and 85 103 This region serves as a binding site for a host encoded protein the redoxsensitive regulator OxyR which acts as a repressor ofmom transcription 103 However OxyR can bind the mom UAS only if the GATCs therein are non methylated or hemimethylated 37 104 Thebiological role of Dam methylation in the regulation of mom transcription is not fully understood However Mom mutants have a subtle phe notype that may provide hints about the role of Dam in mom control Mu DNA produced after infection is less modi ed by Mom than Mu DNA produced after prophage induction 258 A tentative explanation is that the mom promoter is fully methylated in a lysogen thereby preventing OxyRmediated repression 103 This may permit a level of synthesis of Mom product suf cient to modify phage DNA molecules produced upon induction In an endogenous infection however the lag between phage DNA replication and Dam methylation will increase the chances that OxyR binds to a hemimethylated mom promoter repressing transcription 103 Hence phage DNA with a relatively low level of Mom modi cation will be introduced into capsids EPIGENETIC GENE REGULATION IN BACTERIA 847 Conjugal Transfer in the Virulence Plasmid of Salmonella entericu A decade ago a screen for genes regulated by Dam meth ylation identi ed the transfer tra operon of the Salmonella vimlence plasmid pSLT as a Damrepressed locus 254 Derepression of trtz in a Dam background results in increased frequencies of conjugal transfer a phenomenon also observed in other plasmids of the Flike family such as F and R100 47 255 In pSLT Dam methylation does not act directly on the tra operon but acts on the regulatory genes MI and nP 45 255 Transcription of MI which encodes a transcriptional activator of tra is repressed by Dam methylation 46 In turn transcription of nP which encodes a small RNA that antagonizes Tra expression is activated by Dam methyl ation 46 255 This dual effect of Dam methylation ac counts for the increase in trtz operon expression observed in Dam donors 48 Regulation of traJ transcription Repression of MI tran scription by Dam methylation is a typical case of regulation of gene expression at the hemimethylated DNA state reminis cent of Dammediated coupling of 1510 transposition to pas sage of the DNA replication fork see above 219 The traJ UAS contains two binding sites for Lrp which is an activator of MI transcription 45 48 Both Lrp binding sites are necessary for transcriptional activation and one of them LRP2 con tains a GATC site whose methylation state affects Lrp binding When the GATC is hemimethylated or nonmethylated Lrp binds to LRP2 with high af nity If the GATC is methylated however the af nity of Lrp for LRP2 is lowered The binding pattern of Lrp at the MI UAS is also different depending on the methylation state of LRP2 DNase I footprinting reveals that Lrp protects the MI UAS from i132 to 42 when the LRP2 GATC site is nonmethylated and from i132 to 52 when the GATC site is methylated Increased distance be tween the downstream end of the region bound by Lrp and the 35 module of the MI promoter may explain the failure of Lrp to activate traJ transcription when the GATC within LRP2 is methylated 48 Footprint analysis also shows that methylation of the LRP2 GATC alters the distribution of DNase Ihypersensitive sites in the tra UAS providing further evidence that Lrp binding follows different patterns depend ing on the methylation state of the LRP2 GATC 46 Lrp can also bind a hemimethylated traJ UAS see below sug gesting that Dam methylation may serve as a sensor of plasmid replication traJ transcription will be repressed in a nonreplicating plasmid but repression will be lifted during the transient hemimethylation lapse that follows passage of the replication fork 46 af nity of Lrp for hemimethylated traJ UAS is in u enced by the location of the methyl group within LRP2 High af nity Lrp binding occurs if the methylated GATC lies in the noncoding template strand oftraJ In contrast Lrp binds to a hemimethylated DNA substrate containing a methyl group in the MI coding strand with lower af nity If these observations faithfully reproduce the scenario of a replicating plasmid pas sage of the replication fork will permit Lrp binding to one daughter DNA molecule but not to the other and MI activa tion will occur in only one of the newly replicated plasmids Electrophoretic migration of free unbound traJ DNA is also 848 CASADESUS AND IDW different depending on the strand that contains NGrmethylr adenine N6meA a DNA fragment containing N6meA in the noncoding strand migrates like nonmethylated DNA while a A fr m nt containing A in the coding strand mir to induce structural changes in a DNA fragment 72 Hence L I r A39W l ti 39 e wo rm substrates may explain why Lrp is able to discriminate between isomeric DNA molecules 1f the above model is correct Lrpemediated activation oftml transmissible to the recipient cell use of the blooming DNA a a a r r r p39 will reproduce L permis rm activation and the recipient cell will instantly if sui eient Lrp is available Fig 7 This a i m m o 2 nP gene occurs at reduced rates in Dam39 mutanm 46 255 t x a i 1 a r has indicated that repression of nP transcription in a Dam39 background is exerted by the nucleoid protein HrNS 46 However the different expression levels of the gene in m and Dam strains cannot be explained by a local effect of Dam methylation upon HrNS binding because Damemedie by deletion analysis 46 Hence HrNSrmediated repression of nP may eet a condition or state that occurs in Dam 39 39 d type Tentative explanations may lgher HrNS concentration exism in Sulmzmellu Dam mutans as reported for E cali 199 or that lack of N meA favors a change in the pattern of HrNS association to u ii i aBecauseNs an x x sites is known to in uence local DNA structure 72 it seems mnceivable that the methylation state of thousands of GATCs might in uence nucleoid organization and potentially affect HrNS binding Support for this hyp 39 d b microarray analysis ofgene expression in E cali overexpressing Dam 159 Bacmrial Virulence 1n Sulmmellu Hacmapllilils and certain strains of Yerslmu pseudambemulzms lack o 39 ion o vir le ce ver ns not attenuated 121 he involvement of Dam methylation in bacterial virulence MlCROElOL MOL BIOL REV Repressed Activated Repressed Entry of single strand Synthesis of complemenla d DNA stran Activated Recipient FIG 7 Epigenetic states of the tml39 gene in the Salmcaaaa Vrur lence plasmid 1n the donor cell DNA hemimethylation permits rm p me y group in the noncoding DNA strand As a consequence plasmid replication generates two epigenetic states in the MI gene and permits tmtranr sc iptio only one daughter plasmid molecule The met states ofthe top andbottom DNA strands ofa GATC y an open square nonmethylated or closed square methyla ed he possibility that the active epigenetic state oftml39can be transferred to the recipient cell is at this stage hypothetical site are depicted t may provide an example of a housekeeping function that has permitted adaptation to challenges associated with a pathogen lifestyle one such challeng 39 39 that use Dam methylation as a strand discrimination signal for DNA 39 t 39 t 39 leave thecell at the mercy of the MutHLS system if DNA lesions are pmr duced doubleestrand DNA breaks introduced by MutH c kill the cell 121 Lack of mismatch repair is not the phenotype of Dam39 mutans Dam methylation regulates inr vasion of epithelial cells in dalmaaclla calcuca s9 and Hace mapllilils ia acazac 274 secretion of Yersl ia outer meme only Virulencerrelated br dalmaaclla 13 It is intriguing to spe ylation could provide a type ofshorteterm memory forb pathogens via formation of DNA methylation patterns that such an epigenetic memory system is that information regardr ing environmens that mother cells have encountered could be passed on to daughter cells which might be useful in inches trating appropriate temporal control of gene 39 tributing to pathogenesis Despite these examples and possir bilities the roles ofDam methylation in bacterial virulence are VOL 70 2006 EPIGENETIC GENE REGULATION IN BACTERIA 849 REDUCED INVASION OF Reduced mmmw EMTHEUALCELLS Lalo 9f Strand Altered ppB Alterd Reduced Derepression d39sjcr m39mnon ff transcription transcr39pt39on transcription of sIdABC mismatch repair of flagellar of SPM genes transcription genes PeptidogiycanLpp SENSITIVITY assembly defects TO BILE ENHANCED ALERT OF Protein leakage THE HOST Envelope instability IMMUNE SYSTEM FIG 8 Multifactorial basis for attenuation in Dam mutants of Salmonella enterica The lack of strand discrimination for mismatch repair and altered gene expression patterns may explain some of the pleiotropic defects displayed by Salmonella Dam mutants in the mouse model 13 89 208210 not fully understood and their study might uncover hitherto unknown roles of N6meA in the bacterial cell Roles of Dam methylation in Salmonella virulence Dam mutants of Salmonella enterica serovar Typhimurium are severely attenuated in the mouse model the 50 lethal dose of a Dam mutant is 10000fold higher than that of the wild type when administered by the oral route and 1000 fold higher when administered intraperitoneally 89 107 Attenuation by dam mutations is likewise observed in S enterica serovar Enteritidis 93 Microscopic examination of murine ileal loops infected with Dam salmonellae re veals a reduced ability of Dam cells to interact with the intestinal epithelium Furthermore infection of epithelial cell lines indicates that Dam strains have an invasion de fect This defect may be caused by reduced expression of genes in pathogenicity island 1 SPI1 including the main regulatory gene MM 13 The mechanisms by which Dam methylation activates gene expression in SPI1 are not yet known In silico examination of SPI1 regulatory regions does not reveal the existence of any GATC clusters 13 However this does not exclude the possibility that Dam methylation may activate SPI1 expression at the transcrip tional level since the methylation state of a single GATC site can govern speci c DNAprotein interactions 46 118 219 An additional defect of Salmonella Dam mutants that may contribute to inef cient invasion of the intestinal epi thelium is reduced motility which may be caused by unco ordinated expression of agellar genes 13 Another relevant defect of S enterica Dam mutants is envelope instability with release of outer membrane vesicles 210 and leakage of proteins 89 Vesicle release has been tentatively associated with impaired binding of T01 and PAL 210 proteins to peptidoglycan 210 Protein release may also be a side eifect of envelope fragility In addition a mbrial operon that is tightly repressed in the wildtype stdABC un dergoes derepression in Dam mutants 13 In a Dam back ground std mRNA increases over 100fold 13 and the StdA protein becomes one of the most abundant proteins detected by twodimensional gel electrophoresis in cell extracts The presence of three GATC sites clustered in a 24bp interval upstream from the stdABC promoter is reminiscent of genes in which Dam methylation regulates binding of a transacting regulator for example OxyR binding to agn43 97 111 269 see above and raises the possibility that Dam methylation may control stdABC transcription 13 However discrepancies between the std transcription rates and the levels of Std m brial proteins provide evidence for posttranscriptional con trol by Dam methylation 130 as previously described for the E coli vsr gene 19 Production of Std mbriae is tightly repressed in LB medium and becomes derepressed in ileal loops 126 Hence the stdABC operon may provide an interesting example of the use of Dam methylation as a signal that is responsive to environmental cues On the other hand massive mbrial expression on the cell surface to gether with the envelope defects discussed above may con tribute to the avirulence of Dam mutants by activating the host immune system In fact Dam mutants of S enterica have been shown to elicit animal immune responses with high ef ciency 76 108 The observation that Dam meth ylation often regulates cell surface functions mbriae a gella envelope structures and secreted proteins is intrigu ing and may suggest that certain gene families are more prone than others to fall under Dam control An additional defect of Salmonella Dam mutants is sensi tivity to bile 108 210 Bile salts are detergents and DNA damaging agents and both activities appear to contribute to Dam mutant killing during infection Because of their enve lope defects Dam mutants are more sensitive to the deter gent activity of bile In addition in the absence of Dam meth ylation exposure to bile salts triggers killing of Dam cells by their own MutHLS system every attempt to repair bilein duced DNA damage in the absence of DNA strand discrimi nation can result in a doublestrand DNA break performed by the MutH endonuclease 208 A summary of the pleiotropic eifects of a dam mutation on S enterica serovar Typhimurium gene expression and physiology is shown in Fig 8 Attenuation of bacterial virulence by Dam methylase over production Unlike for Salmonella Shigella and Haemophilas analysis of Dam s roles in other pathogens has encountered the obstacle that Dam methylation is an essential function An approach to overcome this hurdle was devised in M Mahan s laboratory Based on the previous nding that both lack of and 850 CASADESUS AND LOW overproduction of Dam methylase attenuated virulence in Sal monella enterictz 107 the effects of Dam overproduction in Yersim39tzpseudotuberculosis and Vibrio cholerae two species in which dam mutations are lethal were tested 135 In both Yersim tz and Vibrio overproduction of Dam was tolerated and caused virulence attenuation 135 An independent study showed that overproduction of Dam methylase in Yersinia enterocolitica enhances invasion of epithelial cells yet results in decreased virulence 83 Damoverproducing strains of Yersinitz pseudoluberculosis show increased secretion of Yersinia outer proteins Yops a group of virulence proteins that are injected in the host cyto plasm via a type III secretion apparatus 136 Yop secretion is tightly regulated by environmental signals such as temperature and calcium concentration 136 Upon Dam overproduction synthesis of the YopE cytotoxin is insensitive to both temper ature and calcium concentration and YopE secretion becomes temperature independent 136 Synthesis of Lch a lowcal ciumresponsive virulence factor involved in Yop synthesis and translocation is also altered in Damoverproducing strains and may contribute to explaining the altered expression pattern of Yop proteins associated with Dam overproduction 10 The success in attenuating vimlence by overproduction of Dam methylase is intriguing and may indicate the existence of virulence genes regulated by stable undermethylation of criti cal GATC sites in a fashion reminiscent of the pap operon or the agn43 gene An alternative explanation is that Dam meth ylase overproduction might interfere with cellular processes which require Squ binding to hemimethylated GATC sites potentially disrupting organization of the nucleoid 159 160 The latter view may be supported by the observation that Squ mutants of Salmonella enterica display virulence defects in the mouse model 209 Cch Methylation and Regulation of Cell Cycle in Alphaprateabacteriu Caulobtzcter is a dimorphic bacterium with two different cell types the stalked cell and the swarmer cell 170 These cell types are formed by asymmetric cell division and they differ in morphology and behavior The swarmer cell is unable to divide and differentiates into a stalked cell which undergoes chromo some replication and cell division Initiation of chromosome replication which occurs only in the stalked cell requires that the GANTC sites within the Caulobtzcter chromosomal origin Cori are methylated 170 Chromosome replication pro duces hemimethylated DNA and the daughter chromosomes of the stalked cell remain hemimethylated until Cch is pro duced during the late stage of chromosome replication 215 When Cch is synthesized methylation of the newly replicated chromosomes occurs After cell division the inheritance of a methylated Cori will permit the initiation of a new replication round in the daughter stalked cell 170 215 The fact that two independent bacterial lineages Gamma proteobtzcteritz and Alphaproteobtzcteritz use DNA adenine methylation as a signal for the initiation of chromosome rep lication is an interesting case of quot which is strengthened by the evidence that the DNA methyl ases involved Dam or Cch are also of independent origin MICROBIOL MOL B101 REv Regulation of L ch transcription Shortly after cell division Cch is degraded by a Lonlike protease in both daughter cells 170 214 In the nondividing swarmer cell initiation of chro mosome replication is blocked by CtrA a global regulator that binds the methylated Cori In the stalked cell CtrA is degraded and remains undetectable until chromosome replication has initiated 170 Because the cch gene is not transcribed until chromosome replication approaches the terminus the origin and most of the chromosome will remain hemimethylated until the late stages of replication when a burst in Cch synthesis occurs 170 Transcription of the cch gene is acti vated by CtrA which accumulates in the stalked cell as chro mosome replication progresses However CtrAmediated ac tivation of cch transcription is inhibited by methylation of two GANTC sites located in the leader of the CtrA coding sequence 243 This inhibition may contribute to delay cch transcrip tion until the replication fork reaches cch and may serve to prevent earlier activation by CtrA 215 If high levels of Cch are present throughout the cell cycle Caulobtzcter DNA is methylated all the time the cell cycle is disrupted and la ments made of polyploid cells are formed 287 Regulation of ctrA transcription Synthesis of the cell cycle regulator CtrA is regulated by GANTC methylation in a fash ion reminiscent of Damrepressed genes such as My IS10 and MI 46 219 One of the two CtrA promoters P1 contains a GANTC site near its 35 module 216 Transcription starting at P1 is repressed when the GANTC is methylated Passage of the replication fork renders the promoter hemimethylated and activates transcription 216 This mechanism may serve to boost CtrA gene transcription in response to replication progress In turn CtrA accumulation will activate transcription of the cch gene as soon as the replication fork renders the cch promoter hemimethylated Note that the ability of the CtrA transcription factor to recognize hemimethylated cch DNA is a crucial factor to permit an orderly sequence of events during chromosome replication The importance of hemi methylation in the Caulobtzcter cell cycle is supported by ge netic experiments carried out in Shapiro s laboratory if the CtrA gene is moved to an ectopic position near the replication terminus CtrA transcription from the methylationsensitive P1 promoter remains repressed for a longer lapse of the cell cycle and CtrA accumulates more slowly 216 These elegant ex periments provide further evidence that the hemimethylation wave associated with chromosome replication serves as a mo lecular clock for the Caulobtzcter cell cycle CONCLUDING REMARKS DNA methyltransferases are widespread in bacteria and most of them are part of restrictionmodi cation systems In addition certain bacterial genomes contain solitary DNA methylases that are not involved in protecting DNA from a cognate restriction enzyme Two of these enzymes the Dam methylase of enteric bacteria and the Cch methylase of Caulo bacter crescentus are paradigms of an evolutionary process in which DNA adenine methylation acts as a signaling mechanism that regulates DNAprotein interactions In both Gamma and I 39 I DNA adenine methylation regulates chro mosome replication and couples transcription of certain genes to passage of the DNA replication fork In some cases regu VOL 70 2006 latory protein binding inhibits DNA methylation generatin DNA methylation patterns that are hallmarks of temative epigenetic states DNA methylation patterns are modulated by environmental conditions via alterations in regulatory protein inding Speci c DNA methylation states can be propagated by positive feedback loops and in certain cases they are clonally inherited by daughter cells Protein binding prevents maintenance methylation thereby generating sites that are stably 39 or quot ing factors include transcriptional regulators such as CAP Lrp R and ot er in ing proteins Inheritance of DNA methylation patterns is a phenomenon reminiscent of eukary otic imprinting of genes and may convey adaptive value bac terial populations may use inherited DNA methylation pat terns as a shortterm memory of the metabolic conditions in which the former generation thrived and divided DNA meth ylation also plays an essential role in diverse bacterial patho gens raising the possibility of designing new antibacterial drugs that might inhibit DNA adenine methylation A drug of this kind could be expected to inhibit the vimlence of wildtype bacteria by transforming them into phenocopies of Dam mu tants ACKNOWLEDGMENT S We thank Bruce Braaten Aaron Hernday Stephanie Aoki Brooke Trinh and Marjan van der Woude for reading parts of the manuscript andor helpful advice and Edward Robinson for work on Fig Work in our laboratories is supported by grants B1020043455 C0202 and GEN200320234C0603 from the Spanish Ministry of Education and Science and the European Regional fund to JC and by National Institutes of Health grant A123348 to DL REFERENCES 1 Abraham J M C s Freitag J R Clements and B I Eisenstein 1985 An invertible element of DNA controls phase variation of type 1 mbriae of Escherichia coli Proc Natl Acad Sci USA 82572475727 Alonso A M G Pucciarelli N FigueroaBossi an Garu adelPortillo 2005 Increased excision of the Salmahella prophage ST64B caused by a de ciency in Dam methylase J Bacteriol 187790177911 3 Anki SK R PammaA D Hernday J Bickham B A Braaten and D A Low 2005 Contactrdependent inhibition of growth in Escherichia coli Science 309124571248 Appelmelk B J s L Martin M A Monteiro C A Clayton A A McColni P Zheng T Verboom J J Maaskant D H van den Eijnden C H Hokke M B Perry C M VandenbrouckeGrauls and J G Kusters 1999 Phase variation in Helicabacter pylari lipopolysaccharide due to changes in the lengths of polyC tracts in 0137fucosyltransferase genes Infect Immun 67536175366 ArberW1974 D N r NA modi cation and restriction Prog Nucleic Acid Res Mol Biol 141757 6 Arber W and D Dussoix 1962 Host speci city of DNA produced by Escherichia coli 1 Host controlled modi cation of bacteriophage lambda J Mol Biol 51amp36 Arnold H P U Ziese and W Zillig 2000 SNDV a novel virus of the extremely thermophilic and acidophilic archaeon Sulfolobus Virology 272 409416 LII 4 9 Au K G K Welsh and P Modrich 1992 Initiation of methylrdi39rected mismatch repair J Biol Chem 26712142712148 9 Auer B and M Schweiger 1984 Evidence that Escherichia caZi virus T1 induces a DNA methyltransferase J Virol 495887590 Badie G D M Heitho and M J Mahan 2004 Ich synthesis is altered by DNA adenine methylase overproduction in Yersihia pseudatuberculasis 39red to confer immunity in vaccinated hosts Infect Immun 72670776710 M M Goransson s Normark and B E Uhlin 1985 Transcripr ti nal activation of a pap pilus virulence operon from uropathogenic Eschr erichia coli EMBO J 4888773893 12 Bakker A and D W Smith 1989 Methylation of GATC sites is required 39 39 39 DNA renlication in E T r o r r on rm 3 Bacieriol 171573e5742 Balbontin R G Rowley M G Puoeiarelli Y Wormstone s Lneehini F GarciadelPortjllo J C D Hinton and J Casadesus Unpublished data r 5quot 14 r u r r l r l 9 gt39 r 0 to o 88 sass B 253 www NHO w w w 5quot w w 92 9 gt39 w o a o a r a w Berdls A J 1 Lee J K Cow s Bergerat A A Berthlaum F Bhagwat A s and Bhugi39 Bird A 1997 D Blaisdell B E A Boyer H 1964 Braaten B Braaten B A XN in pap r EPIGENETIC GENE REGULATION IN BACTERIA 851 Bale A M d39Alarcao and M G Marinus 1979 Characterization of DNA adenine methylation mutants of Escherichia coli K12 Mutat Res 591577 165 W te 2000 The I Baranyi U R Klein w Lubitz D H Kruger and A it archaeal halophilic Virusrencoded Damrlike methyltransferase MphiChlr meth l 39 39 39 nd complements dam mutants in the low salt environment of Escherichia coli Mol Microbiol 35116871179 Barras F and M G Marinus 1989 The great GATC DNA methylation in E coli Trends Genet 51397143 Baumler A J R M Tsolis F A Bowe J G Kusters s Hoiimann and F Hetl ron 1996 The pef mbrial operon of Salmahella typhirriuriurri mes diates adhesion to murine small intestine and is necessary for uid accur mulation in the infant mouse In ect Immun 6461768 Beletskaya I v M v Zakharova M G Shl a v L M Semenova and A S Solonin 2000 DNA methylation at the CfrBI site is involved in expression control in the CfrBI restrictionrmodi cation system Nucleic Acids Res 28881773822 Bell D C and C G Cupples 2001 Veryshortrpatch repair in Escherichia caZi requires the Dam adenine methylase J Bacteriol 183863173635 39 ard C Stephens L Wright L Shapiro and J Benkovic 1998 A cell cyclerregulated adenine DNA methyltransferase essively methylates GANTC sites on hemir methylated DNA Proc Natl Acad Sci USA 95287472879 Reference deleted Bergerat A w Guschlbauer and G w Fazakerley 1991 Allosteric and c g DNA adenine methyltransferase monitored by 3H NMR Proc Natl Acad Sci USA 88639476397 Kriebardis and W Guschlbauer 1989 Preferential site speci c hemimethylation of GATC sites in pBR322 DNA by Dam methylr transferase from Escherichia coli J Biol Chem 26440644070 39 e C Crost v Labrie C MartinE B man and J Harel 2004 In uence of Lrleucine and Lralanine on Ll39p regulation of m coding for F1651 a Pap homologue J Bacteriol 1868537541 M L39 b 2002 Cooperation and competition in mis match repair very shortrpatch repair and methylrdirected mismatch repair in Escherichia call Mol Microbiol 44142171428 a B L L Voelker N Zou H Yu and K Dybvig 1995 Mechanism of ant39genic variation in Mycoplasma pulmonis interwoven sitespeci c obiol 18 7 DNA inversions Mol Micr 703 714 Bickle T A and D H Kruger 1993 Biology of DNA restriction Micros v v biol Rev 57434450 Bird A 1999 DNA methylation de novo Science 286228772288 Bird A 2002 DNA methylation patterns and epigenetic memory Genes Dev 166721 oes DNA methylation control transposition of sel sh eler merits in the germline Trends Genet 13469472 M Campbell and S Karlin 1996 Similarities and dissimilarities of phage genomes Proc Natl Acad Sci USA 93585475859 Bloni la type eld I C 2001 The regu tion of pap an mbriation in Escherichia coli Adv Microb Physio 45149 Blom eld I C D H Kula kara an B I Eisenstein 1997 Integration host factor stimulates both FimB inversi r and FimErmediated sitespeci c DNA on that controls phase variation of type 1 mbriae expression in Escherichia coli Mol Microbiol 237057 17 Blyn L B B A Braaten and D A Low 1990 Regulation of pap pilin phase variation by a mechanism involving differential dam methylation states EMBO J 940454054 Blyn L B B A Braaten C A WhiteZiegler D H 852 81 u 81 ax amp 81 o LIIUIUI lob to u w u 81 u u u ax u m u 9 u o ax o ax Equot E ax amp ax o Camacho Carnach Campbell J L and N Klechne Campbell J L and N Klechner 1988 T e Cadsu Charlier D Charlier D N Huysveld M RDove coli Chen S M H RDsner and J M Calvo Correnti J v Munste Crost C J Harel F Berthiaunle A Garrivler M C d C Martin 2004 39 39 Cui Y M A Mldkl Cui IY Q Wang D39Ari R CASADESUS AND LOW protein a global regulator of metabolism in Escherichia call Microbiol Rev 5846 90 Erratum 59323 199 E M d J Casadesus 2002 Conjugal transfer of the virulence plasmid of Salmonella enterica is regulated by the leucineresponsive regr ulatory protein and DNA adenine methylation Mol Microbiol 4415897 1598 o E M and J Casadesus 2005 Regulation of traJ transcription in the Salmonella virulence plasmid by strandrspeci c DNA adenine hemir methylation Mol Microbiol 57170L17 Camacho E MA Sema andJ 18 Casadesus 2005 Regulation of conjugal transfer by Lrp and Dam methylation in plasmid R100 Int Microbiol 82797285 Camacho E M A Sema C Madrid 5 Marques R Fernandez F de la km A Juarez and J Casadesus 2005 Regulation of nP transcription by DNA adenine methylation in the virulence plasmid of Salmzmella entenm J Bacteriol 1875691756 r 1990 E coli oriC and the dnaA gene promoter are sequestered from dam methyltransferase following the pasr sage of the chromosomal replication fork Oell 6296779 79 h rate of Damrmediated DNA adenine methylation in Escherichia coli Gene 741897190 Casadesus J and R D Ari 2002 Memory in bacteria and phage Bioessays 245127518 sa e 5 J and R Maldonado 1990 Genomic imprinting in microorr ganisms icrobiologia 61710 A CerdenoTarraga A M 5 Patrick L C Crossman G Blakely v Ahratt e is uail Barron L N Lennard 1 Poxton B Duerd n B Harr MA Q Price Rabb Barrell and J Parkhill 2005 Extensive DNA inversions in the B fragilis genome control variable gene expression Sc39ence 307146371465 D Gigot N Huysveld M RDovers A Pierard and Glansdor 1995 Pyrimidine regulation of the Escherichia coli and Salmonella typhir murium carAB operons CarP and integration host factor I39HF modulate the methylation status of a GATC site present in the control region J Mol Biol 2503837391 rs and N Glansdor 1994 On the role of the Escherichia integration host factor IHF in repression at a distance of the pyrlmldine speci c promoter P1 of the carAB operon Biochimie 76104171051 hen L D B Paulsen D W Scru M Banes B Y Reeks and M L Lawrence 2003 Alteration of DNA adenine methylase Dam active ity in Pasteurella multmlda causes increase spontaneous mutation fre quency and attenuation in mice Microbiology 149228372290 Chen S and u i eindu M Calvo 2002 be c n ced dissociation of Esche richia coli Lrp hexadecamers to octamers J Mol Biol 318103171042 Chen S M Iannolo and M Calvo 2005 Cooperative binding of the leucineresponsive regulatory protein Lrp to DNA J Mol Biol 39452517 264 2001 Leucineregulated selfr association of leucineresponsive regulatory protein Lrp from Escherichia coli J Mol Biol 31262 3 r T Chan and M Woude 2002 Damrdependent phase variation of Ag43 in Escherichia coli is altered in a squ mutant Mol Microbiol 44 217532 Coulhy J N and L Stemberg 1988 Characterization of the phage P1 dam gene Gene 74191 A Crost Garnvier J Hare and C Martin 2003 Ieucinerresponsive 4 by LrlBuCin and Lralanine in Escherichia call J Bacteriol 185188ramp1894 39 Tessier H n transcriptional regulation of foo and clp coding for F1651 and CS31A adhesins in Escherichia coli Res Microbiol 1554754482 39 39 Q Wang and J M Calvo 1996 The leucine responsive regulatory protein Lrp from Escherichia coli Stoichiometry 39 J and mlnimal requlrements for binding to DNA Biol Chem 27166117 G D stormo and J M Calvo 1995 A consensus sequence for binding of Lrp to DNA J Bacteriol 177487244880 Danese P N L A Pratt s L Dove and R Kolter 2000 The outer membrane protein antigen 43 mediates cellrtocell interactions within Escherichia coli bio lms Mol Microbiol 374244432 E and A S Bhagwat 1993 Mechanism of expression of vsr repair genev an TJNA 39 gene dam Mol Microbiol 9823833 R T Lin and E B Newman 1993 The leucinerresponsive regulatory protein more than a regulator Trends Biochem Sci 182607 Denison A M B Clapper and K Dybvig 2005 Avoidance of the host immune system through phase variation in Mywplasma pulmams Infect Immun 7320392039 70 qua WNquot m 5quot m ax m H m on m on o on r on N on w coon 51 on on on on o o r o N o w o r o 5quot Eg ls E 2 ElMaarn 0 K BuI FergusonSmith A C and 5 Fulka H GarciaDel Portillo F M G Puc Gerdes K T Atl Giacomodonato M C Ce Guschlbauer MICROBIOL MOL BIOL REV Deschavanne P and M Radrnan 1991 Counterselection of GATC see L o m m 11 t d 1 r mismatch repair system J Mol Evol 331257132 Diderichsen B 1980 u a metastable gene controlling surface properties of Escherichia call J Bacteriol 141858867 Diekmann S 1987 DNA methylation can enhance or induce DNA curvar ture EMBO J 6421344217 D son an DE Berg 1989 Factors affecting transposition activity 7 397 of IS50 and Tn5 ends Gene 76207721 D r r W 06 De novo methylation longrterm promoter silencing methylation patterns in the human genome and consequences of foreign DNA insertion Curr Top Microbiol Immunol 3011257175 Dorman J and C F Higgins 1987 Fimbrial phase variation in Esme enchla call de ndence on integration host factor and homologies with ther sitespeci c recombinases J Bacteriol 169384L3843 protective immune responses in c l Dussoix D and w Arber 1962 Host speci city of DNA produced by Escherichia coli II Control over acceptance of DNA from infecting phage lambda J Mol Biol 53749 an E S S Duigou and M K Waldor 2006 Autorepression of RctB an initiator of Vlbm ahaleme chromosome II replication J Bacteriol 1887 r 89 793 9 Eisenstein B I 1981 Phase variation of type1 mbriae in Escherichia coli under transcriptional control Science 2143377339 lLabany s B K Sohanpal M Lahooti K Akerman and I C Blom eld nnntt39 ai a c mB in Escherichia coli K712 Mol Microbiol 49110971118 39 39ting E G Peery P M Kroisel B Balaban K Wagner B Urman J Heyd C Lic C Br J Walter and B Horsthemke 2001 aternal methylation imprints on human chromosome 15 are established during or after fertilization Nat Genet 273417344 Engelberg Kulka H and G Glaser 1999 Addiction modules and pror grammed cell death and antideath in bacterial cultures Annu Rev Micror 70 blol 534 Falker s M A Schmidt and G Heusipp DNA methylation in Yemm entemwlltlm role of the DNA adenine methyltransferase in mismatch repair and regulation of virulence factors Microbiology o o 0 o o H o H E o 5quot H O Q HH Ho oxo H H H H N H H H H E H VOL 70 2006 Escherichia chi Damrdependent methylation abrogates OxyR binding and RV ediate repression of transcription Mol Microbiol 35877387 Hagblom P E Sega E Billyard and M So 1985 Intragenic recombir nation leads to pilus antigenic variation in Ne39 eria gonorrhoeae Namre 31515amp158 Hale W B M W van der Woude and D A Low 1994 Analysis of nonmethylated GATC sites in the Escherichia chi chromosome and idene ti cation of sites that are differentially methylated in response to environe mental stimuli J Bacteriol 176343873441 Han J 5 s Kang 39m and D s Hwang 2003 Sequential bindin of Squ to paired hemirmethylated GATC sequences mediates formation of higher order complexes J Biol Chem 27834983734989 Harel J F Daigle c Eorget M c Tessierc Crost and c Martin 2000 Phase variation of F1651 Prsrlike mbriae from Escherichia coli causing septicaemia in animals Can J Microbiol 46110171107 Hattman S 1979 Unusual modi cation of bacteriophage Mu DNA J Vir rol 32468 47 Hattman S 1999 Unusual transcriptional and translational regulation of the bacteriophage Mu mam operon Pharmacol Ther 843677388 Hattman S and W Sun 1997 Escherichia coli OxyR modulation of bacteriophage Mu mom expression in arn cells can be attributed to its ability to bind hemimethylated Pmom promoter DNA Nucleic Acids Res 2543854388 Hattman s J Wilkinson D Swinton s Schlagnlan P M Macdonald and G Mosig 1985 Common evolutionary origin of the phage T4 dam and hn t E dam NA 4 I I Bacte riol 1649327937 Hayes F 2003 Toxinseantitoxins plasmid maintenance programmed cell death and cell cycle arrest Science 301149amp1499 Heitho D R L Sinsheimer D A L w M essential role for DNA adenine methylation in bacterial virulence Science 2849677970 Heitho D M E I Enioutina R A Daynes R L Sinsheimer D A Low and M J Mahan 2001 Salmahella DNA adenine methylase mutants confer crossrprotective immunity Infect Immun 69672576730 Reference deleted H naut A T Rouer A Gleizes I Moszer and A Danchin 1996 Uneven distribution of GATC motifs in the Escherichia chi chromosome its plase mids and its phages J Mol Biol 2575747 8 Henderson 1 R M Meehan and P Owen 1997 A novel regulatory mech nism for a novel phaservariable outer membrane protein of Esche richia coli Adv Exp Med Biol 4123497355 Henderson 1 R and P Owen 1999 The major phaservariable outer membrane protein of Escherichia chi structurally resembles the immunoe globulin A1 protease class of export otein and is regulated by a novel mechanism involving Dam and cxyR J Bacteriol 181213272141 Henderson 1 R P Owen and J P Nataro 1999 olecular switchesithe ON and OFF of bacterial phase variation Mol Microbiol 339197932 Herman E and P Modrich 1982 Escherichia coli dam methylase Physical and catalytic properties of the homogeneous enzyme J Biol Chem 257260572612 Hernday A B Braaten and D Low 2004 The intricate workings of a bacterial epigenetic switch Adv Em Med Biol 547839 Hernday A M Krabbe B Braaten and D Low 2002 Selfeperpetuating epigenetic pili switches in bacteria Proc Natl Acad Sci USA 2929 Hernday A D B A Braaten G BroitmanMaduro P Engelberts and D A Low 2004 Regulation of the pap epigenetic switch by CprR phosphorylated CpxR inhibits transition to the phase ON state by compe tition with Lrp Mol Cell 165377547 Hernday D Braaten and D A Low 2003 The mechanism by whichDNA i 39 L39 dPapI rr r w Mol Cell 129477957 High N J M P Jennings and E R Moxon 1996 Tandem repeats of the AATV resent in lic2A are required for phase variation but not lipopolysaccharide biosynthesis in Haemophilus in uenzae Mol Mir crobiol 201657174 Holst 13 L SogaardAndersen H Pedersen and P ValentinHanse 1992 The cAMPrCRPCth nucleoprotein complex in Escherichia co two pairs of closely linked binding sites for the cAMP CRP activator comr plex are involved in combinatorial regulation of the cdd promoter EMBO J 11363573643 Honma Y R E Fernandez and A T Maurelli 2004 A DNA adenine methylase mutant of Shigella eaheri shows no signi cant attenuation of virulence Microbiology 15010791078 Hood D W M E Deadman M P Jennings M Bisercic R D Fleischmann J C Venter and E R Moxon 1996 DNA repeats identify novel virulence genes in Haemophilus in uenzae Proc Natl Acad Sci 9311121711125 Horton J R K Liebert s Hattman A Jeltsch and X Cheng 2005 Transition from nonspeci c to speci c DNA interactions along the sub straterecognition pathway of dam methyltransferase Cell 1213497361 Huisman T T D Bakker P Klaasen and F K de Graal 1994 Leucine n li Hun J aenisch R and A Bird 2003 Epigenetic regulation of gene expressio L 4 NM Gen Jenuwem Jonsson A B Julio SMDM HeithotiDProvenzano K E KloseR L Slnshe Julio s M D M Heitholl R L sin KangSH Lee so A replication J Kapoor A E Agins andJ silencing by Karyagina A Klose R J and Klun oyr H K Ko Y G K Kobayashi 1 2001 EPIGENETIC GENE REGULATION IN BACTERIA 853 responsive regulatory protein IS1 insertions and the negative regulator FaeA control the expression of the fae K88 operon in Escherichia coli Mol Microbiol 115257536 Huisman T T and F d Graal 1995 Negative control of fae K88 expression by the global regulator Lrp is modulate t e local regulator FaeA and affected by DNA methylation Mol Microbiol 1694379 3 Humphries A D M Ra atellu 5 Winter E H Weening R A Kingsley Hgne redo s Khare J Nune L Adams Tsohs and A J Baumler 2003 The use of ow cytometry to detect expression of subunits encoded by 11 Salmonella enterica serotype Typhir murium mbrial operons Mol Microbiol 48135771376 g D L T L 39 39 Silhavy and S J Hnltgren 2001 Cpx signaling pathway monitors biogenesis and affects assembly and expression of P pili EMBO J 20150871518 R Droleskey s Zhang J M n et how 33Suppl245r254 Jal ri en and J M Calvo 2002 IZVIH operon expression in cherichi a chi requires Lrp binding to two distinct regions of DNA J Bacteriol 184 29375300 Jakomin M and J Casadestis Unpublished Jarb ata oe L R D kwith and J C Liao 2004 Stochastic modeling of the phasevariable pap operon regulation in uropathogenic Escherichia coli Biotechnol Bioeng 881897203 T and C D Allis 2001 Translating the histone code Science 293107471080 G rg and S Normark 1991 Phase variation of gonococcal pili by frameshift mutation in pilC a novel gene for pilus assembly EMBO J 10477488 r Jorgensen H F and A Bird 2002 MeCP2 and other methyerpG binding 93 proteins Ment Retard Dev Disabil Res Rev 8877 liner D A Low and M J Mahan 2001 DNA adenine methylase is essential for viability and plays a role in the patho enesis of Yersihia pseudctaberculcsis and Vibrw ctherae Infect Immun 69761077615 sheimer D A Low and M J ahan 002 DNA adenine methylase overproduction in Yersihia pseudzrtuherculcsis alters r 39 4 39 and 39 39 r 39 Infect Immun 70100w1009 Kahng L S and L Shapiro 2001 The Cch DNA methyltransferase of J Bacteriol 183306573075 nbach L S B A Braaten and D A Low 1995 Speci c binding of PapI to Lrpepap DNA complexes J Bacteriol 1776449764 H LII 6 b AH LIIUI H LII H ur on H LII H ax o H ax S H ax 5quot H HH H mm ax um UI E H n ax H on a N CASADESUS AND LOW portant for oxidation and transcriptional activation J Bacteriol 17712757 1284 Iprlarl unro Q 106 quot 39 39 39 nucleic acid in Escherichia coli Virology 273787387 Lemon K P and A D rossman 2 00 Movement of replicating DNA through a stationary replisome Mol Cell 6132171330 Levenson J M and J D Sweatt 2005 Epigenetic mechanisms in memory formation Nat Rev Neurosci 61087118 Lewis J D R R Meehan W J Henzel 1 ManrerFogy P Jeppesen F Klein and A Bird 1992 Puri cation sequence and cellular localization of a novel chromosomal protein that binds to methylated DNA Cell 699057 914 Liebert K A Hermann M Schlickenrieder and A Jeltsch 2004 Stoppedr ow and mutational analysis of base ipping by the Escherichia coli Dam DNAradeninerN6methyltransferase J Mol Biol 341443454 LobnerOlesen A Bo e and M arinus 1992 Expression of the Escherichi coli dam gene Mol icrobiol 61841718 1 MbnerOlesen A M G Marinus and F G Hanssen 2003 Role of Squ and am in Escherichia chi gene expression a globalmicroarray analysis Proc Natl Acad Sci USA 10046724677 Lobner01esen A 0 Skovgaard and M G Marinns 2005 Dam methy ylation coordinating cellular processes Curr Opin Microbiol 81547160 lodge J K K W o Haler and D E Berg 1991 Tn5 insertion specie city is not in uenced by IS50 end sequences in target DNA Mol Gen Genet 2283127315 w D A N J d and M J Mahan 2001 Roles of DNA adenine methylation in regulating bacterial gene expression and virulence Infect Immun 69 719777204 u M bell E Boye and N Kleckner 1994 Squ a negative modulator of replication initiation in E coli Cell 77413426 64 Lysnyansky 1 R Rosengarten and D Yogev 1996 Phenotypic switching of variable surface lipoproteins in Myccplasma batis involves highrfre quency chromosomal rearrangements J Bacteriol 178539575401 Malais J C P L Nordmann and W S Rezniko 1990 Integration host factor plays a role in 1550 and Tn5 transposition J Bacteriol 17213687 1373 Reference deleted Malone T R M Blumenthal and X Cheng 1995 Strucmreguided anal ysis reveals nine sequence motifs conserved among DNA aminormethylr I c c J 192 H o w bi 3 Munsky B 2006 NakayamaY and I Kobayashi 1998 Restrictionrmodi cation gene come 39r es Newman EB R Nicholson B an o f regulates Pap phase variation in E Nou X B Ski MICROBIOL MOL B101 REV o 139 ol 115557566 39 b h 39 39 Mol Micror The nite state projection algorithm for the solution of the chemical master equation University of California Santa Barbara unsky B and M Khamm 6 The nite state projection algorithm for the solution of the chemical master equation J Chem Phys 124 044104 Murray N E 2000 Type I restriction systems sophisticated molecular machines a legacy of Bertani and Weigle Microbiol Mol Biol Rev 644124434 plexes as sel sh gene entities roles of a regulatory system in thei tabr lishment maintenance and apoptotic mutual exclusion Proc Natl Acad Sci USA 95644276447 Nan X S 0055 and A Bird 1998 Gene silencing by methyerpGr binding proteins Novartis Found Symp 21 6716 D i and R T L39 1992 The leucineLrp regulon in E coli a global response in search of a raison d etre Oell 686177619 Newman E B and R Lln 1995 Leucinerresponsive regulatory protein a 7 global regulator of gene expression in E coli Annu Rev Microbiol 49 7477775 Low 2000 DNA methylationrdependent regulation d D f pe expression in Salmonella typhimurium Mol Microbiol 357287742 Noormohammadl A H P F Markham A Kanu K G Whithear and G F Browning 2000 A novel mechaan for control of antigenic variation in 39 39 quot 39 Mol Microbiol 359117923 NorregaardMadsen M B Mygind R Pedersen P ValentinHansen and I C J A J L 439 L 39 I I L39I39 homologue PPIase A in Escherichia coli is emresged from four prgmotr ers cite Lm 11quot i i regulated by the Cth repressor Mol Microbiol 149897997 Nou X B Braaten L Kaltenhach and D Low 1995 Differential binding of Lrp to two sets of pap DNA binding sites mediated by Pap I scherichia coli EMBO J 14578575797 nner B Braaten L Blyn D Hirsch and Low 1993 Regulation of pyelonephritisrassociated pili phaservariation in Escherichia coli binding of the PapI and e Lrp regulatory proteins is controlled by DNA methylation Mol Microbiol 7 457553 tran fera rs 4 195 Obata Y and T Kono 2002 Maternal primary imprinting is established at Biol 2536187632 a speci c time for each gene throughout oocyte growth J Biol Chem Malygin E G A A Evdokimov v v Zinoviev L G 0vechkina W M 277528575289 Lindstrom N o Reich 5 L Schlagman and s Hattman 2001 A dual 196 O39Driseoll J G F Fitzgerald and D van Sinderen 2005 A dichotomous 4 39 r L 0Lhemn bacteriophage T4 Dam DNArN6radeninermethyltransferase Nucleic Acids tion system Mol Microbiol 57153271544 Res 29236172369 197 O39Driseoll J F Glynn 0 Cahalane M O ConnellMotherway G F Malygin E G B Sclavi v v ZinovievAA Evdokimov s Hattman and Fitzgerald and D Van Sinderen 2004 Lactococcal plasmid pNP40 enr ckle 2004 Bacteriophage T4 Dam DNAradeninerN6rmethylr codes a novel temperamresensitive restrictionrmodi cation system Appl transferase Comparison of presteady state and single turnover methy r Environ Microbiol 70554675556 ation of 407mer duplexes containing two unmodi ed target sites J Biol 198 A V M Thiberge L Ielpi A Chem 27950012750018 Marczynski G T and L Shapiro 2002 Control of chromosome replica tion in Caulcbacter crescehtus Annu Rev Microbiol 566257656 Marinus M G 1 8 A methylation in uences trpR promoter activity in Escherichia chi Mol Gen Genet 2001857186 Marinus M G 1996 Methylation of DNA p 7827791171 F C Neidhardt et al ed Escherichia chi and Salmchella cellular and molecular biology 2nd ed ASM r 39 n C Martin C 1996 The clp CS31A operon is negatively controlled by Lrp ClpB and Lralanine at the transcriptional level Mol Microbiol 212817 292 McClelland M 1985 Selection against a39arri methylation sites in the ge nomes of DNA of enterobacteriophages J Mol Evol 213177322 McCommas S A and M Syvanen 1988 Temporal control of transposir tion in Tn5 J Bacteriol 170889894 McEwen J and P Silverman 1980 Genetic analysis of Escherichia chi K712 chromosomal mutants defective in expression of Frplasmid functions identi cation of genes cpitA and cpr Bacteriol 14460767 Mille s E Kntter G Mosig F Arisaka T Knnisawa and W Ruger 2003 Bacteriophage T4 genome Microbiol Mol Biol Rev 67867156 Modrich P 1989 Methylrdirected DNA mismatch correction J Biol Chem 264659776600 and K Skarstad 2004 Replication fork and Squ focus dis tributions in Escherichia coli suggest a replication hyperstructure depenr dent on nucleotide metabolism Mol Microbiol 52159 771612 Morgan H D F Santos K Green W Dean an Reik 2005 Epige netic reprogramming in mammals Hum Mol Genet 14Spec No 1R47r R58 Morisato D and N Kledmer 1987 Tn10 transposition and circle formar tion in vitro Cell 511017111 Morschhanser J v Vetter L Emody and J Hacker 1994 Adhesin regulatory genes within large unstable DNA regions of pathogenic Eschr 8 w O Rourke E J c Chevalier L d J oshima T c Wada Y Kawagoe T E to E3 to to to w a N to w to to 9 VOL 70 2006 Prieto A 1 1 Segura F RamosMorales and J Casadesus Unpublished data Puuciarelli M G A I Prieto J Casadesus and F Garciadel Portillo 2002 Envelope instability in DNA adenine methylase mutants of Salmor nella enterica Microbiology 148117171182 Raivio T L and T J Silhavy 1999 The sigmaE and Cpx regulatory pathways overlapping but distinct envelope stress responses Curr Opin Microbiol 21597165 Ramseier T M and M H Saier Jr 1995 cAMPrcAMP receptor protein complex ve binding sites in the control region of the Escherichia coli mannitol operon Microbiology 141190171907 Reik W W Dean and J Walter 2001 Epigenetic reprogramming in mammalian development Science 293108971093 Reisenauer A L S Kahn S Me 0 um and L Sha iro 1999 Bacterial DNA methylation a cell cycle regulator J Bacteriol 181513 7 139 Reisenauer A K Quon and L Shapiro 1999 The CtrA response regur lator mediates temporal control of gene expression during the Caalcbacter cell cycle J Bacteriol 181243L24 9 Reisenauer A and L Shapiro 2002 DNA methylation affects the cell cycle transcription of the CtrA global regulator in Caulobacter EMBO J 21496944977 Rezniko W S 1993 The Tn5 transposon Annu Rev Microbiol 479457 963 Ringquist S and C L Smith 1992 The Escherichia coli chromosome contains speci c unmethylated dam and dcm sites Proc Natl Acad Sci USA 89453944543 Roberts D B c Hoopes W R McClure and N Kleckner 1985 1510 transposition is regulated by DNA adenine methylation Cell 431177130 Roberts R J 1978 Restriction and modi cation enzymes and their recog nition sequences Gene 41837194 Roberts R J M Belfort T Bestor A S Bhagwat T A Bickle J Bitinaite R M Blumenthai S Degtyarev D T Dryden K Dybvig K Hrman E S Gromova R I Gumport S E Halt ord S Hattman J Heit man D P Homby A Janulaitis A Jeltsch J Josephsen A Kiss T R Klaenhammer I Kobayashi H Kong D H Kruger S Lacks M G Marinus M Miyahara R D Morgan N E Murray v Nagaraja A Piekarowicz A Pingoud E Raleigh D N Rao N Reich v E Repin E U Selker P c Shaw D c Stein B L Stoddard W Szybalski T A autner J L Van Etten J M Vitor G G Wilson and S Y Xu 2003 A nomenclature 39 39 NA 39 and their genes Nucleic Acids Res 31180571812 Robertson G T A Reisenauer R Wright R B Jensen A Jensen L Shapiio and R M Roop II 2000 The Bmcella abartus Cch DNA methylr tran ras is essential for viability and its overemression attenuates intrar cellular replication in murine macrophages J Bacteriol 182348273489 SatputeKrishnan P and T R Serio 2005 Prion protein remodelling confers an immediate phenotypic switch Natlire 4372627265 bri M A L Hjerrild M Gjermansen and P Klemm 2003 Difr ferential expression of the Escherichia chi autoaggregation factor antigen 43 J Bacteriol 185223672242 Schembri M A and P Klemm 2001 Coordinate gene regulation by mbriaerinduced signal transduction EMBO J 20307473081 Schlagman S L and S Hattman 1983 Molecular cloning of a functional dam gene coding for phage T4 DNA adenine methylase Gene 224397 156 Schlagnian S L S Hattman and M G Marinus 1986 Direct role of the Escherichia chi Dam DNA methyltransferase in methylationrdirected mis match repair J Bacteriol 16589S900 28 Schlagnian S L z Miner z Feher and S Hattman 1988 The DNA adeninerN6methyltransferase Dam of bacteriophage T4 Gene 735177 530 Scott T N and M 1 Simon 1982 Genetic analysis of the mechanism of the Salmonella phase variation site speci c recombination system Mol Gen Genet 1883137321 Selker E U M Ereitag G 0 Kothe B S Margolin M R Rountree C lis and Tamaru 2002 Induction and maintenance of nonsymr metrical DNA methylation in Neurospora Proc Natl Acad Sci USA 99Suppl 416485716490 Serio T R A G Cashikar A S Kowal G J Sawicki and S L Lindquist 2001 Selfrpel39petuating changes in Sup35 protein conformation as a mech anism of here 39ty in yeast Biochem Soc Symp 683543 Serio T R and S L Lindquist 2000 Proteinronly inheritance in yeast something to get PSIrched about Trends Cell Biol 10987105 Shea c M and M A Md o 39 n neti organization of the ferric enterobactin transport system homology to other periplasmic binding proteinrdependent systems in Escherichia coli Mol Microbiol 5141571428 Shier v K C J Hancey and S J Benkovic 2001 Identi cation of the Caulobacter crescentlis J Biol Chem 27614744714751 Short r J and S Lindquist 2005 Prions as adaptive conduits of memory and inheritance Nat Rev Genet 64354450 EB E 53 St Stemberg N and J Stemherg N Taghhalout A A LandoulsiRKem M Yamazo I t nsf npro B b 8 b Torreb ans 9 9 0 o Urig S H Gowher van der Woude M B Braaten and D Low 1996 variation of the pap operon in Escherichia coli Trends Microbiol 4579 van erW Hal EPIGENETIC GENE REGULATION IN BACTERIA 855 S and D N Rao 2004 SrAdenosylrerethioninerdependent rer tl striction enzymes Crit Rev Biochem Mol Biol 39 1719 Smith D W A M Garland G Herman R E Enns T A Baker and J W Zyskind 1985 Importance of state of methylation of oriC GATC sites in initiation of DNA replication in Escherichia coli EMBO J 4131971326 Smith H 0 and D Nathans 1973 A su ted nomenclatlire for bacter rial host modi cation and restriction systems and their enzymes J Mol Biol 814194423 Labany M Lahooti J A Plumbridge and I c Sohanpal B K S El Blom eld 2004 Integrated regulatory responses of mB to Nracetylneurr aminic sialic acid and GlcNAc in Escherichia coli K712 Proc Natl Acad Sci USA 10116322716327 Srikhanta Y N T L Maguire K J Stacey S M Grimmond and M P Jennings 2005 The phasevarion a genetic system controlling coordinated random switching of expression of multiple genes Proc Natl Acad Sci USA 102554775551 Stancheva 1 T Koller and J M Sogo 1999 Asymmetry of Dam re methylation on the leading and lagging arms of plasmid replicative interr mediates EMBO J 18654276551 ephens c A Re senauer R Wright and L Shapiro 1996 A cell cyclerregulated bacterial DNA methyltransferase is essential for viability oc Natl Acad Sci USA 93121071214 Pr Stephens C M G Zweiger and L Shapiro 1995 Coordinate cell cycle control of a Caalcbacter DNA methyltransferase and the agellar genetic hierarchy J Bacteriol 177166271669 S m A and T F Meyer 1987 Common mechanism controlling phase and antigenic variation in pathogenic neisseriae Mol Microbiol 15712 Coulby 1990 Cleavage of the bacteriophage P1 packaging site pac is regulated by adenine methylation Proc Natl Acad Sci USA 8780703074 B Sauer R Hoess and K Abremski 1986 Bacteriophage 1 cre gene and its regulatory region Evidence for multiple promoters and for regulation by Dam methylation J Mol Biol 18719 77212 SunWandSHatman1 39 998 Bidirectional transcription in the mam Mol Biol 284885392 S Cheng D L Smith and J A McCloskey 1983 Puri cation and characterization of the unusual nuclear tid arNr9rerr2 rdeoxyribofuranosylpurinr6rylglycinamide speci ed b the phage Mu modi cation function Proc Natl Acad S


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Jim McGreen Ohio University

"Knowing I can count on the Elite Notetaker in my class allows me to focus on what the professor is saying instead of just scribbling notes the whole time and falling behind."

Jennifer McGill UCSF Med School

"Selling my MCAT study guides and notes has been a great source of side revenue while I'm in school. Some months I'm making over $500! Plus, it makes me happy knowing that I'm helping future med students with their MCAT."

Bentley McCaw University of Florida

"I was shooting for a perfect 4.0 GPA this semester. Having StudySoup as a study aid was critical to helping me achieve my goal...and I nailed it!"


"Their 'Elite Notetakers' are making over $1,200/month in sales by creating high quality content that helps their classmates in a time of need."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.