New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

Introductory Zoology

by: Selmer Parker

Introductory Zoology ZOO 1114

Selmer Parker
GPA 3.68

Douglas Gaffin

Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

Douglas Gaffin
Class Notes
25 ?




Popular in Course

Popular in Animal Science

This 38 page Class Notes was uploaded by Selmer Parker on Sunday October 25, 2015. The Class Notes belongs to ZOO 1114 at University of Oklahoma taught by Douglas Gaffin in Fall. Since its upload, it has received 21 views. For similar materials see /class/229238/zoo-1114-university-of-oklahoma in Animal Science at University of Oklahoma.


Reviews for Introductory Zoology


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 10/25/15
Zoology 9302010 33500 PM Characterizing Life o Fire Life symbolism What is Zoology o science dealing with or relating to the study of living animals What is Life What does it mean to be alive to be living o Life the general condition that distinguishes organisms from inorganic objects and dead organisms o Organism a complex structure of interdependent and subordinate elements whose relations and properties are largely determined by their function in the whole an individual constituted to carry on the activities of life by means of organs separate in function but mutually Richard Dawkins the law that all life evolves by the differential of replicating entitiesquot The Five Characteristics of Life o Organization 0 Hierarchy of Organization Atoms gt Complex Biological Molecules gt Subcellular organelles gt Cells gt Tissues gt Organs gt Organ Systems gt Organism gt Population gt Community gt Ecosystem Level gt Biosphere Try and Give Examples of Each Say something about each of these levels 0 Emergent Property A quality that appears as biological complexity increases Example two pieces of a hammer alone they are hard to hammer a nail but together they complete a task Hydrophilic likes what phospholipids Hydrophobic afraid of water phospholipids Endothelial cell but a sheet of endothelial cells can become a tube capillary o Energy Use 0 Producer Consumer Decomposer 0 Two Laws of Thermodynamics 1 Energy cannot be created or destroyed energy of the universe is constant does not break the second law 2 Ever process increases the entropy of the universe a entropy measures of disorder Organisms maintain order at the expense of increased entropy of their surroundings 0 Does Life Break these laws Organisms are Open Systems o Maintenance of Internal Constancy Homeostasis 0 Negative Feedback Systems Promote Homeostasis Fight the change Ex Room gets to cold heater turns on room gets to hot heater turns off and AC turns on o Reproduction life comes only from life Growth and Development o Evolution 0 Adaptation an inherited trait that enables an organism to successfully reproduce in a given environment survival of the fittest that go on to reproduce Camouflage aids predators born with camouflage evolution Natural Selection enhanced survival and reproductive success of certain individuals from a population based on inherited characteristics Ex variation in heritable traits Prevailing conditions Differential reproducing The Diversity of Life o All life on Earth is made of 1 or more cells 0 All cells 0 O Have similar chemical makeup and processes Have DNA that uses the same genetic code B Cells can read other life forms information our cells in bacteria would make our proteins Have ribosome s protein factories Have a plasma cell membrane Acquire nutrients amp expel wastes Woese s 3 domains based on genetic ara analysis 0 2 domains Archaea and Bacteria contain only prokaryotes prokaryotes lack nuclei 0 1 domain Eukarya contains everything else Eukaryotes have nuclei n In book figure 19 Where does this leave viruses 0 They aren t cellular by themselves you can t really put them in any kingdom or domain The bacteria that cause tooth decay 0 Kingdom Bacteria The organisms that cause amoebic dysentery 0 Kingdom Protista Onecelled organisms found in hot springs 0 Kingdom Archaea The organisms that cause jock itch 0 Kingdom Fungi Tapeworms 0 Kingdom Animalia Mistletoe 0 Kingdom Plantae HIVAids 0 None There is Unity in Diversity 15 million species named estimated diversity 540 million from cells down all life is similar Taxonomy branch of biology concerned with naming and classifying organisms o Taxonomy Domain n Kingdom o Phylum 0 Class Order a Family Genus 0 Species Taxonomy Humans Domain Eukarya Kingdom Animalia Phylum Choradata Class Mammalia Order Primates Family Hominidae Genus Homo Species sapens say both parts of genus and species Taxonomy Desert grassland scorpion Domain Eukarya Kingdom Animalia Phylum Anthropoda Class Arachnida Order Scorpionida Family Vejovidae Genus Paruroctonus Species utahensis O O O O O O O O O O O O O O O O The Nature of Science What is 0 Science comes from the Latin verb meaning To Know The Scientific Method 0 Make observation9 ask a question 9 consult prior knowledge 9 formulate a hypothesis 9 design experiment 9 collect and interpret data 9 consult prior knowledge 9 draw conclusions 9 peer review 9Publish a good Hypothesis Is it a possible explanation for an observation Is it testable 0 Clearly testable so you can say yes or no It is the if in if in front of hypothesis and place before experiment then place before conclusion Experimental design 0 The power of numbers in general the larger the sample size the better o Dependent variable variable in which you are looking for an effect usually the Y axis 0 Independent Variable variable that causes the effect on the dependent variable X axis usually 0 Standardized variable anything held constant for all subjects in the experiment 0 Placebo inert substance used as an experimental control o What Science is 0 Understanding how nature works based on objective evidence that includes reproducible experimental data and measurements and observations o What Science Isn t 0 Art astrology creationism extrasensory perception fortune telling healing crystals philosophy psychic phenomena reincarnation religion telekinesisetc Basic Chemistry o A Composition of matter o B Chemical Bonds 0 1 Ionic bonds 0 2 Covalent bonds 0 3 Hydrogen bonds o 15 In lecture packet Look over and make sure you know o Element a substance that cannot be broken down to other substances by ordinary chemical means 0 Elements Essential to Life Bulk elements need to know these 11 n Oxygen 65 a Carbon 185 a Hydrogen 95 Nitrogen 35 n Calcium n Phosphorous n Potassium make up 4 percent a Sulfur Sodium n Chlorine n Magnesium Trace Elements n Example iron copper iodine magnesium zinc n Coenzymes The number of protons determines what the element is 0 Compound two or more elements combined in a fixed ratio 0 Mixture two or more substances in no fixed ration Subatomic Particles o Particle MassDaltons Charge o Neutron 1 0 o Proton 1 1 o Electron 1200 1 o 1 Dalton 17 x 10A23 o in a neutral atom protons electrons Atom o Relative size if a cherry is increased to the size of Earth then how big do you think the original atoms arethe size of cherries o If diameter of atom is increased to the size of the Astrodome then nucleus size of fly Molecular Mass obtained by adding the atomic o Example H20 Chemical Bonds o Ionic Bonds a chemical bonds between ions of opposite charge 0 Ionan atom that has gained or lost electrons o Cation and Anion bond together o Covalent Bonds sharing of electrons between two or more atoms 0 Methane has 4 covalent bonds CH4 o Hydrogen Bonds the attraction of the hydrogen atom of one molecule for a strongly electronegative atom eg NO in an adjacent molecule or within the same molecule 0 holds your DNA together Water and Life o Water is both cohesive and adhesive o Cohesive is water with itself adhesive is water with other things o Water is a good solvent 0 pH logH o 1very acidic 14very basic7neutral 0 blood 735745 Example n pHlog10 7M so the pH 7 a pH log10 2M so the pH 2 o high heat capacity specific heat 1caloriegramdegree Celsius 0 this means water is capable of taking a lot of energy in without having its temperature change much o high heat of vaporization 0 Ex sweating evaporative cooling o Expands when it freezes o Know how these relate to hydrogen bonds and the electronegativity of oxygen Organic Compounds Chemical Reactions 0 Types of Reactions Synthesis n A B 9 AB o Dehydration synthesis water molecule is lost as a bond is formed Decomposition n AB 9 A B o Hydrolysis bond is broken through the addition of water 0 Monomers small single unit molecules 0 Polymers linked monomers o Carbohydrates CnH20n o Monosaccharide s Simple sugars 37 carbons straight chain or ring a Examples glucose ribose fructose o 2 monosaccharide s joined via dehydration synthesis xample sucrose maltose lacmse o polysaccharides long chains of monosaccharide s important in stora e u Example starch plants glycogen animal Lipids o Triglyceride and fatty acids d and unsaturated u Saturamd r all single bonds as many hydrogen s as it can hold example butter u Unsaturamd 7 double bond give up two hydrogen s kinkylike oil o Phospholi s Phosphatidyl choline Lecithin a phospholipid o Sterols Cholesmrol I Steroid hormones n Vitamin D Proteins Amino acids The building blocksquot of promins I 20 amino acids 8 are essential I Basic Structure of Amino Acid amino gm cmbnxyl group animal strm39nlrr onquot r am mi ac39 R is the only thing that changes 0 Pepu39des Dehydratmn shythests Pepnde band PEPWJE 5mm u Strumura evets Dfpmtems anary Stru re a Sequence nfammn amds Secundary Structure he speeme shapes Atpha 2W etaspteated sheet see We a beun nfammn amds Where yuu see a whate bundw nfammn ands temmg back arr ttsem 5th has hydrugen bands ane strand 1 curmnuuus pawpeptme a Ternary Structure Eurmnun Quaternary Structure a Mare than me beun nfammn amds m Wu separate 777sph2r25777 mare than me pawpeptme strands hydrugen bundmg between them Enzymes s catatyze reaetmns s 1 gets Wu thmgs tngether ta term a synthests RNAV Rmus mRNA Dwsu de hands if HRTEEN arm qu headed 06 45 m bndv 23 m awe awav Dmes RNA 6 H OH Sugay CEHS CeHmar Basws m We a Same stturv Hunke man39s 7 ubservmg cnrk mssue 7 tamed term caHu ae Van Leeuwenhnek 157D39S used smg eJensmmmscDDe m ubserve mmurgamsms Brawn man39s 7 nuc eus Schleiden 184039s cells present in all plant tissues nucleus somehow important in reproduction Schwann 14039s reported cells in animal tissus o The Cell Theory proposed by Schleiden and Schwann a all organisms are composed of one or more cells the cell is the basic living unit organization Virchow 1855 a All cells come from preexisting cells Variations on a cellular theme o major kinds of cells based on structural organization Prokaryotic no membranebound nucleus or organells a Bacteria Archaea Eukaryotic membranebound nucleus and organelles a Protista Plantae Fungi Animalia Why aren39t we one big cell more surface are compared to the volume when large if we get to big we have to much enzymes to deal with Surface Area to volume ratio Bacteria Archaea Eukarya nmals Chlamflexus Fquotquot9 Pumie bacteria Chloroplast Cyanobacrana Fiavobac T chonomads NEW Mlcmsporidia Diplamonads Common Ancestor A generalized animal cell smooth endoplasnic plasma 57 membrane quot 1 i mitochondrion 4 nuclear pore v Iysosorne rou h endgplasnic re wlum quottlear nucleolus ma39nbrme nucleus Parts of a generalized animal cell 0 Nucleus nuclei Contains chromatin DNA and proteins averages about 5 microns diameter enclosed by nuclear envelope a Double membrane a Pores regulate molecular transport contains nucleolus Ribosome synthesis 0 Mitochondria mitochondrion M ochnndrla Inner Structure mner Mlmx Figure 1 Cuntam nbnsnme39s and same DNA FEW tn thnusands dependmg an the sen Endnsed bv 2 membranes are er ceHmar resmrauun a Rmasam 395 Pmtemsynmesws Prutems Wm functan m cvmsm Bnund Pmtems desuned fur membrane mdusmn Dr 2x art N membranerbnund Pmkarvntes have ansnme39stnn StrEDmmvmn tetracychne mmmr bactena nbnsnme39s a Endup asmm r tmumm rename 39 ms de thnp asm n twnrk continuous with outer membrane of nuclear envelope a Smooth ER o Lacks ribosome s o Synthesis of lipids phospholipids steroids o Carbohydrate metabolism o Stores calcium ions in muscle contraction n Rough ER o Studded with ribosome s o Synthesis of new membrane and proteins destined for secretion 0 Golgi Apparatus Modifies stores routes products of the Endoplasmic Reticulum o Lysosomes Membrane enclosed bad of hydrolytic enzymes Digest all classes of macromolecules Recycle cell s own organic material 0 Peroxisomes Membranebound In all eukaryotic cells Help cell use oxygen Disables oxygen freeradicals Remember o These are generalized cells 0 Numbers and types of organelles can vary Example cells that secrete a lot of proteins would have lots of what organelles n Rough ER Golgi apparatus Example cells using lots of energy would have lots of what organelle n Mitochondria Animal vs other eukayotic cells a Not found in animal cells o Chloroplasts only plants and some protists o Cell wall plants fungi o Vacuole plants fungi protists u Found ONLY m anrrna ceHs Lvsososomes Centrwo es Wnrcn We39H ta k about ater Tne EndosvmbwontTheorv a av e e earw Eukarva carne about from bactena and archaea The tie Membrane S c we a Phosphode Poarnead group a nvdropnmc Non po artaw a Hvdrophobxc a In me ceH IntraceHu ar a Outsrde tne ce Extraceuar umar lace n m n rho a W PG 3 wdmunamc vasn Vu wd mm mm and 3 gt J mmnswoumn sugav sms mm maqu mensc urmems mum Aemwvsm vmlem may lace anamycapaaa m I Funct ons of Membrane Protems a T ansporte or c ermca s across membrane a A an Enzyme a As a receptor srte For chermca messenger sudn as normones Hg 3 y 0 Cell adhesion 0 As attachment site for cytoskeleton Diffusion osis The movement of water through a semipermeable from high concentration to low concentration of water Water moves towards the high solute concentration Concentrated Dilute sugar water molecules passes su ar I solution through not sugar solution partially 39 permeable membrane OsmoSIS sugar water molecules molecules gradient a gradual change in some quantitative property of a specific distance ower Concentration 6 Higher Ooncentration Permeability o Membrane Stmcture and Function Selective Permeability a some substances cross more easily than others 1 Permeability of lipid bilayer nonpolar hydrophobic molecules s asily eg Oxygen a polar molecules small polar uncharged pass easily example Water and Carbon Dioxide a larger uncharged do not pass easily eg glucose must go through a door a 5 mm naye armeuny passmg 2 Transpurt brbter a brbyrde a nyurbbnme channe a mavement by amrye transpnrt ATP needed erbm D Em es a Endbeytbsrs 7 new takes m maerbm D Em es by furmmg vesu es rrbm p asma membrane a Emey bars a secretmn D ma rbm D EEMES But bf eeu by Man vaesu es wrtn p asma membrane HDW DD CeHs Rexease EnergW Fur yDur neurnns m Wurk yDu naye m naye the sndmm putassmm pumps gmng at 5 nmes D b CeHmar respwratmn an Arprbrbuuung catabuh brbbess m wnren the umm ate abutan acceptnr rs an marganu ma ecme such as nygen b ATP Adennsme tnphusphate mntams unstab e phnsphate bands that the eeu hydm yzes fur energy AuEMwE THZ macs Pnospnnz snows OH on a Adenosine triphosphaxs m make energy yDu take an bne bnne phnsphate grnups eat a phnsphate grnup m pDWEr beH o Substratelevel phosphowlation ATP production by direct enzymatic transfer of phosphate from an intermediate substrate to 0 And enzyme gets involved to help the transfer 0 SLP Chemiosmotic phosphyoryation ATP production coupled to transfer of electrons from food to oxygen oxidative phosphorylation o CoP a an Glucose l Hexokinase ADP gt4 cHzogtB H u i no quot N on eoicu2 o carafe Ho GIucose Dl lisphate quot H quot Fructo B Phasphoglumnsnmerase Misphgsphaga CMHB Aldolase 0 man n no H on He u 9 Isomerase so c o Fructose6 phosphale W W igt lm 2 lt2 airway phosphale apllospllale ADP Cuwwhiovem Education Inc INDIN VW as Benimmeummmgs o 2 NAD Triose phosphate dehydrogenase 1 aEisphnsphaglycerate 2 ADP Phosphcglyceroklnase 2 7 2H0H cu oi 3Pllosphoglycerate Phosphoglyceromutase Ouuywhl veulwm magnum m nuwsmmus wmmmmmmmg o c o H7 707 cnon 2Phosphoglycerale 2 NAD Triose phosphate dehydrogenase 2 2 1 2 H39 Lzo 2 97070 Hicioi cHoH Hon T 2Phosphoglycerale CH1 7 Enclase 2 1 JBisphosphoglycerale 2 AD P Phosphoglycerokinase 2 7 ezo IfHOH CH1 707 3Phnsphoglycerate Fhosphoglyceromutase 0 797E oogo CH2 Phosphoenolpyruvale 2 ADP 3 2 Pyruvale kinase oo Angngo CH Pyruvate CaWWhloPellwn Educahon m quotmmm mmmcmmm Glycolysis 2 ATP 2 NADH Pyruvic Acid NADH 2NADH Krebs cycle 2 ATP 5 NADH 2 FADH 2 Electron transport chain ATP 10 NADH X 25 25 2 FADHZ X 15 3 8 2 25ATP4ATP TOTAL 30ATP DNA Structu re DNA Reohcatron Cornohcatrons o Rephcatron proceeds m bubb es brdrrectronaHv at mump e 5W5 0 DNA ooNrnerases onN can add nudeotwdeS m one drrectron Thev can onN add to one end on tne 3 onne end a 3 onne 7 references tne carbons on tne Sugar so rt rneans rts on tne 339d carbon 0 Tne how can rephcatron proceed m botn drrectrons 539 339 539 339 539 339 o Hehcase unWmdS parenta doub e hehx o Brndrng protems separate strands o pnrnase adds snort pnrner to temp ate strands 0 DNA poNrnerase bmds nudeotwdes to torrn new strands DNAWWMSEM on gadmg smu Lcam q arm yywir Leadmg sum evrobze Hugm wand NA WWW f s t I 39 omen axiom unmmmrr WWWquot o o Ligase joins Dkazaki fragments and Seam otner nicks in Sugar obosobate backbone M tOSiS The process ofnuc ear division that occurs in Somatic bodv ceHs c2 Druduces 2n dauuhter ceHs 32 Late marphasa a can checksfnr cummzte DNA rephcaunn hase PrDD resmts m ma mamtenance m chmmnsnma number m 2 2n parent H 25 candanse became wswb e Emma apparatus am Nudear Envemuefragmems summa bars attach m kmmcharas Metauhase a Chmmnsnmes ahgn a ung equamr m can Anauhase 0 Sister chromatids now called chromosomes separate to opposite poles of cell 8 chromosomes0 chromatids o Telophase 0 Nuclear membranes assemble around two daughter nuclei Chromosomes decondense Spindle disappears o Cytokinesis 0 Division of the cytoplasm into two cells o G1 early interphase 0 Of daughter cells Cells resume normal function Review To which of the domains of life do you belong o Eukarya Animalia A scientist measures the oxygen consumption of rats while they are resting walking and running through a maze Which of the following is true o know dependent and independent oxygen consumption is dependent The following can be compared quantitatively Use the choices below to compare the pairs of statements The number of protons in an atom is known as its atomic number Know how to compare element radius size Down and to the left Which of the elements is most likely to participate in an ionic bond Nitrogen is much more electronegative than hydrogen Which of the following statements is correct about ammonia answer Each hydrogen atom has a partial positive charge The nitrogen atoms has a strong positive charge Each hydrogen atom has a slight negative charge The nitrogen atom has a partial positive charge There are covalent bonds between the hydrogen atoms Which of the following is strongest o hydrogen The bond between two complementary bases of DNA o Answer Covalent The bond between H and O in one water molecule o Ionic The bond between NA and CL in a salt crystal What type of bonds hold together a molecule of methane o Nonpolar covalent Which of the following is NOT a characteristic of water o Cohesive o Adhesive o answer Low heat capacity o High heat of vaporization o Expands when it freezes Something that has peptides in it o Proteins Where are sterols involved o Lipids Glycogen involved o Carbohydrates Which of the following is an example of a complex carbohydrate o Glucose o Fructose o Ribose o Glyceraldehyde o Answerglycogen The monomers that make up DNA are known as o Nucleic acids o Amino acids o Fatty acids o answer Nucleotides o Nuclesomes Site where amino acids are joined to form proteins is o Nucleus o Nucleolus o Answer Ribosome o Smooth endoplasmic reticulum o Lysosome Animal cells are unique from those of all other multicellular organism in that they answer Lack cell walls Contain vacuoles Contain the most organelles Are the most complex Always contain a single nucleus If you were to insert a pin into an animal cell so that it pierced the cell membrane 2 completely through a mitochondrion 8 complexly through a lysosome 4 completely through a free ribosome 0 and through the nuclear envelope 4 stopping at the nucleolus 0 how many phospholipids layers would the pin have crossed o 9 o 14 o answer 18 0 24 if you were to insert a microscopic pin into an animal cell so that it pierced the cell membrane passed completely thorough a mitochondrion passed completely through a free peroxisome 4 passed completely through a free ribosome passed completely through a lysosome and through the nuclear envelope stopping at the nucleolus how many phospholipid layers would the pin have crossed o 14 o 18 o 20 o 22 o 24 which of the following groups have ribosome s in their cells o eukarya o protista o bacteria o archaea c all of the above answer which of the following groups have endolplasimc reticlua in their cells o eukarya answer o bacteria o archea o prokaryotes c all of above The endosymbiosis hypotheseis postulates that a host aerbic o eukaryote bacterium o eukaryote archean o bacterium archaean o bacterium eukarytoe o archaen bacterium answer engulfed an Which of these are found in both prokaryotes and eukarytoes o Mitochondrion o Ribosome answer o Lysosome o Endoplasmic reticulum o Golgi apparatus Which of the following organelles is incorrectly matched with a kingdoms in which it occurs o Mitochondrion kingdom Fungi Kingdom Bacteria which of the following is are function s of membrane proteins o Cell adhesion o Transport o Attachment o All of the above answer Which of the following should be able to cross the lipid bilayer easiest C6H1206 Polar o CH4 answer o CA Ions o NH3 Polar o Both A and D Which of the following would pass through the cell membrane most easily o Disaccharide o Nonpolar molecules like 02 answer 0 H o Protein o Calcium ion Where do you find chemiosmotic phosphorlyation o Glycolsis o Kreb s cycle o Electron transport chain answer o Lactic acid fermentation All Which of these takes place in the matrix of mitochondrion o Glycolsis o Krebs cycle answer o Electron transport chain c Lactic acid fermentaion Which of these produces 2 NADH for each glucose metabolized o Glycolysis answer o Krebs o Electron transport chain The oxygen we inhale with each breath functions as an electron acceptor during this statge of aerobic respiration o Glycolsis o Krebs o Citric acid cycle o Fermentation o Electron transport chain answer Where withink the mitochondrion would you expect to find the highest concentraion of hydrogen cations H o Cytoplasm o Intermembrane space answer o Mitochondrial matrix o Nucleolus o None of above During glycolysis glucose o 0 answer 0 1 o 2 o 3 4 molecules of FADHZ are produced per molecule of I How many ATP could be produced if you injected with one acetyl CoA injected into the mitochondrial matrix 0 5 o 9 o 10 answer 0 020 What unwinds the double helix o ligase o helicase answer o binding proteins o DNA polymerase o Gravy What assist the binding of Okazake fragments o Ligase answer o Helicase o Binding proteins o Dna polymerase o Gravy Which of the following statements is true o In prophase the sister chromatids separate o In metaphase the sister chromatids begin condensation o In telophase the nuclear membrane begins to form answer o In anaphase the chromosome move to the spindle equate Which of the stage of mitosis is essentially the opposite of prophase in terms of changes in the nucleus o Telophase Which of the following would occur during the stage of mitosis immediately before this stage o Centromeres break in anaphase If the diploid number for some animal is 20 how many chromsomes would there be in a hear cell during G2 interphase o 20 same question but metaphase o 20 same question prophase o 20 same question ananphase o 40 same questions chromatids G1 0 0 chromatids metaphase o 40 Chromosome G1 0 20 Chromatids G2 0 40 Chromatids anaphase o 0 Zoology RICHARDS HALL 207 9302010 33500 PM From Gene to Protein o Overview of Protein Synthesis o Transcription o Translation o Gene Regulation in Bacteria o Gene regulation in Eukaryotes o Mutations Remember proteins o Building Blocks were amino acids 0 Peptide bondsdipeptide bonds o Protein Synthesis 0 DNA codes for proteins 1 Transcription transfer of information from DNA to mRNA strand n in nucleus 2 Translation the transfer of info from mRNA into a polypeptide n in cytoplasm ribosome s Replication 9 Transcription 9 Translation in S phase and G1 phase or possibly G2 im not really sure 123 Transcription of RNA from DNA o DNA template strand 9 DNA coding strand o RNA polymerase always falls on the template strand 0 Transcription9 splicing 9 Transcription o See Fig 1211 talks about TATA factor TATA enzymeprotein and RNA polymerase o In us Eukaryotes are going to splice out the introns o In your DNA you have intervening sequences of code o mRNA cap on 5 prime end then the Poly A tail on the 3 prime end c We need to be able to talk about the Transcription process Translation o All of transcription leads to the production of proteins o 20 amino acids 4 nucleotides 0 11 code only 4 amino acids 0 doublet code only 16 amino acids 0 triplet code 64 amino acids o mRNA language translated into a growing polypeptide language o tRNA t stands for translator is the translator 0 picks up amino acids 0 recognizes codons on mRNA contains anticodons 0 Translation Elongation Always starts with methionine Fig 128 AUGAUACUCAUUAAGGAGACUGAGGCAUGA MStartI L I K E T E A Rstop The Genetic Code u c A 1 G l i j UUU lUCU UAU UGU Emquot musine Mteine U U UUC al nme ucc 5 UAC use 3 arms l UCA E at l Stop A g a i E LEW lUCG p lmumunmre cuu lccu iii can u l lt tldlne CUC CCC ggg CGC I C Leucine U Ill 0mm 1 Arglnlne cu ccn can A Qutamlge cuc ccc 266 G nuu A cul l u l u I paragge Elna AUC so ucine ACC MAAC lAGC C II 39 i VAUA ACA Jeonlne l A H A SIFIE l39 IFIIHE m Methioninql cc 1AM L J G cuu As amc ccu u cuc loco 6116 add GGC C Mine l nine cine cuc lGQGS AG acid 66 G Regulation of gene expression Don t want to express whole genome at once 0 All organisms respond to changing conditions 0 Multicellular eukaryotes have specialized cells 0 Specialization cells express different genes in same DNA 0 Examples Cell type Pancreas Eye lens Nerve Glycolysis enzyme x x x Crystalline gene x Insulin gene x Hemoglobin gene o Enzyme induction the lac operon 0 Fig 1210 Gene Regulation in Eukaryotes o About 10 of DNA codes for transcription factors 0 Zinc finger o Helixturnhelix o Leucine zipper o Helixloophelix o Steroid receptors o SexEducation o Lipidsoluble hormone secrete hormone passes through cell membrane and binds to interior receptor Mutations o A Mutation change in DNA sequence Substitution Insertion Deletion o Base substitution Eg sicklecell disease 0 O O O 0 See Fig 1214 Normal Sickled 0 DNA sequence CTC CAC 0 mRNA sequence GAG GUG 0 Amino acid Glutamic Acid Glutamic Acid 0 Hard to notice with some mutations Sometimes they do nothing and other times they weaken but also can improve protein Insertionsdeletions involve one or more bases 0 Downstream codons probably change and ruin protein shape fatal if proteins is essential VOCABULARY 0 Point change in single DNA base Missense changes a codon to code for diff Amino Acid Nonsense changes a codon to code for stop Frameshift add or delete anything except multiples of 3 Fig 1215 c B why are they important 0 1 Create different versions of genes alleles may change protein function u eg different appearance a eg different enzyme activity o faster slower catalyze new reaction defective protein may cause disease a eg phenylketonuria enzyme a eg cystic fibrosis transport protein a eg sickle cell hemoglobin o 2 Natural selection chooses which alleles are best makes evolution possible 0 3 Useful in science mutate a gene to learn its function 0 O O Zoology 9302010 33500 PM Zoology 9302010 33500 PM


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."

Janice Dongeun University of Washington

"I used the money I made selling my notes & study guides to pay for spring break in Olympia, Washington...which was Sweet!"

Jim McGreen Ohio University

"Knowing I can count on the Elite Notetaker in my class allows me to focus on what the professor is saying instead of just scribbling notes the whole time and falling behind."


"Their 'Elite Notetakers' are making over $1,200/month in sales by creating high quality content that helps their classmates in a time of need."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.