New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

Chapter 10 Lecture Notes

by: Lareb Notetaker

Chapter 10 Lecture Notes BISC 2202

Lareb Notetaker
GPA 3.0
Cell Biology
Oren, M

Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

Chapter 10 Notes from Dr. Oren's Lecture
Cell Biology
Oren, M
Class Notes
25 ?




Popular in Cell Biology

Popular in Biological Sciences

This 4 page Class Notes was uploaded by Lareb Notetaker on Tuesday October 27, 2015. The Class Notes belongs to BISC 2202 at George Washington University taught by Oren, M in Fall 2015. Since its upload, it has received 84 views. For similar materials see Cell Biology in Biological Sciences at George Washington University.


Reviews for Chapter 10 Lecture Notes


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 10/27/15
Chapter 10 Modern Recombinant DNA Technology Manipulating DNA by selective breeding a rst image of a rose ever painted b Humans manipulated genomes by selective breeding The two dogs are selectively breed by selecting for speci c traits in the same species Lab Techni ues to Mani ulante DNA A 3 cleavagesite Restriction enzymes are enzymes that exist in 3 5 most l1v1ng organ1sms Funct10n 1s to cut and identify double stranded region which has speci c 539 39 sequence Each enzyme recognizes specific W sequence Once they re identi ed they re cut into 39 double stranded The image to the left depicts methods of cutting sequence Discovered by studying the foreign DNA degradation by Bacteria Cut in speci c sequencesspeci c sites Rare vs abundant restriction sites depending on the length of target site Gel Electrophoresis technique used to differentiate DNA molecules sequence by sizes One characteristic is that if it heats up it will not break but separate into single strands and when you cool it down it can hybridize again as a complimentary strand This characteristic is being used for hybridization techniques discussed about later Probing of DNA using Hybridization DNA is cut herein pieces via the gel the bands are transformed into page and the paper which contains the dan is then hybridized via a probe which is a complimentary sequence of the DNA In this case the probe is radioactive so you couldn t know that the elds can get the bands and you know which sequences contain the probe You are probing for speci c sequence in the long DNA Southern Blotting Do not need to know the process Characteristic of DNA is that once it s heated up it can denature to single strands and once positive elearodee bonnm A slab ol agirose gel cooled down renatured because to DNA double helices EN m Ligation Role is for DNA repair and replication in order to get 39 1 3 two double stranded DNA Can be done on both sticky and clamped ends Cloning of DNA plasmids used for recombination and cloning they exist as an external DNA and also present in Eukaryotes Sometimes we use other things like BACS bacterial arti cial chromosomes which are circular DNA Bacterial Plasmid pictured to the right 7 v 1Creatin Recombinant DNA b Li ation 2 Transformation 3 O I COO Clonin and Am li cation double stranded plasmid which becomes 221quot open with sticky ends Fragments are ampli ed via PCR to clone in order to get single type of sequence Close up the fragment using ligase 13W rm 39 v w Io d recombina 21393 Transfect it into bacteria usually E Coli to isolate and amplify to have t v quot39DNA I I I I I I C Q l the colony of the same organ1sm to grow agam 1n 11qu1d med1a that have many of the same copies use for sequencing and recombining etc Genomic Libraries each colony has a different sequence of DNA creating a library You f p can keep them in 80 freezer as a stock If you use glycerol you have bacteria in stock lt7 you can take it and regrow it Ex of Hybridization of clones via 7393 mm V 4 DNA labe39elc1PNA pmbe col oooooo ontalnin m AC probing of DNA you can use this JV JLJ j 39 R Q pa 7 39393939 9 technique in order to identify colonies 7 Q 7 3229 i7 31 INCUBATE WITH PHOTOGRAPHIC that Contains your Plasmid With the SPeCi C thing 5mm Eiiiiipiiiiigim you are looking within them using a probe immigm39amids 39I f l mquot g cDNA library complimentary DNA We basically want to see gene expression which type of molecule Gene expression ffff mmmm 5 V 3 is not with mRNA but we cannot work with mRNA because l myng it s very vulnerable and not as stable as DNA therefore we use 539 3Z reverse transcriptase enzymes of retrovirus We use it to g 5 l min39l m fmWWW have the same sequence but in the form DNA Take speci c ESTzaUEAS situation in cell life or tissue and extract total RNA and use mRNA to make library to know which genes are expressed in mm Mm amp Emm ELTEESA DAU Sn mmm certain type When you want to sequence a genome you make 1y a genomic library You cannot take the old genome and throw 1 Mew them in one plasmid so you cut them in two pieces in nitro PCR Polymerase Chain Reaction Ampli cation of speci c target PCR 1 39 Chain RPm m 39 ampli cation of speci c target mm EPKIIATE STRINGS AN39D 39 V V T A amt Should know what this is 531 SYNTHESIS gnu ns A r 77 39 I 7 quotANNEAp 7777777 7 Denaturation Annealing Polymerization inzns lt lt W 4 95 C 55 65 C 72 C T u quot0 END OF SECOND CYCLE THIRD CYCLE FIRST CYCLE produces OIquot donblcamndod Produces eight doublestranded DNA molxules DNA molecules 123456789 PCR Sea Urchin Example DNA ladder example of pieces of genome from sea urchin A cluster of genes speci c genes on different back clones Used primate Ian ll ll llllm that can catch all possible genes at the same time Can identify each genes in the 39 back clone and can be noti ed of repetition bbbbbbbbb IE PCR as diagnostic tool for ex used for HIV If we have small quantities quot of RNA from Retral Virus can use cDNAPCR to identify the speci c 4 vL vvvv m E 7 1 gene even if it is in low quantities view image on the left BV TTTTTTTTTTTT ON Fragment Length Analysis often used in forensics bio and population genetics simple PCR with primer that is being modi ed with a uorescent label The idea is to use Microsatellites short tandem repeats STRs are repeating sequences of 25 bp of DNA to use 23 tides to identify regions that contain GA repeatedly junk DNA We have lots of these LOCI places where we have this Microsatellites They re speci c quality is that they are different for different individuals In one individual you have one length in another it s different length with repetition Recognize individuality within species Good for humans too Ex of 4 individuals on how to identify crime scene left overs s3 E when you have suspects taken from crime scene door door a r F t4 t handle According to the length of reputation of E Microsatellites is different from each different individual EEEEE 3 uuuu Need to use 16 speci c Microsatellites to see if you have same 3 A a F signature to catch the suspect used in pop genetics to trace lineage of population identified primaries women after 330 Pregnancy contain genome of embryo quot Fragment length analysis of STRs Microsatellites using Fluorescent Egg Primers experiment with creature that can combine together by fusing and becoming one Sequencing in era of sequencing revolution meaning that the quality is much better than it was and cost has declined in nucleotide sequencing Sanger Sequencing older still used today very efficient Based on 0 3 0 05 o nucleotides that do not contain the hydrocelic extention basically W d ex ensionat extensionat m terminate the polymerization of the strand 3 end 339 end A PRODUCTSLDADED mal I LuLI u ATGT ONTO CGIEILLARV e39e ml me quot triphosphate dNTP triphosphate ddNTP once you have the nucleotide 2533 quot The Nucleotide is dyed with 4 different colors red t c blue a green g yellow Get many sequences in different sizes and run them in high resolution genetic electrophoresis to identify color for each size to get this big chromatogram to give sequence depicted on the image to the left Illumina SM Sanger sequencing need to have primers other TTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGT Pairedend Mg Eaigbrary PacBio w1se cannot create new strands Also have other 2513 a e Up to 20k techniques that use arbitrary random primers to 3 WZZE sequence anything without knowing the v 2 specific sequence Diagonal line sequence h M identical to itself Dots genes repeated to quot 39 39 sequence similar to another gene Illumina based on short peaks 500 bp SMRT Pacbio reletavitly lower coverage less w than 40 million we have several ten thousands 39 39 hundred But are longer 20K Same cluster but results are different because the SMRT weighed 20K long sequences could resolve area of our genes compared to Illumina short genes Major problem because if you have many repetitive genomes when you try to get them together they will all collapse convert to DNAv into fewer secluence mun Gene Expression Analysis by Microarray chips printed with small short sequences representing genes Print samples and turn into DNA and give it specific n mg gum dyestrain In this case it s red and green Then hybridize it with chipped to get ALS AND COMBINE IMAGES pattern of the expression Red greed together cohybridized expressed in both experiments Dark vs light red weak and strong Gene Expression Analysis by FISH Ex of nervous system in sea animal observed via uorescent probe Can see the nerve cells and in the blue is the nucleus You can localize expression of a gene aka being transcribed Use a probe with a speci c color and probe it with a tissue to get localization Reporter Gene nuclear DNA sequences You can take genes you want to study in what time it is expressed and A CONSTRUCTING A REPORTER GENE I under what circumstances so you will add a reporter gene For ex GFP uorescent proteins planted in same area of the original gene When gene has to be expressed instead of expression gene you will get expression of reported gene so you know the time of the gene expression Ex of nervous system Nock Out know the function of speci c protein or gene you can take it out Sometimes it s lethal In cases it s not lethal you can see how it affects the organism CR 39 inseam Ex Mouse gene responsible for DNA damage If you don t have this gene you get faster senescence showing DNA repair is important to 39 prevent these events Ex Transgenic Organisms using Bacteria NORMAL GENE INTO PSEUDOPREGNANT ES cells with one o of ar a E coli expressing double stranded RNA eaten by worm MATE WITH NORMAL MOUSE the offspring will include males and females with one ltopy O a of target gene altered in all cells MATING a rugIRAfugiiE IcFaoius ZINW 39Q 39m 3159 TAKGH sNEJAREMIEREQ 20 um Ex Nock Down based on RNAi instead of knocking out original DNA of organism or to make a transgenic organism by changing DNA you can knockdown RNA by using RNAi or microRNA Both used to knock down genes You are able to see phenotype in example image above right In order to produce high quantities of proteins express in all kinds of cells e coli yeasts eukaryotic if you have culture not all cells can be cultured Protein Production by a Vector In order to produce high quantities of proteins express in all kinds of cells e coli yeasts eukaryotic if you have culture not all cells can be cultured Ex Insulin diabetic pt s produce insulin via this technique t We cu r DNA WITH l RESTRICTION NUCLEASE INTRODUCE RECOMBINANT DNA 1 INTO CELLS


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."

Jennifer McGill UCSF Med School

"Selling my MCAT study guides and notes has been a great source of side revenue while I'm in school. Some months I'm making over $500! Plus, it makes me happy knowing that I'm helping future med students with their MCAT."

Jim McGreen Ohio University

"Knowing I can count on the Elite Notetaker in my class allows me to focus on what the professor is saying instead of just scribbling notes the whole time and falling behind."


"Their 'Elite Notetakers' are making over $1,200/month in sales by creating high quality content that helps their classmates in a time of need."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.