New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

Introductionto Biochemistry Laboratory

by: Francisca Sipes DVM

Introductionto Biochemistry Laboratory CHEM 603

Marketplace > University of Wisconsin - Milwaukee > Chemistry > CHEM 603 > Introductionto Biochemistry Laboratory
Francisca Sipes DVM
GPA 3.94


Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

Class Notes
25 ?




Popular in Course

Popular in Chemistry

This 9 page Class Notes was uploaded by Francisca Sipes DVM on Tuesday October 27, 2015. The Class Notes belongs to CHEM 603 at University of Wisconsin - Milwaukee taught by Staff in Fall. Since its upload, it has received 8 views. For similar materials see /class/230300/chem-603-university-of-wisconsin-milwaukee in Chemistry at University of Wisconsin - Milwaukee.


Reviews for Introductionto Biochemistry Laboratory


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 10/27/15
Chemistry 603 Introduction to Biochemistry Laboratory o 06 Ho NH3 gt Type II Tyrosmemla and Type III Tyrosmemla 9 L39Tyros39ne Hawkinsinuria Tyrosine 6 lt3 aminotransferase O Uncoupled 0 Turnover Enzymatlc 0H0 06 o o HO S HO 0 0 3H3 Biosynthesis of 4Hydroxyphenylpyruvate 0 Ce Plastoquinone in Plants 4Hydroxyphenylpyruvate Hawkinsin H dioxygenase Hac 7n O Alkaptonuria l 09 K OH O 0 Non 09 P I lt 4 HO Enzymatic o oymenza Ion Ochronotic 0 CH3 Homogentisate gt CH3 Homogentisate O P39gment Plastoquinone 12 dioxygenase 60 o O O O 09 Type 1 Tyrosinemia Pathway Maleylacetoacetate Maleylacetoacetate Isomerase 90 Non 90 o 0 Enzymatic o o o gt o 09 o 06 Succinylacetoacetate Succinylacetone o o e Fumarylacetoacetate Fumarylacetoacetase O 90 W 90M o Acetoacetate Fumarate OH OH co2 OH O 0 e gt Type 11 Tyrosinemia amp Type 111 Tyrosinemia HO gHi LrTyrosme Hawkinsinuria Pathway Tyrosine 09 aminotransfemse Uncoupled De 0 Turnover 0 06 gt O o gt O o HO 5 8 HO HO NH 47Hydr0xyphenylpymvate O O Alkapwnuria Pathway e Biosyn wesisui39Hasiouuiuone igyyg fehmylpymm Hawknan O N O H 7 on it De Enzymau39e 39 Polymen zah oh 01 d T h lt OH cr0n0 c H3 7 INH gt gt Pigment 39 quot HO Pla mqui none H0m ogemsm Homogen sate 127 di oxyg ehase e 0 Type 1 Tyrosinemia Pathway o o De 9 o o O Maleylaeemaeeme O O O Maleylacetoacetate gt gt isomerase O O 0 Ge 09 9 Succinylacemacetate sheeihylaeemhe O E Fumarylacetoacetate Fumarylacemacecase 90W GEEKYea o o o Acetoacetate Fum arme Usnea Old man s beard v s ng39enta m gm ma Ziaasuc sw 3 AVentS NTBC SULCOTRIONE MESOTRIONE ISOXAFLUTOLE o o SOZCH3 oo ooNo2 ooc ooNo2 O on C O o CF3 o SOZCHg o soch3 I39ll F3 DIKETONITRILE ooNo2 ooNo2 ONNO2 00No2 Cl 0 OCH3 O O O LEPTOSPERMONE USNIC ACID 0 HO O O I O 0 g N02 0 02 00 N02 0 oo 00 Cl 00 3 00 N02 0 0CH3 0 0 H3 0 o CF3 oo oo i0 O O O O O O O O O O O o e Vancomycm NH3 0 Cofactor F420 HO H2N NH LTyrosme 4 T W OH 4Hydroxymandelate o R 0 0e synthaseHMS lt 09 l 1 HO o HO o HO N n o 4Hydroxymandelate HMA 4 Hydroxyphenylpyruvate HPP 1392 4 Hydroxyphenylpyruvate FO H dioxygenase HPPD If 0 O 9 09 06 OH O 0 4 4 4 gt gt Melanin 0 CH3 HO 0 CH3 Homogentisate HG Quinone Plastoquinone 3 I E J H H30 0 0 HO CH3 60 Moe CH3 W Go o OLOcopherol Acetoacetate Fumarate Egg 3 9 ContentsSyllabus Cloning nflhe PPD gem from Sgnegtymngs a Ex e mem la PCR P0 yme39rase chain reamon 7 Experiment 1b Elecu ophcresis of Lhe PCR fragment l7 Experiment 1c Lig 39 an I 27 Experiment 1d Assay 01 Insert 37 Puri cation of HPPD F nerimpnna WW 39 W caIe quot 43 F nerimenr 7h Ivci 39md 50 F nPrim n L 58 ExperimemZd Assay afHPPD AcKiVilY H 66 F mrim m h 39 72 F man39um 7r 39 nuu protein 78 Chnrnctcrization of PPD 87 Experiment 3a Steady state kinetic gggjxgi Course Schedule Thurs 4 WWW 11 A g 93 M g 2 1a um um am 25 Lam my gagsunis 26 mmmm 17 mmww 2 mm Rwn m mu 4 a In F al Revon due 1 Lab Note Rnnlr 20 On ve occassions you will hand in your note book to be graded This will be a record of what you did in each laboratory They will not contain lengthy rewzites of the methods but should have an initial brief description of what you intend to do in each lab They will be graded on the following criteria Title of experiment Date on each page NNNNN G eral neatness and orgamzauo Quality of observations Attention to detail lnnndnminn 15 Results and hi runsinn 15 Final RPnnrt 30 Your experimental data will be assembled into a final report that will describe your data throughout the course The report is to be written in the style of a research article Some examples of research articles are included in the back of the manual Use these as a style guide Each section will have the headings Title Author Abstract Methods Results and Discussion You will not be required to generate a bibliography Experiment 1 CLONING OF THE HPPD GENE FROM THE GENOMIC DNA OF The Gene m um 4mm 5 W TCCGATGCGCGECTCCCGCGCCAGCAGCACCAGGAGCCGGCCGTCCAGATGATCGATCGCCACG CCTCECCGAECATGTGGCCGAGCACGECGAEGGCGTEGTCGACCTCGCCATCGAGGTCCCGGAC TGAAGGACGAGCACGGCACGGTCGTCCTCGCCGCGATCGCCACCTACGGCAAGACCCGCCACAC CCTCGTCGACCGGACCGGCTACGACGGCCCCTACCTCCCCGGCTACGTGGCCGCCGCCCCGATC GTCGAACCGCCCGCCCACCGCACCTTCCAGGCCATCGACCACTGCGTCGGCAACGTCGAGCTCG ECCGGATGAACGAATGGETCGGCTTCTACAACAAGGTCATGGGCTTCACGAACATGAAGGAGTT CGTGGGCSACGACATEECGACCGAGTACTCGECGCTGATGTCGAAGGTCGTGGCCGACGGCACG CTCAAGGTCAAGTTCCCGATCAACGAGCCC CTCGCCAAGAAGAAGT AG GACGGTACGCACGATECGCGCCGCCGGCGTCCAGTTCCTGGACACGCCCGACTCGTACTACGAC ACCCTCGGGGAGTGGGTGGGCGACACCCGCGTCCCCGTCGACACCCTGCGCGAGCTGAAGATCC TCGCGGACCGCGACGAGGACGGCTATCTGCTCCAGATCTTCACCAAGCCGGTCCAGGACCGCCC GACGGTCTTCTTCGAGATCATCGAACGCCACGGCTCGATGGGATTCGGCAAGGGCAACTTCAAG cc 339 GAGCGGGAGCAGGAGAAGCGGGGCAACCTGTAGGCGG GCG CTCGCCCTCGTCCTCTTCGCCCCGTTGGACATCCGCCGCGC CT 1m 5 339 c CTTCGCCCCGTTGE MTTTTTTAAAKAA 5 v0 x mm 5 mm H 5 mm Cycl 1 L ka z 14quotC 4306c cam Mm HM Hllncm munllmm IIHI HI mum um unmmunm IIHIHIHHIIII HIHIIIHHHIH IHHIHHHIVIIHIHHIIIIIIIIIH ll ETC m HIVIHHI IH


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."

Amaris Trozzo George Washington University

"I made $350 in just two days after posting my first study guide."

Jim McGreen Ohio University

"Knowing I can count on the Elite Notetaker in my class allows me to focus on what the professor is saying instead of just scribbling notes the whole time and falling behind."


"Their 'Elite Notetakers' are making over $1,200/month in sales by creating high quality content that helps their classmates in a time of need."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.