New User Special Price Expires in

Let's log you in.

Sign in with Facebook


Don't have a StudySoup account? Create one here!


Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook


Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

Intro Bio IBasic Seq. Comp

by: Geovany Abernathy

Intro Bio IBasic Seq. Comp BIOL 5351

Marketplace > University of Texas at El Paso > Biology > BIOL 5351 > Intro Bio IBasic Seq Comp
Geovany Abernathy
GPA 3.65


Almost Ready


These notes were just uploaded, and will be ready to view shortly.

Purchase these notes here, or revisit this page.

Either way, we'll remind you when they're ready :)

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

Class Notes
25 ?




Popular in Course

Popular in Biology

This 11 page Class Notes was uploaded by Geovany Abernathy on Thursday October 29, 2015. The Class Notes belongs to BIOL 5351 at University of Texas at El Paso taught by Staff in Fall. Since its upload, it has received 34 views. For similar materials see /class/231282/biol-5351-university-of-texas-at-el-paso in Biology at University of Texas at El Paso.


Reviews for Intro Bio IBasic Seq. Comp


Report this Material


What is Karma?


Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 10/29/15
What are the Biochemical Questions Molecular Function Biochemistry review my 7 Control Structure BIOL 5351 Fall 2003 CellOrganism integration 7 Distribution 7 Activation 7 pathways What can be answered by Two strategies sequence data Match whole sequences better for evol Same sequence w evolutionary relationship plies relatedmolec e 7 Some equal weight to all positions Same sequence ltgtSameFunction but 7 similar or complementary substitutions allowed 7 7 H W quotf39l fquot 53quot f quot quot quot Match subsequence pattems better for fnx WMquot 5 quotquot1quot fquot 53quot f quot quot quot7 7 Implies some biochemistry in common Panly smnlar Wsom cemmon functions 7 Positional and spatial information critical 7 spatial orientation wsome common function 7 Subset ofsimilarcomplementary allowed For both 7 need to know the biology The Central Dogmaquot Nucleic Acid or Protein principles apply to both Evolution or function question applies to r 1 b th 0 i One general rule If dealing with coding m regions ofDNA better offworking in protein space J n Problem what is acoding region Nucleic Acids m smne doubler nnda mus 2v on an quothas unnann wudure Gnnd1nr Informtinquot lungememd yi Inhuml la n machms lulu Duchgln m alanine nny emaieqnnnm woman mm mm s 2v on wme nnge Mcn vlex mclms Gnnd 1m nnnyunnge imnnnmnmnem walking memryi strumml unawarls cutlysis Regullllnn Nucleotides Z39Dimbuse Reuse wanimnee Fumes Polynucleokides A RNA 3 Puiamy id 5 0quot 3 Ease Pairing Interactions Hydrogen Bonds 1 AT GVC and mnreslzhle GVC J samewidlh Q c Anlipzrzllel Nnie PNAcanbasepaiimihesameway Double Helix Structure of DNA ume mun un iannnni gunmen den lrudurs hm lung maul namesquot me canqu znry Ind my mums column n Ru A Packaging of DNA in Chrom osom es Know the most about protein coding regions of DNA SMALL portion of total DNA One Bioinformatics challenge 7 how identify coding region 7 Homology 7 ORFS 7 Base use statistics The Genetic Code Standard Codon Table um Kw Um Cy U m v um c i t um A W m mum h m W 1L 1mmquot Met cc Aquot c Tr 3 2m CGAJH i u mm a u Goodons Leu m N m 5 Am A m to l A K n G mu Aim EU U m m a o W m m n A la E 7 mRNA and Polypeptide for Human insulin TACA39JHAD39WANMMUNMJ39V mumMm a m w m w m A L Liquot D a w m mu m t mn no my v 1w u m um um to um n39c man u m m n M u w m A m m u t t W um w m m rn m mm mm cm W m m m mu m w m m m m mm m m m w m cm w w L A w w m 1 m m t a m A m m 14 m mr 39m m M w m m w w m m w w am W V u v u mu 0 u my cy my l at n m m m on um mu m m w mm W 1 ram w m m m m m w c my 5 4 a w A vrr Um nrv vm m m m to uni m u m t a 0 c m m m m a in 7 all not mm an m w w quota m m m nu u m m w m mu m a w Mn 1 m on u L W an n our Mummyth aummamMW WMJMVMLW 2 mm The ribosome is a ribozyme 1 n r r 2 Crystal structure of large subunit shows no protein within 18A of active site for peptidyl transfer reaction Looking into active site Side View C From Nissen et al 2000 Science 289920 Role oftRNA in reading the triplet code 1 2 3 4 5 6 7 ATGTCCACTGCGGTCCTGGAA DNA UACAGGTGACGCCAGGACCTT Transcrlpuo m RNA AUGUCCACUGCGGUCCUGGAA u t c A GUGA Translation tRNAamino acid Example Phenylalanyl tRNA Complex folding Modi ed bases Anticodon I I l 3v cuu 539 Codon in mRNA Transcription In ation Bacteria v promoter mm a mm mm Slums mmm e mlsasm lallawwg ilhliawu ye a momer gone I Hangman Conserved Sequences in Prokaryotic Promoters 35 and 1D um lr Il e WW ollI m a39 Mme Gene Aligned Promoter Sequences 1n sequence 11 mnmncee mm Enccnc nwemcencmemcn m mmmc mm mmcnm snmncc39mm39nnsn svdn nn39nscnsc39r 139 mm mm mmmm c nquot ccncmcm mm Emcnc nwcmmsncscnc39mnc m um csmmm mm scscccc sc39ncccsn39mmsnscn Lac oncemm mm 515154 mmcnsccmmcm Deviations from consensus influence promoter strength Transcription lnitIation Eukaryotes AM mmm W W lmm k MM u Regulation by Polymerase Recruitment Eukaryotes Recogn n Sequences for Some Transcriptional Regulators Bacteria lac repressor AATTGTGAGCGGATAACAATT CAP TGTG GTTAGCTCACT A repressor TATCACCGCCACACCTA Yeast 3AM CGGAGGACTGTCCTCCG MATOLZ CATGTAATT com ATGACTCAT Drosopmla Kruppel AACGGGTTAA blcold GGGATFAGA Mammals 3m 0cm ATGCAAAT SATM Making a Protein Prokaryotes 1min slnnni 1RMA slnnni I mam Amlnn nae Stnnu runemwmm Prem RNA Splicing Reaction Two sequential Dansres terl catlons Generates a larlat intermediate With a mreerwayjuncuon I lr u A G sin i Lariat O 5 ai i ii Making a Protein Eukaryotes Exnn lmmquot Exnn Mmquot Exnn Gme 1mm slunul llmnscnr llnn lrmscrlr39l inmi annpi AAAAA 5mm Messenuemun AAAAA I ransomquot Amlnn Acld sump Fun lnnd Protein 9 i m The Spliceosome a g of plemRNA occurs in a llbonucleoplotein complex Large approx 405 Complex 5 snRNPs s snlNAs gt70 proteins Vamp l j composi nal and conformational changes during the splicing cycle From Villa et al 2002 Cell 109 149 Recognition of Splice Site Signals and U2 SHRNAS basepp We in all win we 5 Splice Elle and we brancnsne espectlvely U 2 MR NA Ui snRNA Ho pppema lifi irilUAvwsm iieiiii GUAAGU UAcUAc moonms exon 1 A exon 2 539 splice Ste 339 sallce Site WHY SPLICING 1 Remnant from early RNA world facilitated gene evolution by exon shuffling 2 Provides a posttranscriptional regulation point 3 Allows divers cation of protein products without Increase in gene number Alternative Splicing Generates Protein Variants thelnE SFIIEIHE pattern 7 ProoeinA rrmscnm Cnmhinmnrizl Splicing Generates High Prnlein Diveis y nmnm splian mm mm W W a Neurexin Alternative Splicing in Mammals dumion of synapse form ation Nww can clan and xequexm aama gene a 5mmme an i l n nmivnn nml lEIEHm cDNA W W W W W mixing RNA types imnnim 232 rRNA 5mm 39 RNA Messenwm WA mRNA Reverselrzrscriplion And Total RNA Yeast mRNA l5 3 minor fraction mine RNA ln a all N2 wna are me functions Dflhe abundant RNAS vw manila Regulation by RNAs 1 micro RNAs in Eukaryotes 2 Dosage compensation 3 Small RNAs in prokaryotes Small Noncoding Regulatory RNAs in Bacteria Abundant Modulate cnanges rn cellular metabollsm under Suboptlmal or stress condrtrons A Mmeliwmysamlnhlb lan n Yrmlailon MW like 5 MadalmvssiNAlnmhlllnnn Tlunuvlmlnn Dman Sluilnnry unu X drates response to H202 qulnteractswlth rnan SRNAS eg DsrA Wltn tnlA rs a transcnptlonal actlvator blrldlrlg rpos rs a general stress tactor 65 RNA may act by competlng Frnrn Wassarrnan KMQEIEIZCEH1EI9 lAl 670 promoters for RNAPOl Amino Acid Single Letter Code Learn it A aianine N asparagine c cysteine P proline D aspartat Q glutarmne E glutama R arginine F phenylalanine s serine G cine T threonine H histidine V valin I Isoleucme w trypt nan K sine X any amino acid L leucine Y tyrosi M methionine Experimental Ambiguity Aspartic Acid or Asparagine Asx B Glutamic Acid or Glutamine Glx Z Unknown X Similar AA may be substituted rBasic Polarnon inlar 39 Size Aromatic Reactive Special traits eg cysteine 39 Many t in more than one category 7 substitution de 39 t pends on Which characteristic importan Classi cation of Amino Acids 39 Aliphatic r Oily hydrophobic side chains 7 ine AlaA Valine VaiVLeucine LeuL e Isoleucine HeJ Proline Pro 3f o a a a CE 7 Phenylalanine PheF Tyrosine my Up an m 39 Acidic r Negatively charged side chains 7 Aspam39c Acid AspD Glutamic Acid GluE 39 Amide r Uncharged polar side chains derived from acidic amino acids 7 Asparagine AsnN Glutamine GlnQ Classi cation of Amino Acids 39 Hydroxyl 7 Oxygen containing alcohol side chain 7 Serine Sens Theronine ThrT 7 see also Tyr Sul ir r Weakly polar almost aliphatic side chain 7 Cysteine CysC Methionine MetM 39 Amine r Positively charged side chain 7 Lysine LysK Arginine ArgR Histidine HisH 39 Tiny 7 Hydrogen atom side chain 7 Glycine GiyG no in cuddled Statistical comparisons Look at which aaexchanged in curated trees Rank over entire proteins sets Look at substitutions allowed for speci c special cases Amino Acid Composition of SwissProt Release 4022 m yelloweswnmms Am1no Acid Mutablllty Ser 149 Lys Met 22 Pro 55 Asn 111 HIS 50 ll I D Gly 48 GI 102 PM 45 All IUD Arg 44 Gln 95 Leu 35 As an Tyr 34 Thr SD Cys 27 Gap a4 Trp 22 VII BU Amino Acids to Proteins Proteins are alinear polymer ofamino acids They can assume a regular conformation In39egular but frequently found patteins of conformations ovei short stretches Tums No discemable regularity Peptide backbone effects peptide bondplanar Model backbone structure with two angles Psi mhw39nnzl v am w v Ilvhlhlllx Different fur each Possible Conform ations m aamarmaaraa PM asl M amen ma mlIx Observed in 500 Proteins Protein 3 Dimensional Structure uni He 3 dimensional structure ear be decomposedinto distinct elements called secondary structure lpha helices and beta sheet are regular stru s where the backbon conformation of each element assume the same con gurati Tums have backbone con rmations tha show the same pattern ofcon gura ons in each instance Random coil regions of structure have no regular or repetitive backbone c e E Alpha Helix Structure a ma Beta Sheet Structure r n c o E u e u n t Pmllgl mshui Beta Turn Structure 1 7 ll mm ImmdlzhePulimmmciydm0rkh Alpha Helical Proteins Mnrimhlnodwomhumdlhinm land 5 pl mlum am nun Beta Sheet Proteins mt Cm bPlmqlninm a n min when out Mixture of Alpha and Beta mm mm m a Inns in Pmtn39n 39u l gunmanquot nhmnddlg Predominantly Tum Proteins Whimlahnillinhul mnhd ind 15 Winnd nhxmauaamnimmmhm Some structural mutations more equal than others Core ofprotein change effects packing and structure Outside loops 7 change much less important Tiansmembrane span 7 often exible as long as not hydrophilic Catalysis Active site is conserved 7 in anee dimensions Not neeessan39ly adjacent in one dimension Binding pocket allowed speci c Variation for substrate Variation Other sites also conserved 7 Binding sites Where does protein belong All protein synthesis takes place in cytosol but need proteins throughout cell and secreted Prokaryotes relatively simple 7 cytosol membrane secreted Eukaryotes substantially more complex Eukalynlvs cylnnlasm is cnmpanmenlalized inln membrane hnund nrganelles with sn ized lunclinns Mltuchundnun Prnkalynlic Cell Vaennle um E ukalynlic cell thanleri l wlanl l R lbusumes Enduplasml vetlculum Functions of Eukaryotic organelles Nucleus Cuntamsgenetl matevlal DNA sue Mtvanscvlptmn and RNA pyneesslng Enduplasmlc Synthesls nnyansmemmane and secreted proteins vetlculum Gulgl appayams M dmcatlun and wnlng unvansmemmane and seeyelennmlems Mltuphundvla Pt dudlun utenevgy by DWAan phosphuvylahun cmnmplasl Fllallun ut cavbun and enevgy by phatusymhesls Lysnsume Hydralyslsutpvutemsstc Fllamemnns shape muvement cyluskeletun Protein distribution cytoplasm 7 source of all protein syn Secreted and plasma membrane proteins Signal peptide for import into E retention signals Lysosomes7som39ngtags P arsfrom ER Nucleus and peroxisomes 7 speci c sequence tags NLitochondn39a and Chloroplastr some local synthesis also speci c import sequence tags Protein modification Disul de 7 increased stability ofsecreted proteins Formed in Endoplasmic Reticulum Myristylation palrnitation Others


Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.


You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Bentley McCaw University of Florida

"I was shooting for a perfect 4.0 GPA this semester. Having StudySoup as a study aid was critical to helping me achieve my goal...and I nailed it!"

Janice Dongeun University of Washington

"I used the money I made selling my notes & study guides to pay for spring break in Olympia, Washington...which was Sweet!"

Jim McGreen Ohio University

"Knowing I can count on the Elite Notetaker in my class allows me to focus on what the professor is saying instead of just scribbling notes the whole time and falling behind."

Parker Thompson 500 Startups

"It's a great way for students to improve their educational experience and it seemed like a product that everybody wants, so all the people participating are winning."

Become an Elite Notetaker and start selling your notes online!

Refund Policy


All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email


StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.