New User Special Price Expires in

Let's log you in.

Sign in with Facebook

Don't have a StudySoup account? Create one here!

Create a StudySoup account

Be part of our community, it's free to join!

Sign up with Facebook

Create your account
By creating an account you agree to StudySoup's terms and conditions and privacy policy

Already have a StudySoup account? Login here

Lecture 6

by: Sierra

Lecture 6 FNR 348

Preview These Notes for FREE

Get a free preview of these Notes, just enter your email below.

Unlock Preview
Unlock Preview

Preview these materials now for free

Why put in your email? Get access to more of this material and other relevant free materials for your school

View Preview

About this Document

Aging Sexing
Wildlife Investigational Techniques
Elizabeth A. Flaherty
Class Notes
wildlife, investigational techniques, forestry, Natural Resources
25 ?

Popular in Wildlife Investigational Techniques

Popular in Agriculture and Forestry

This 15 page Class Notes was uploaded by Sierra on Friday April 1, 2016. The Class Notes belongs to FNR 348 at Purdue University taught by Elizabeth A. Flaherty in Spring 2016. Since its upload, it has received 13 views. For similar materials see Wildlife Investigational Techniques in Agriculture and Forestry at Purdue University.

Popular in Agriculture and Forestry

Reviews for Lecture 6

Report this Material

What is Karma?

Karma is the currency of StudySoup.

You can buy or earn more Karma at anytime and redeem it for class notes, study guides, flashcards, and more!

Date Created: 04/01/16
1/31/16% Grammar%Points% •  Dependent%clauses% – When%collec9ng%hair%samples%for%stable%isotope% analysis%store%hair%in%a%coin%envelope.% •  Use%of%commas% – The%trees%located%at%the%end%of%field%site%were%mostly% oaks%which%are%a%common%species%in%this%area.% – Separates%two%complete%thoughts%or%natural%pauses% •  Contrac9ons% – Don’t%=%do%not% – Its%vs%it’s% 1% To%remember%for%the%next%lab%report% •  Write%it%in%the%style%of%ar9cles%you%should%be% reading%for%these%lab%reports.% •  Review%formaLng%guidelines%in%the%Scien9fic% Wri9ng%handout% •  Ask%for%help%early% •  FormaLng%requirements% •  Help%on%Blackboard%Learn% 2% General%Wri9ng%Points% •  Because%vs.%since% •  If%ci9ng%the%handTout%from%lab%when% referencing%data,%use%(E.%A.%Flaherty% unpublished%data)% •  Southeast%Alaska%is%a%proper%noun%and% Southeast%should%be%capitalized% •  Verb%tense%–%past%tense%unless%it’s%general% knowledge% 1% 1/31/16% Introduc9on%Notes% •  Vital%rates%do%affect%popula9ons%but%that’s%not% what%our%research%focus%was%on.% •  Start%broadly% •  In%groups,%think%of%~4%major%topics/points%to% cover%in%in%the%introduc9on.%Iden9fy%the%order% in%which%you%would%present%them.% % IDing,%Aging,%Sexing%Wildlife% 1%February%2016% Learning%Objec9ves% •  Be%able%to%determine%age%and%sex%of%different% mammals%and%birds%using%a%variety%of% characteris9cs.% •  Know%which%techniques%for%determining%age% and%sex%work%best%for%certain%taxa.% 6% 2% 1/31/16% Why%do%we%need%to%know%how%to%ID,% age,%and%determine%the%sex%of%wildlife?% 7% IDTing% •  Importance%of%taking%the%‘ology%series% •  Visual% – Actual%animals% – Evidence% •  Scat% •  Tracks% •  Modifica9ons%of%environment% •  Auditory% – Calls% •  Olfactory% 8% 9% 3% 1/31/16% Maryland%DNR% 10% DNA%ID% •  Collect%9ssue%samples% (hair,%scales,%scat,% etc.)% •  Extract%DNA,%use%PCR,% and%species%specific% primers%to%iden9fy%to% species% 11% What%is%PCR?% % Polymerase%Chain%Reac9on% % In#vitro#duplica9on%of%DNA## 4% 1/31/16% What%are%some%pros%and%cons%of%using% the%different%ID%methods?% 13% Aging%Wildlife%T%Physical%Characteris9cs% •  Measurements%of%animals%in%hand% – Body%mass% – Hind%foot%length,%body%length,%tail%length,%ear% (mammals)% – Forearm%length%(bats)% – SnoutTvent%length%(herps)% – Wing%chord,%wing%notch%length%(birds)% •  Must%be%standardized% •  Reduce%subjec9vity% Green.blogs.ny9mes% 14% Molecular%Techniques%–%Determining%Age%and%Sex% •  Telomeres% 15% 5% 1/31/16% The%region%at%the%end%of%a%linear%chromosomes%is% called%a%telomere.% % Each%eukaryo9c%chromosome%is%capped%with%a% telomere.% % Similar%to%microsatellite%DNA%loci,%telomeres%are%6% base%repeats:% TTAGGGTTAGGGTTAGGGTTAGGG% % Telomeres%shorten%with%each%successive%cell% divisions% =% Telomeres%shorten%with%age% What%is%the%difference%between%adult%and% embryonic%stem%cells?% % % % % % % Longer%telomeres!% What%are%the%implica9ons%for%cloning?%%Clones%have% shorter%telomeres!% 6% 1/31/16% By%quan9fying%telomere%length%(using%PCR)%we% can%es9mate%the%age%of%American%marten%from%a% hair%sample.% Aging%Mammals% •  Before%lab,%your%assignment%is%to%watch%the% following%videos:% •  hmps:// v=Aem65RBHL98% •  Link%available%on%blackboard% 21% 7% 1/31/16% Aging%Mammals%T%teeth% Pg%227%in%textbook% 22% 23% Aging%Mammals%T%Bones% 24% 8% 1/31/16% Aging%Mammals%T%Horns% 25% Aging%Mammals%–%Other%Op9ons% •  Tail%shape%(pg%225)% •  Baculum%size%(pg%226)% •  Pelage%(pg%226)% •  Signs%of%reproduc9on%(pg%226)% 26% 27% Sharp%1958% 9% 1/31/16% Shanks%1948% 28% Figure%8.22%in%textbook% 29% Aging%Birds% T  Size%is%not%useful%for%aging%birds.% T  Become%full%grown%just%aner%leaving%parents% T  Use%plumage%to%successfully%age%birds% T  Feathers%replaced%1T3%9mes%each%year%by%molt% % % 30% 10% 1/31/16% Aging%birds%cont.% •  Natal%down%quickly%replaced%by%juvenile% feathers.% – Juvenile%plumage%dis9nct%from%later%plumage% 31% Aging%birds%cont.% •  Juvenile%plumage%replaced%by%1 %adult% “winter”%plumage% 32% 33% 11% 1/31/16% Aging%Birds% Feather%wear%is%another% way%to%age%birds.% 34% Aging%Birds% Skull%pneuma9ciza9on%is%another%aging%technique.% nd %TGradual%forma9on%of%2 %layer%of%bone%under%previous%one.% %T%Required%4T12%months%(depends%on%species)% %T%Produces%recognizable%pamerns%in%extent/distribu9on%of%air%% %%%%%%%%%pockets%and%small%visible%columns%of%bones% 35% Determining%the%sex%of%wildlife% Op9ons%other%than%assessing%the% appearance%of%genitalia% 36% 12% 1/31/16% Determining%the%sex%of%birds% •  See%figure%8.10%for%cloacal%structures%in%male% and%female%birds.% •  Plumage% •  Brood%patch% 37% 38% Determining%Sex%–%Mammals%T%Skulls% 39% 13% 1/31/16% Antlers/Horns% ADF&G% 40% Body%Characteris9cs% 41% Body%Characteris9cs% 42% 14% 1/31/16% SRY%(Sex<%Determining%Region%of%the%Y% chromosome)%Gene% % •  Males:%In%the%7 %week%of% development,%the%SRY#gene%on%the% SRY Y%chromosome%ac9vates%a% gene number%of%genes,%and%the%gonads% develop%as%testes.% % •  Females:%With%no%SRY%gene,% gonads%develop%as%ovaries%by% Y default.% •  Detect%presence/absence%of%SRY% to%determine%sex% X 43% Ques9ons?% 44% 15%

Buy Material

Are you sure you want to buy this material for

25 Karma

Buy Material

BOOM! Enjoy Your Free Notes!

We've added these Notes to your profile, click here to view them now.

You're already Subscribed!

Looks like you've already subscribed to StudySoup, you won't need to purchase another subscription to get this material. To access this material simply click 'View Full Document'

Why people love StudySoup

Steve Martinelli UC Los Angeles

"There's no way I would have passed my Organic Chemistry class this semester without the notes and study guides I got from StudySoup."

Amaris Trozzo George Washington University

"I made $350 in just two days after posting my first study guide."

Bentley McCaw University of Florida

"I was shooting for a perfect 4.0 GPA this semester. Having StudySoup as a study aid was critical to helping me achieve my goal...and I nailed it!"

Parker Thompson 500 Startups

"It's a great way for students to improve their educational experience and it seemed like a product that everybody wants, so all the people participating are winning."

Become an Elite Notetaker and start selling your notes online!

Refund Policy

All subscriptions to StudySoup are paid in full at the time of subscribing. To change your credit card information or to cancel your subscription, go to "Edit Settings". All credit card information will be available there. If you should decide to cancel your subscription, it will continue to be valid until the next payment period, as all payments for the current period were made in advance. For special circumstances, please email

StudySoup has more than 1 million course-specific study resources to help students study smarter. If you’re having trouble finding what you’re looking for, our customer support team can help you find what you need! Feel free to contact them here:

Recurring Subscriptions: If you have canceled your recurring subscription on the day of renewal and have not downloaded any documents, you may request a refund by submitting an email to

Satisfaction Guarantee: If you’re not satisfied with your subscription, you can contact us for further help. Contact must be made within 3 business days of your subscription purchase and your refund request will be subject for review.

Please Note: Refunds can never be provided more than 30 days after the initial purchase date regardless of your activity on the site.