86P Supply the missing organic and/or inorganic

Problem 1P Explain each statement in terms of atomic properties: (a)Carbon engages in covalent rather than ionic bonding. (b)Carbon has four bonds in all its organic compounds. (c)Carbon forms neither stable cations, like many metals, nor stable anions, like many nonmetals. (d)Carbon bonds to itself more extensively than does any other element. (e)Carbon forms stable multiple bonds.

Problem 2P Carbon bonds to many elements other than itself. (a)Name six elements that commonly bond to carbon in organic compounds. (b)Which of these elements are heteroatoms? (c)Which of these elements are more electronegative than carbon? Less electronegative? (d)How does bonding of carbon to heteroatoms increase the number of organic compounds?

Problem 5P (a) What structural feature is associated with each type of hydrocarbon: an alkane; a cycloalkane; an alkene; an alkyne? (b)Give the general formula for each type. (c)Which hydrocarbons are considered saturated?

Problem 6P Define each type of isomer: (a) constitutional; (b) geometric; (c) optical. Which types of isomers are stereoisomers?

Problem 3P Silicon lies just below carbon in Group 4A(14) and also forms four covalent bonds. Why aren't there as many silicon compounds as carbon compounds?

Problem 8P Which objects are asymmetric (have no plane of symmetry): (a) a circular clock face; (b) a football; (c) a dime; (d) a brick; (e) a hammer; (f) a spring?

Problem 7P Among alkenes, alkynes, and aromatic hydrocarbons, only alkenes exhibit cis-trans isomerism. Why don't the others?

Problem 9P Draw all possible skeletons for a 7-C compound with (a)A 6-C chain and 1 double bond (b)A 5-C chain and 1 double bond (c)A 5-C ring and no double bonds

Problem 4P Which of these bonds to carbon would you expect to be relatively reactive: C—H, C—C, C—I, C=O, C—Li? Explain.

Problem 10P Draw all possible skeletons for a 6-C compound with (a)A 5-C chain and 2 double bonds (b)A 5-C chain and 1 triple bond (c)A 4-C ring and no double bonds

Problem 12P Add the correct number of hydrogens to each of the skeletons in Problem 15.15.

Problem 11P Add the correct number of hydrogens to each of the skeletons in Problem 15.14.

Draw correct structures, by making a single change, for any that are incorrect:

Draw correct structures, by making a single change, for any that are incorrect:

Draw the structure or give the name of each compound: (a) \(2,3\)-dimethyloctane (b) \(1\)-ethyl-\(3\)-methylcyclohexane Equation Transcription: Text Transcription: 2,3 1 3

Problem 17P Each of the following names is wrong. Draw structures based on them, and correct the names: (a) 4-methylhexane ________________ (b) 2-ethylpentane ________________ (c) 2-methylcyclohexane ________________ (d) 3,3-methyl-4-ethyloctane

Each of the following compounds can exhibit optical activity. Circle the \(chiral\) center(s) in each: Equation Transcription: Text Transcription: chiral

Problem 21P Draw structures from the following names, and determinewhich compounds are optically active: (a) 3-bromohexane ________________ (b) 3-chloro-3-methylpentane ________________ (c) 1,2-dibromo-2-methylbutane

Draw the structure or give the name of each compound:

Problem 18P Each of the following names is wrong. Draw structures based on them, and correct the names: (a) 3,3-dimethylbutane ________________ (b) 1.1,1-trimethylheptane ________________ (c) 1,4-diethylcyclopentane ________________ (d) 1-propylcyclohexane

Each of the following compounds can exhibit optical activity. Circle the \(chiral\) center(s) in each: Equation Transcription: Text Transcription: chiral

Problem 22P Draw structures from the following names, and determine which compounds are optically active: (a) 1,3-dichloropcntane ________________ (b) 3-chloro-2,2,5-trimcthylhcxane ________________ (c) 1 -bromo-1 -chlorobutane

Problem 26P Which compounds exhibit geometric isomerism? Draw and name the two isomers in each case: (a) 1-pentene ________________ (b) 2-pentene ________________ (c) 1-chloropropene ________________ (d) 2-chloropropene

Which of the following structures exhibit geometric isomerism? Draw and name the \(two\) isomers in each case: Equation Transcription: Text Transcription: two

Problem 25P Which compounds exhibit geometric isomerism? Draw and name the two isomers in each case: (a) propene ________________ (b) 3-hexene ________________ (c) 1,1-dichloroethene ________________ (d) 1,2-dichloroethene

Problem 27P Draw and name all the constitutional isomers of dichlorobenzene.

Problem 28P Draw and name all the constitutional isomers of trimethylbenzene.

Which of the following structures exhibit geometric isomerism? Draw and name the \(two\) isomers in each case: Equation Transcription: Text Transcription: two

Problem 29P Butylated hydroxytoluene (BHT) is a common preservative added to cereals and other dry foods. Its systematic name is 1-hydroxy-2,6-di-tert-buty1-4-methylbenzene (where "tert-butyl" is 1,1-dimethylethyl). Draw the structure of BHT.

Problem 30P There are two compounds with the name 2-methyl-3-hexene, but only one with the name 2-methyl-2-hexene. Explain with structures.

Determine the type of each of the following reactions:

Problem 31P Any tetrahedral atom with four different groups attached can be a chiral center. Which of these species is optically active? (a)CHClBrF (b)NBrCl2H+ (c)PFClBrI+ (d)SeFClBrH

Determine the type of each of the following reactions:

Problem 34P Write equations for the following: (a) an addition reaction between H2O and 3-hexene (H+ is a catalyst); (b) an elimination reaction between 2-bromopropane and hot potassium ethoxide, CH3—CH2—OK (KBr and ethanol are also products); (c) a light-induced substitution reaction between Cl2 and ethane to form 1,1-dichloroethane.

Problem 35P Write equations for the following: (a) a substitution reaction between 2-bromopropane and KI; (b) an addition reaction between cyclohexene and Cl2; (c) an addition reaction between 2-propanone and H2 (Ni metal is a catalyst).

Phenylethylamine is a natural substance that is structurally similar to amphetamine. It is found in sources as diverse as almond oil and human urine, where it occurs at elevated concentrations as a result of stress and certain forms of schizophrenia. One method of synthesizing the compound for pharmacological and psychiatric studies involves \(two\) steps: Classify each step as an addition, elimination, or substitution. Equation Transcription: Text Transcription: two

Problem 37P Compounds with nearly identical molar masses often have very different physical properties. Choose the compound with the higher value for each of the following properties, and explain your choice. (a)Solubility in water: chloroethane or methylethylamine (b)Melting point: diethyl ether or 1-butanol (c)Boiling point: trimethylamine or propylamine

Fill in each blank with a general formula for the type of compound formed:

Problem 39P Why does the C = O group react differently from the C = C group? Show an example of the difference.

Problem 40P Many substitution reactions involve an initial electrostatic attraction between reactants. Show where this attraction arises in the formation of an amide from an amine and an ester.

Problem 41P What reaction type is common to the formation of esters and acid anhydrides? What is the other product?

Problem 43P Name the type of organic compound from the following description of its functional group: (a) polar group that has only single bonds and does not include O or N; (b) group that is polar and has a triple bond; (c) group that has single and double bonds and is acidic in water; (d) group that has a double bond and must be at the end of a C chain.

Problem 44P Name the type of organic compound from the following description of its functional group: (a) N-containing group with single and double bonds; (b) group that is not polar and has a double bond; (c) polar group that has a double bond and cannot be at the end of a C chain; (d) group that has only single bonds and is basic in water.

Problem 42P Both alcohols and carboxylic acids undergo substitution, but the processes are very different. Explain.

Circle and name the functional group(s) in each compound:

Problem 47P Draw all alcohols with the formula C5H12O.

Circle and name the functional group(s) in each compound:

Problem 48P Draw all aldehydes and ketones with the formula C5H10O.

Problem 50P Draw all carboxylic acids with the formula C5H10O2.

Problem 49P Draw all amines with the formula C4H11N.

Problem 52P Draw the organic product formed when the following compounds undergo a substitution reaction: (a) acetic acid and 1-hexanol; (b) propanoic acid and dimethylamine; (c) ethanoic acid and diethylamine.

Draw condensed formulas for the carboxylic acid and amine portions of the following amides:

Fill in the expected organic substances:

Problem 51P Draw the organic product formed when the following compounds undergo a substitution reaction: (a) acetic acid and methylamine; (b) butanoic acid and 2-propanol; (c) formic acid and 2-methyl-1-propanol.

Draw condensed formulas for the carboxylic acid and alcohol portions of the following esters:

Problem 57P (a) Draw the four isomers of C5H12O that can be oxidized to an aldehyde, (b) Draw the three isomers of C5H12O that can be oxidized to a ketone, (c) Draw the isomers of C5H12O that cannot be easily oxidized to an aldehyde or ketone, (d) Name any isomer that is an alcohol.

Problem 59P Name the reaction processes that lead to the two types ofsynthetic polymers.

Ethyl formate is added to foods to give them the flavor of rum. How would you synthesize ethyl formate from ethanol, methanol, and any inorganic reagents?

Problem 63P Which functional groups react to form nylons? Polyesters?

Problem 62P Which of the two types of synthetic polymer is more similar chemically to biopolymers? Explain.

Problem 60P Which functional group occurs in the monomers of addition polymers? How are these polymers different from one another?

Draw an abbreviated structure for the following polymers, with brackets around the repeat unit:

Draw an abbreviated structure for the following polymers, with brackets around the repeat unit:

Problem 61P Which intermolecular force is primarily responsible for the different types of polyethylene? Explain.

Write a balanced equation for the reaction of the monomer dihydroxydimethylsilane (\(below\)) to form the condensation polymer known as Silly Putty. Equation Transcription: Text Transcription: below

Problem 68P Which type of polymer is formed from each of the following monomers: (a) amino acids; (b) alkenes; (c) simple sugars; (d) mononucleotides?

Problem 69P What is the key structural difference between fibrous and globular proteins? How is it related, in general, to the proteins' amino acid composition?

Problem 70P Protein shape, function, and amino acid sequence are interrelated. Which determines which?

Problem 71P What is base pairing? How does it pertain to DNA structure?

Problem 74P Draw the structure of each of the following tripeptides: (a)Aspartic acid-histidine-tryptophan (b)Glycine-cysteine-tyrosine with the charges existing in cell fluid

Problem 73P Draw the R group of (a) glycine; (b) isoleucine; (c) tyrosine.

Problem 72P Draw the R group of (a) alanine; (b) histidine; (c) methionine.

Problem 76P Write the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences: (a) TTAGCC ________________ (b) AGACAT

Problem 77P Write the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences: (a) GGTTAC ________________ (b) CCCGAA

Problem 75P Draw the structure of each of the following tripeptides: (a)Lysine-phenylalanine-threonine (b)Alanine-leucine-valine with the charges that exist in cell fluid

Pyrethrins, such as jasmolin \(?\) (\(below\)), are a group of natural compounds synthesized by flowers of the genus Chrysanthemum (known as pyrethrum flowers) to act as insecticides. (a) Circle and name the functional groups in jasmolin ?. (b) What is the hybridization of the numbered carbons? (c) Which, if any, of the numbered carbons are chiral centers? Equation Transcription: Text Transcription: II below

Problem 82P Compound A is branched and optically active and contains C, H, and O. (a) A 0.500-g sample bums in excess O2 to yield 1.25 g of CO2 and 0.613 g of H2O. Determine the empirical formula, (b) When 0.225 g of compound A vaporizes at 755 torr and 97°C, the vapor occupies 78.0 mL. Determine the molecular formula, (c) Careful oxidation of the compound yields a ketone. Name and draw compound A, and circle the chiral center.

Problem ?86P Supply the missing organic and/or inorganic substances:

Problem 79P Amino acids have an average molar mass of 100 g/mol. How many bases on a single strand of DNA are needed to code for a protein with a molar mass of 5×105 g/mol?

Problem 84P The genetic code consists of a series of three-base words that each code for a given amino acid. (a)Using the selections from the genetic code shown below, determine the amino acid sequence coded by the following segment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG = methionine CCU = proline CAU = histidine UGG = tryptophan AAG = lysine UAU = tyrosine GCC = alanine UUG = leucine CGG = arginine UGU = cysteine AAC = asparagine ACA = threonine UCC = serine GCA = alanine UCA = serine (b)What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?

Protein shapes are maintained by a variety of forces that arise from interactions between the amino-acid \(R\) groups. Name the amino acid that possesses each \(R\) group and the force that could arise in each of the following interactions: Equation Transcription: Text Transcription: R

Sodium propanoate is a common preservative found in breads, cheeses, and pies. How would you synthesize sodium propanoate from 1-propanol and any inorganic reagents?