The genetic code consists of a series of three-base words that each code for a given

Give the names and formulas of two carbon compounds that are organic and two that are inorganic.

Through the first quarter of the 19th century, the concept of vitalismthat a key difference existed between substances isolated from animate sources and those from inanimate sources was widely accepted. What was the central notion of vitalism? Give an example of a finding that led to its eventual downfall.

Explain each statement in terms of atomic properties: (a) Carbon engages in covalent rather than ionic bonding. (b) Carbon has four bonds in all its organic compounds. (c) Carbon forms neither stable cations, like many metals, nor stable anions, like many nonmetals. (d) Carbon bonds to itself more extensively than does any other element. (e) Carbon forms stable multiple bonds.

Carbon bonds to many elements other than itself. (a) Name six elements that commonly bond to carbon in organic compounds. (b) Which of these elements are heteroatoms? (c) Which of these elements are more electronegative than carbon? Less electronegative? (d) How does bonding of carbon to heteroatoms increase the number of organic compounds?

Silicon lies just below carbon in Group 4A(14) and also forms four covalent bonds. Why arent there as many silicon compounds as carbon compounds?

What is the range of oxidation states for carbon? Name a compound in which carbon has its highest oxidation state and one in which it has its lowest.

Which of these bonds to carbon would you expect to be relatively reactive: CH, CC, CI, CoeO, CLi? Explain. (Sample Problems 15.1 and 15.2)

(a) What structural feature is associated with each type of hydrocarbon: an alkane; a cycloalkane; an alkene; an alkyne? (b) Give the general formula for each type. (c) Which hydrocarbons are considered saturated?

Define each type of isomer: (a) constitutional; (b) geometric; (c) optical. Which types of isomers are stereoisomers?

Among alkenes, alkynes, and aromatic hydrocarbons, only alkenes exhibit cis-trans isomerism. Why dont the others?

Which objects are asymmetric (have no plane of symmetry): (a) a circular clock face; (b) a football; (c) a dime; (d) a brick; (e) a hammer; (f) a spring?

Explain how a polarimeter works and what it measures.

How does an aromatic hydrocarbon differ from a cycloalkane in terms of its bonding? How does this difference affect structure? (grouped in similar pairs)

Draw all possible skeletons for a 7-C compound with (a) A 6-C chain and 1 double bond (b) A 5-C chain and 1 double bond (c) A 5-C ring and no double bonds

Draw all possible skeletons for a 6-C compound with (a) A 5-C chain and 2 double bonds (b) A 5-C chain and 1 triple bond (c) A 4-C ring and no double bonds

Add the correct number of hydrogens to each of the skeletons in Problem 15.14.

Add the correct number of hydrogens to each of the skeletons in Problem 15.15.

Draw correct structures, by making a single change, for any that are incorrect: (a) (b) (c) (d)

Draw correct structures, by making a single change, for any that are incorrect: (a) (b) (c) (d)

Draw the structure or give the name of each compound: (a) 2,3-dimethyloctane (b) 1-ethyl-3-methylcyclohexane (c) (d)

Draw the structure or give the name of each compound: (a) (b) (c) 1,2-diethylcyclopentane (d) 2,4,5-trimethylnonane

Each of the following names is wrong. Draw structures based on them, and correct the names: (a) 4-methylhexane (b) 2-ethylpentane (c) 2-methylcyclohexane (d) 3,3-methyl-4-ethyloctane

Each of the following names is wrong. Draw structures based on them, and correct the names: (a) 3,3-dimethylbutane (b) 1,1,1-trimethylheptane (c) 1,4-diethylcyclopentane (d) 1-propylcyclohexane

Each of the following compounds can exhibit optical activity. Circle the chiral center(s) in each: (a) (b)

Each of the following compounds can exhibit optical activity. Circle the chiral center(s) in each: (a) (b)

Draw structures from the following names, and determine which compounds are optically active: (a) 3-bromohexane (b) 3-chloro-3-methylpentane (c) 1,2-dibromo-2-methylbutane

Draw structures from the following names, and determine which compounds are optically active: (a) 1,3-dichloropentane (b) 3-chloro-2,2,5-trimethylhexane (c) 1-bromo-1-chlorobutane

Which of the following structures exhibit geometric isomerism? Draw and name the two isomers in each case: (a) (b) (c)

Which of the following structures exhibit geometric isomerism? Draw and name the two isomers in each case: (a) (b) (c)

Which compounds exhibit geometric isomerism? Draw and name the two isomers in each case: (a) propene (b) 3-hexene (c) 1,1-dichloroethene (d) 1,2-dichloroethene

Which compounds exhibit geometric isomerism? Draw and name the two isomers in each case: (a) 1-pentene (b) 2-pentene (c) 1-chloropropene (d) 2-chloropropene

Draw and name all the constitutional isomers of dichlorobenzene.

Draw and name all the constitutional isomers of trimethylbenzene.

Butylated hydroxytoluene (BHT) is a common preservative added to cereals and other dry foods. Its systematic name is 1- hydroxy-2,6-di-tert-butyl-4-methylbenzene (where tert-butyl is 1,1-dimethylethyl). Draw the structure of BHT.

There are two compounds with the name 2-methyl- 3-hexene, but only one with the name 2-methyl-2-hexene. Explain with structures.

Any tetrahedral atom with four different groups attached can be a chiral center. Which of these species is optically active? (a) CHClBrF (b) NBrCl2H_ (c) PFClBrI_ (d) SeFClBrH

The number of peaks in the 1H-NMR spectrum of a compound depends on the number of different kinds (environments) of H atoms. How many peaks appear in the spectrum of each isomer of C4H10 and of C5H12 (see Table 15.3, p. 638)? (Sample Problem 15.3)

In terms of numbers of reactant and product substances, which organic reaction type corresponds to (a) a combination reaction, (b) a decomposition reaction, (c) a displacement reaction?

The same type of bond is broken in an addition reaction and formed in an elimination reaction. Name the type.

Can a redox reaction also be an addition, elimination, or substitution reaction? Explain with examples. (grouped in similar pairs)

Determine the type of each of the following reactions: (a) (b)

Determine the type of each of the following reactions: (a) (b)

Write equations for the following: (a) an addition reaction between H2O and 3-hexene (H_ is a catalyst); (b) an elimination reaction between 2-bromopropane and hot potassium ethoxide, CH3CH2OK (KBr and ethanol are also products); (c) a light-induced substitution reaction between Cl2 and ethane to form 1,1-dichloroethane.

Write equations for the following: (a) a substitution reaction between 2-bromopropane and KI; (b) an addition reaction between cyclohexene and Cl2; (c) an addition reaction between 2-propanone and H2 (Ni metal is a catalyst).

Based on the number of bonds and the nature of the bonded atoms, state whether each of the following changes is an oxidation or a reduction:

Based on the number of bonds and the nature of the bonded atoms, state whether each of the following changes is an oxidation or a reduction: (a) (b) (c)

Is the organic reactant oxidized, reduced, or neither in each of the following reactions? (a) (b)

Is the organic reactant oxidized, reduced, or neither in each of the following reactions? (a) (b)

Phenylethylamine is a natural substance that is structurally similar to amphetamine. It is found in sources as diverse as almond oil and human urine, where it occurs at elevated concentrations as a result of stress and certain forms of schizophrenia. One method of synthesizing the compound for pharmacological and psychiatric studies involves two steps: Classify each step as an addition, elimination, or substitution. (Sample Problems 15.4 to 15.7)

Compounds with nearly identical molar masses often have very different physical properties. Choose the compound with the higher value for each of the following properties, and explain your choice. (a) Solubility in water: chloroethane or methylethylamine (b) Melting point: diethyl ether or 1-butanol (c) Boiling point: trimethylamine or propylamine

Fill in each blank with a general formula for the type of compound formed:

Of the three major types of organic reactions, which do not occur readily with benzene? Why?

Why does the C O group react differently from the C C group? Show an example of the difference.

Many substitution reactions involve an initial electrostatic attraction between reactants. Show where this attraction arises in the formation of an amide from an amine and an ester.

Although both carboxylic acids and alcohols contain an OH group, one is acidic in water and the other is not. Explain.

What reaction type is common to the formation of esters and acid anhydrides? What is the other product?

Both alcohols and carboxylic acids undergo substitution, but the processes are very different. Explain. (grouped in similar pairs)

Name the type of organic compound from the following description of its functional group: (a) polar group that has only single bonds and does not include O or N; (b) group that is polar and has a triple bond; (c) group that has single and double bonds and is acidic in water; (d) group that has a double bond and must be at the end of a C chain.

Name the type of organic compound from the following description of its functional group: (a) N-containing group with single and double bonds; (b) group that is not polar and has a double bond; (c) polar group that has a double bond and cannot be at the end of a C chain; (d) group that has only single bonds and is basic in water.

Circle and name the functional group(s) in each compound:

Circle and name the functional group(s) in each compound: (a) (b) (c) (d) (e)

Draw all alcohols with the formula C5H12O.

Draw all aldehydes and ketones with the formula C5H10O.

Draw all amines with the formula C4H11N.

Draw all carboxylic acids with the formula C5H10O2.

Draw the product resulting from mild oxidation of (a) 2- butanol; (b) 2-methylpropanal; (c) cyclopentanol.

Draw the alcohol youd oxidize to produce (a) 2-methylpropanal; (b) 2-pentanone; (c) 3-methylbutanoic acid.

Draw the organic product formed when the following compounds undergo a substitution reaction: (a) acetic acid and methylamine; (b) butanoic acid and 2-propanol; (c) formic acid and 2-methyl-1-propanol.

Draw the organic product formed when the following compounds undergo a substitution reaction: (a) acetic acid and 1-hexanol; (b) propanoic acid and dimethylamine; (c) ethanoic acid and diethylamine.

Draw condensed formulas for the carboxylic acid and alcohol that form the following esters: (a) (b) (c)

Draw condensed formulas for the carboxylic acid and amine that form the following amides: (a) (b) (c)

Fill in the expected organic substances: (a) (b)

Fill in the expected organic substances: (a) (b)

Supply the missing organic and/or inorganic substances: (a) (b)

Supply the missing organic and/or inorganic substances: (a) (b) CH3 CH3 Cl CH CH3 CH CH2 ? CH3 CH CH2

(a) Draw the four isomers of C5H12O that can be oxidized to an aldehyde. (b) Draw the three isomers of C5H12O that can be oxidized to a ketone. (c) Draw the isomers of C5H12O that cannot be easily oxidized to an aldehyde or ketone. (d) Name any isomer that is an alcohol.

Ethyl formate is added to foods to give them the flavor of rum. How would you synthesize ethyl formate from ethanol, methanol, and any inorganic reagents?

Name the reaction processes that lead to the two types of synthetic polymers.

Which functional group occurs in the monomers of addition polymers? How are these polymers different from one another?

What is a free radical? How is it involved in polymer formation?

Which intermolecular force is primarily responsible for the different types of polyethylene? Explain.

Which of the two types of synthetic polymer is more similar chemically to biopolymers? Explain.

Which functional groups react to form nylons? Polyesters? (grouped in similar pairs)

Draw an abbreviated structure for the following polymers, with brackets around the repeat unit: (a) Poly(vinyl chloride) (PVC) from (b) Polypropylene from

Draw an abbreviated structure for the following polymers, with brackets around the repeat unit: (a) Teflon from (b) Polystyrene from

Polyethylene terephthalate (PET) is used to make synthetic fibers, such as Dacron, thin films, such as Mylar, and bottles for carbonated beverages. PET is produced from ethylene glycol and either of two monomers, depending on whether the reaction proceeds by dehydration-condensation or by displacement. Write equations for the two syntheses. (Hint: The displacement is reversed by adding methanol to PET at high T and P.)

Write a balanced equation for the reaction of dihydroxydimethylsilane (right) to form the condensation polymer known as Silly Putty.

Which type of polymer is formed from each of the following monomers: (a) amino acids; (b) alkenes; (c) simple sugars; (d) mononucleotides?

What is the key structural difference between fibrous and globular proteins? How is it related, in general, to the proteins amino acid composition?

Protein shape, function, and amino acid sequence are interrelated. Which determines which?

What linkage joins the monomers in each strand of DNA?

What is base pairing? How does it pertain to DNA structure?

RNA base sequence, protein amino acid sequence, and DNAbase sequence are interrelated. Which determines which in the process of protein synthesis? (grouped in similar pairs)

Draw the R group of (a) alanine; (b) histidine; (c) methionine.

Draw the R group of (a) glycine; (b) isoleucine; (c) tyrosine.

Draw the structure of each of the following tripeptides: (a) Aspartic acid-histidine-tryptophan (b) Glycine-cysteine-tyrosine with the charges existing in cell fluid

Draw the structure of each of the following tripeptides: (a) Lysine-phenylalanine-threonine (b) Alanine-leucine-valine with the charges that exist in cell fluid

Write the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences: (a) TTAGCC (b) AGACAT

Write the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences: (a) GGTTAC (b) CCCGAA

Write the base sequence of the DNA template from which this RNA sequence was derived: UGUUACGGA. How many amino acids are coded for in this sequence?

Write the base sequence of the DNA template from which this RNA sequence was derived: GUAUCAAUGAACUUG. How many amino acids are coded for in this sequence?

Protein shapes are maintained by a variety of forces that arise from interactions between the amino-acid R groups. Name the amino acid that possesses each R group and the force that could arise in each of the following interactions: (a) (b) (c) (d)

Amino acids have an average molar mass of 100 g/mol. How many bases on a single strand of DNA are needed to code for a protein with a molar mass of 5 105 g/mol?

A synthesis of 2-butanol was performed by treating 2-bromobutane with hot sodium hydroxide solution. The yield was 60%, indicating that a significant portion of the reactant was converted into a second product. Predict what this other product might be. What simple test would support your prediction?

Ethers (general formula ROR) have many important uses. Until recently, methyl tert-butyl ether (MTBE, right) was used as an octane booster and fuel additive for gasoline. It increases the oxygen content of the fuel, which reduces CO emissions. MTBE is synthesized by the catalyzed reaction of 2-methylpropene with methanol. (a) Write a balanced equation for the synthesis of MTBE. (Hint: Alcohols add to alkenes similarly to the way water does.) (b) If the government required that auto fuel mixtures contain 2.7% oxygen by mass to reduce CO emissions, how many grams of MTBE would have to be added to each 100. g of gasoline? (c) How many liters of MTBE would be in each liter of fuel mixture? (The density of both gasoline and MTBE is 0.740 g/mL.) (d) How many liters of air (21% O2 by volume) are needed at 24_C and 1.00 atm to fully combust 1.00 L of MTBE?

An alcohol is oxidized to a carboxylic acid, and 0.2003 g of the acid is titrated with 45.25 mL of 0.03811 M NaOH. (a) What is the molar mass of the acid? (b) What are the molar mass and molecular formula of the alcohol?

Some of the most useful compounds for organic synthesis are Grignard reagents (general formula R MgX, where X is a halogen), which are made by combining an alkyl halide, R X, with Mg. They are used to change the carbon skeleton of a starting carbonyl compound in a reaction similar to that with R Li: (a) What is the product, after a final step with water, of the reaction between ethanal and the Grignard reagent of bromobenzene? (b) What is the product, after a final step with water, of the reaction between 2-butanone and the Grignard reagent of 2-bromopropane? (c) There are often two (or more) combinations of Grignard reagent and carbonyl compound that will give the same product. Choose another pair of reactants to give the product in (a). (d) What carbonyl compound must react with a Grignard reagent to yield a product with the OH group at the end of the carbon chain? (e) What Grignard reagent and carbonyl compound would you use to prepare 2-methyl-2-butanol?

Starting with the given organic reactant and any necessary inorganic reagents, explain how you would perform each of the following syntheses: (a)From , make (b)From , make

Compound A, composed of C, H, and O, is heated in a 1.00-L flask to 160._C until all of the A has vaporized and displaced the air. The flask is then cooled, and 2.48 g of A remains. When 0.500 g of A burns in O2, 0.409 g of H2O and 1.00 g of CO2 are produced. Compound A is not acidic, but it can be oxidized to compound B, which is weakly acidic: 1.000 g of B is neutralized with 33.9 mL of 0.5 M sodium hydroxide. When B is heated to 260_C, it gives off water and forms C, whose solution in CDCl3 (where D is deuterium, 2H) has one peak in its 1H-NMR spectrum. (a) What are the structures of A, B, and C? (b) Compound A is a controlled substance because it is metabolized to the weakly acidic date rape drug GHB, C4H8O3. What are the structure and name of GHB?

Cadaverine (1,5-diaminopentane) and putrescine (1,4- diaminobutane) are two compounds that are formed by bacterial action and are responsible for the odor of rotting flesh. Draw their structures. Suggest a series of reactions to synthesize putrescine from 1,2-dibromoethane and any inorganic reagents.

Pyrethrins, such as jasmolin II (below), are a group of natural compounds synthesized by flowers of the genus Chrysanthemum (known as pyrethrum flowers) to act as insecticides. (a) Circle and name the functional groups in jasmolin II. (b) What is the hybridization of the numbered carbons? (c) Which, if any, of the numbered carbons are chiral centers?

Compound A is branched and optically active and contains C, H, and O. (a) A 0.500-g sample burns in excess O2 to yield 1.25 g of CO2 and 0.613 g of H2O. Determine the empirical formula. (b) When 0.225 g of compound A vaporizes at 755 torr and 97_C, the vapor occupies 78.0 mL. Determine the molecular formula. (c) Careful oxidation of the compound yields a ketone. Name and draw compound A, and circle the chiral center.

Ibuprofen is one of the most common anti-inflammatory drugs. (a) Identify the functional group(s) and chiral center(s) in ibuprofen. (b) Write a four-step synthesis of a racemic mixture of ibuprofen from 4-isobutylbenzaldehyde, using inorganic reactants and one organometallic reactant (see Problem 15.107).

Combustion of gasoline releases almost all of the carbon it contains as CO2, the major greenhouse gas. As a simplification, assume that gasoline consists of eight-C alkanes (average d _ 0.74 g/mL). How many metric tons of CO2 are released in a year by an SUV that gets 15 mpg and is driven 18,000 miles?

Which features of retinal make it so useful as a photon absorber in the visual systems of organisms?

The polypeptide chain in proteins does not exhibit free rotation because of the partial double-bond character of the peptide bond. Explain this fact with resonance structures.

Other nonmetals form compounds that are structurally analogous to those of carbon, but these inorganic compounds are usually more reactive. Predict any missing products and write balanced equations for each reaction: (a) the decomposition and chlorination of diborane to boron trichloride; (b) the combustion of pentaborane (B5H9) in O2; (c) the addition of water to bor-azines double bonds (B3N3H6, Figure 14.9B, p. 583) (Hint: The OH group bonds to B); (d) the hydrolysis of trisilane (Si3H8) to silica (SiO2) and H2; (e) the complete halogenation of disilane with Cl2; (f) the thermal decomposition of H2S5 to hydrogen sulfide and sulfur molecules; (g) the hydrolysis of PCl5.

The genetic code consists of a series of three-base words that each code for a given amino acid. (a) Using the selections from the genetic code shown below, determine the amino acid sequence coded by the following segment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG _ methionine CCU _ proline CAU _ histidine UGG _ tryptophan AAG _ lysine UAU _ tyrosine GCC _ alanine UUG _ leucine CGG _ arginine UGU _ cysteine AAC _ asparagine ACA_ threonine UCC _ serine GCA_ alanine UCA_ serine (b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?

In addition to their use in water treatment, ion-exchange resins are used to extract Au, Ag, and Pt ions from solution. One of the most common resins consists of a polymer with a benzene-containing backbone to which sulfonic acid groups ( SO3 H) are then added. (a) What monomer can be used to prepare the polymer backbone? (b) This polymer typically contains 416% crosslinking. Draw the structure of the benzenecontaining monomer used to crosslink the polymer.

Complete hydrolysis of a 100.00-g sample of a peptide gave the following amounts of individual amino acids (molar masses, in g/mol, appear in parentheses): 3.00 g of glycine (75.07) 0.90 g of alanine (89.10) 3.70 g of valine (117.15) 6.90 g of proline (115.13) 7.30 g of serine (105.10) 86.00 g of arginine (174.21) (a) Why does the total mass of amino acids exceed the mass of peptide? (b) What are the relative numbers of amino acids in the peptide? (c) What is the minimum molar mass of the peptide?

Aircraft de-icing agents, such as propylene glycol [1,2- propanediol; CH3CH(OH)CH2OH; d_1.036 g/mL], are used to remove ice and snow prior to winter flights, but their presence in runoff depletes O2 in natural waters. (a) Write a balanced equation for the complete oxidation of propylene glycol by O2. (b) What is the theoretical oxygen demand, in grams of O2 required per gram of propylene glycol oxidized? (c) What is the theoretical oxygen demand, in grams of O2 required per liter of solution, of 90.0% by volume aqueous propylene glycol?

2-Butanone is reduced by hydride ion donors, such as sodium borohydride (NaBH4), to the alcohol 2-butanol. Even though the alcohol has a chiral center, the product isolated from the redox reaction is not optically active. Explain.

Biphenyl consists of two benzene rings connected by a single bond. When Cl atoms substitute for some of the H atoms, polychlorinated biphenyls (PCBs) are formed. There are over 200 different PCBs, but only six with one Cl on each ring. Draw these constitutional isomers.

Wastewater from a cheese factory has the following composition: 8.0 g/L protein (C16H24O5N4); 12 g/L carbohydrate (CH2O); and 2.0 g/L fat (C8H16O). What is the total organic carbon (TOC) of the wastewater in g of C/L?